Application of miRNA detection reagent in preparation of kit for Alzheimer disease diagnosis

Abstract

The invention relates to application of a miRNA detection reagent in preparation of a kit for Alzheimer's disease diagnosis. The miRNA is selected from hsa-miR-96-5p, hsa-miR-32-5p and hsa-miR-95-3p, and the miRNA is selected from the group consisting of hsa-miR-96-5p, according to the present invention, the found miRNA marker combination significantly changes in the AD early stage, and the diagnosis model constructed based on the ratio shows the high area under the curve (AUC), the high sensitivity and the high specificity in the independent verification queue, such that the good application prospect is provided.

Description

Technical Field

[0001] This application relates to the field of molecular diagnostic technology, and in particular to the application of miRNA detection reagents in the preparation of kits for the diagnosis of Alzheimer's disease. Background Technology

[0002] Alzheimer's disease (AD) is the most common neurodegenerative disease and a leading cause of dementia in older adults. Its pathological process begins decades before clinical symptoms appear; therefore, early diagnosis is crucial for slowing disease progression and implementing effective interventions.

[0003] Currently, the clinical diagnosis of Alzheimer's disease (AD) mainly relies on clinical symptom assessment, neuropsychological tests, and imaging examinations (such as MRI and PET). However, these methods lack sensitivity and specificity in the early stages of the disease, and PET examinations are expensive. While the detection of biomarkers such as Aβ42 and pTau in cerebrospinal fluid (CSF) has high accuracy, lumbar puncture is an invasive procedure with low patient acceptance, making it difficult to use for large-scale screening. In recent years, peripheral blood biomarkers have become a research hotspot due to their non-invasiveness and ease of acquisition. Blood miRNAs are stable and associated with pathological changes in the central nervous system, making them highly promising diagnostic biomarkers for AD. However, the diagnostic efficacy of existing single blood miRNA biomarkers is limited, and the screening of combined biomarkers and their clinical application models still need further optimization to achieve high-precision identification in earlier stages of the disease (such as the preclinical stage and the mild cognitive impairment (MCI) stage). Therefore, there is an urgent need in this field to develop a novel non-invasive detection method based on peripheral blood, with high sensitivity and specificity, suitable for the early diagnosis of AD. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of miRNA detection reagents in the preparation of kits for the diagnosis of Alzheimer's disease.

[0006] The first objective of this invention is to provide the use of a reagent for detecting miRNA in the preparation of a kit for the diagnosis of Alzheimer's disease.

[0007] A second objective of this invention is to provide a kit for the diagnosis of Alzheimer's disease.

[0008] To achieve the above objectives, the present invention is implemented through the following technical solution: This invention claims protection for the use of miRNA detection reagents in the preparation of kits for the diagnosis of Alzheimer's disease, wherein the miRNAs are hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p.

[0009] hsa-miR-96-5p:UUUGGCACUAGCACAUUUUUGCU (SEQ ID NO: 1); hsa-miR-32-5p:UAUUGCACAUUACUAAGUUGCA (SEQ ID NO: 2); hsa-miR-95-3p:UUCAACGGGUAUUUAUUGAGCA (SEQ ID NO:3).

[0010] Preferably, the miRNA further comprises an internal reference miRNA.

[0011] More preferably, the miRNA detection reagent is a primer for detecting miRNA.

[0012] A kit for the diagnosis of Alzheimer's disease, containing the miRNA detection reagent described in 3.

[0013] More preferably, it also contains qPCR reagents, reverse transcription primers, reverse transcription reagents, or exogenous internal reference miRNA.

[0014] More preferably, the exogenous internal reference miRNA is cel-miR-39-3p.

[0015] cel-miR-39-3p:UCACCGGGUGUAAAUCAGCUUG.

[0016] More preferably, the primers for detecting miRNA are one or more of the forward primers with nucleotide sequences as shown in SEQ ID NO:9 to 11.

[0017] More preferably, the primer for detecting miRNA further contains an internal reference forward primer with a nucleotide sequence as shown in SEQ ID NO: 12.

[0018] More preferably, the reverse transcription primer is one or more of the reverse transcription primers with nucleotide sequences as shown in SEQ ID NO:5 to 7.

