Alzheimer disease biomarker signal amplification detection biosensor based on InP quantum dot and miRNA triggered DNA walker, and preparation method and application thereof

Abstract

The invention discloses an Alzheimer's disease biomarker signal amplification detection biosensor based on InP quantum dots and a miRNA triggered DNA walker as well as a preparation method and application of the Alzheimer's disease biomarker signal amplification detection biosensor. The biosensor comprises an InP / ZnSe / ZnS QDs (at) MPA fluorescent probe with high luminescence property