[0019] More preferably, the reverse transcription primer further contains an internal reference reverse transcription primer with a nucleotide sequence as shown in SEQ ID NO: 8.

[0020] More preferably, it also contains a universal reverse primer with a nucleotide sequence as shown in SEQ ID NO: 13.

[0021] More preferably, it also contains an MGB probe, the 5' end of which is modified with 6-FAM and the 3' end with NFQ and MGB.

[0022] As a specific implementation, the nucleotide sequence of the MGB probe is shown in SEQ ID NO: 14.

[0023] More preferably, the kit diagnoses Alzheimer's disease using a diagnostic model, which is: Ratio = (ΔCt1 × ΔCt2) / ΔCt3, where ΔCt1 is the difference in Ct value between hsa-miR-96-5p and the internal reference, ΔCt2 is the difference in Ct value between hsa-miR-32-5p and the internal reference, and ΔCt3 is the difference in Ct value between hsa-miR-95-3p and the internal reference.

[0024] As a specific implementation, a Ratio ≥ 5.0 indicates the sample is positive for Alzheimer's disease, and a Ratio < 5.0 indicates the sample is negative for Alzheimer's disease. At this threshold, the present invention exhibits extremely high discriminative power (sensitivity 90.0%, specificity 100%) and an accuracy of 95.0%, fully demonstrating the good generalization ability and reliability of this diagnostic model.

[0025] Compared with the prior art, the present invention has the following beneficial effects: 1. Early detection and high accuracy: The miRNA biomarker combination discovered in this invention shows significant changes in the early stages of AD. The diagnostic model built based on its ratio shows high area under the curve (AUC), sensitivity and specificity in independent validation cohorts, which is superior to most reported single or small miRNA combinations.

[0026] 2. Non-invasive and convenient: The test sample is peripheral blood serum or plasma, which is easy to collect and non-invasive, and patients have good compliance. It is very suitable for large-scale population screening and regular monitoring.

[0027] 3. Simple operation and low cost: Based on mature multiplex qRT-PCR technology, the detection process is standardized, time-saving, and cost is significantly lower than imaging or cerebrospinal fluid detection methods, making it easy to promote in clinical laboratories.

[0028] 4. Novel biomarkers: The application of the selected combination of hsa-miR-96-5p, hsa-miR-32-5p and hsa-miR-95-3p in the early diagnosis of AD is a first-time proposal and is innovative. Attached Figure Description

[0029] Figure 1 This is the ROC curve for queue 2. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0031] In the following examples, sample queue 1, queue 2 and queue 3 are three independent queues that do not repeat or overlap.

[0032] The samples were obtained from the HaploSmithKline laboratory and all were obtained with the consent of the individuals who provided the samples. The early-stage AD patients and healthy controls included met the diagnostic and staging criteria in the "Revised Criteria for Diagnosis and Staging of Alzheimer's Disease (2024) (DOl: 10.1002 / alz.13859)" recently released by the National Institute on Aging and the Alzheimer's Association (NIA-AA).

[0033] Example 1: High-throughput data analysis I. Experimental Methods Bioinformatics analysis was performed on peripheral blood miRNA expression profiles of Alzheimer's disease patients (AD) and healthy controls (HC) from the public database (GEO). Combined with the machine LASSO regression learning algorithm, candidate miRNAs with expression differences between the AD group and the control group were preliminarily screened.

[0034] Subsequently, NGS was performed on cohort 1 (30 cases of early AD and 30 cases of HC) collected by our company to analyze the expression changes of each candidate miRNA.

[0035] II. Experimental Results The results showed that hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p were the optimal combination of the present invention. The optimal cut-off value was determined to be 6.10 by ROC curve analysis. The sensitivity was 85.0% (17 / 20), the specificity was 90.0% (19 / 20), the accuracy was 90.0% (36 / 40), and the AUC was 0.94.

[0036] hsa-miR-96-5p:UUUGGCACUAGCACAUUUUUGCU (SEQ ID NO: 1); hsa-miR-32-5p:UAUUGCACAUUACUAAGUUGCA (SEQ ID NO: 2); hsa-miR-95-3p:UUCAACGGGUAUUUAUUGAGCA (SEQ ID NO:3).

[0037] Example 2: RT-qPCR detection of serum samples I. Experimental Methods Serum samples were collected from 20 patients diagnosed with early-stage Alzheimer's disease (AD) and 20 age- and sex-matched healthy controls (HC), for a total of 40 cases as cohort 2.

[0038] miRNAs were extracted from each sample in cohort 2 using the miRNeasy Serum / Plasma Advanced Kit (cat:217204, QIAGEN). cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG, SEQ ID NO:4) from the RNA Spike-In Kit for RT (cat:339390, QIAGEN) was added as an exogenous internal control. cDNA was synthesized using a commercial miRNA stem-loop reverse transcription kit (reverse transcription primers are shown in Table 1).

[0039] Table 1

[0040] Subsequently, commercial RT-qPCR kits were used to detect hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p by qPCR. Primer and probe sequences for detecting hsa-miR-96-5p, hsa-miR-32-5p, hsa-miR-95-3p, and cel-miR-39-3p were designed and synthesized, as shown in Table 2.

[0041] Table 2:

[0042] Using the primers and probes in Table 2, qRT-PCR was performed on hsa-miR-96-5p, hsa-miR-32-5p and hsa-miR-95-3p of each sample to obtain the Ct value of each miRNA.

[0043] Calculate ΔCt = Ct target miRNA - Ct cel-miR-39-3p Then calculate the Ratio value for each sample using the formula: Ratio = (ΔCt) miR-96-5p × ΔCt miR-32-5p ) / ΔCt miR-95-3p .

[0044] II. Experimental Results The original ΔCt values ​​and calculated Ratio values ​​for each sample are shown in Table 3.

[0045]

[0046] The 40 samples were sorted from largest to smallest Ratio value. Each Ratio value was then used as a diagnostic threshold, and its corresponding sensitivity (true positive rate) and 1-specificity (false positive rate) were calculated. See [link to relevant documentation]. Figure 1 The optimal cut-off value was determined to be 6.10 by ROC curve analysis. The sensitivity was 85.0% (17 / 20), the specificity was 90.0% (19 / 20), the accuracy was 90.0% (36 / 40), and the AUC was 0.94.

[0047] Additionally, using (ΔCt) miR-96-5p / ΔCt miR-32-5p ) / ΔCt miR-95-3p The Ratio' value for each sample was calculated, and an ROC curve was constructed. The AUC value was 0.3050, which is lower than 0.5, indicating that the indicator has poor efficacy in distinguishing between the HC group and the AD group. Using (ΔCt) miR-96-5p × ΔCt miR-95-3p ) / ΔCt miR-32-5p The Ratio'' value for each sample was calculated, and an ROC curve was established. The AUC value was 0.690. When the threshold was set to 2.97, the sensitivity was 70% and the specificity was 65%. The model has a certain judgment ability, but the sensitivity and specificity are not good.

[0048] Compared with the above results, using (ΔCt) miR-96-5p × ΔCt miR-32-5p ) / ΔCt miR-95-3p The calculated Ratio value has significant advantages in sensitivity and specificity when used to distinguish AD patients from healthy controls.

[0049] Example 3 RT-qPCR detection of serum samples I. Experimental Methods Twenty patients with early-stage Alzheimer's disease (AD) and twenty healthy controls were included in cohort 3. The three samples from cohort 3 were tested according to the method described in Example 3, and a cut-off value of 5.0 was used for judgment: a ratio ≥ 5.0 was considered AD positive, and a ratio < 5.0 was considered negative (HC).

[0050] II. Experimental Results The original ΔCt values ​​and calculated Ratio values ​​for each sample are shown in Tables 4 and 5. The calculated performance metrics are: Sensitivity = 90.0% (18 / 20), Specificity = 100% (20 / 20), and Accuracy = 95.0% (38 / 40).

[0051] Table 4

[0052] Table 5

[0053] In summary, the diagnostic model for Alzheimer's disease established using hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p exhibits extremely high discriminative power (sensitivity 90.0%, specificity 100%) and accuracy 95.0% at a fixed threshold (Ratio=5.0), fully demonstrating the good generalization ability and reliability of this diagnostic model.

[0054] Example 4: A diagnostic kit for early Alzheimer's disease I. Composition 1. Exogenous internal reference cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG); 2. The hsa-miR-96-5p stem-loop reverse transcription primer shown in SEQ ID NO:5, the hsa-miR-32-5p stem-loop reverse transcription primer shown in SEQ ID NO:6, the hsa-miR-95-3p stem-loop reverse transcription primer shown in SEQ ID NO:7, and the cel-miR-39-3p stem-loop reverse transcription primer shown in SEQ ID NO:8; 3. The hsa-miR-96-5p forward primer shown in SEQ ID NO:9, the hsa-miR-32-5p forward primer shown in SEQ ID NO:10, the hsa-miR-95-3p forward primer shown in SEQ ID NO:11, and the cel-miR-39-3p forward primer shown in SEQ ID NO:12; 4. The universal reverse primer shown in SEQ ID NO:13; 5. The MGB probe shown in SEQ ID NO:14 has 6-FAM modified at its 5' end and NFQ and MGB modified at its 3' end; 6. miRNA stem-loop reverse transcription reagent; 7. qPCR reagents.

[0055] II. Instructions for Use Serum samples were collected for testing, and miRNAs were extracted from the serum samples. An exogenous internal control, cel-miR-39-3p, was added. cDNA was synthesized using the stem-loop reverse transcription primers and miRNA stem-loop reverse transcription reagents shown in SEQ ID NO:5 to 8. qRT-PCR was performed on hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p of each sample using the stem-loop reverse transcription primers shown in SEQ ID NO:9 to 12, the universal reverse primer shown in SEQ ID NO:13, the MGB probe shown in SEQ ID NO:14, and qPCR reagents to obtain the Ct values ​​of each miRNA.

[0056] Calculate ΔCt = Ct target miRNA - Ct cel-miR-39-3p Then calculate the Ratio value for each sample using the formula: Ratio = (ΔCt) miR-96-5p × ΔCt miR-32-5p ) / ΔCt miR-95-3p .

[0057] III. Result Judgment A ratio ≥ 5.0 indicates AD positivity, while a ratio < 5.0 indicates HC positivity.

Claims

1. The application of a miRNA detection reagent in the preparation of a kit for the diagnosis of Alzheimer's disease, characterized in that, The miRNAs are hsa-miR-96-5p, hsa-miR-32-5p, and hsa-miR-95-3p.

2. The application according to claim 1, characterized in that, The miRNA also includes an internal reference miRNA.

3. The application according to claim 1 or 2, characterized in that, The miRNA detection reagent is a primer for detecting miRNA.

4. A reagent kit for diagnosing Alzheimer's disease, characterized in that, The reagent for detecting miRNA contains any one of the claims 1 to 3.

5. The reagent kit according to claim 4, characterized in that, It also contains qPCR reagents, reverse transcription primers, reverse transcription reagents, or exogenous internal reference miRNA.

6. The reagent kit according to claim 4, characterized in that, The exogenous internal reference miRNA is cel-miR-39-3p.

7. The reagent kit according to claim 4, characterized in that, The primers for detecting miRNA are one or more of the forward primers with nucleotide sequences as shown in SEQ ID NO:9 to 11.

8. The reagent kit according to claim 4, characterized in that, The primers for detecting miRNA also contain an internal reference primer with a nucleotide sequence as shown in SEQ ID NO:

12.

9. The reagent kit according to claim 5, characterized in that, The reverse transcription primer is one or more of the reverse transcription primers with nucleotide sequences as shown in SEQ ID NO: 5 to 7.

10. The reagent kit according to claim 5, characterized in that, The kit diagnoses Alzheimer's disease using a diagnostic model, which is: Ratio = (ΔCt1 × ΔCt2) / ΔCt3, where ΔCt1 is the difference in Ct value between hsa-miR-96-5p and the internal reference, ΔCt2 is the difference in Ct value between hsa-miR-32-5p and the internal reference, and ΔCt3 is the difference in Ct value between hsa-miR-95-3p and the internal reference. A ratio ≥ 5.0 indicates the sample is positive for Alzheimer's disease, while a ratio < 5.0 indicates the sample is negative for Alzheimer's disease.

Images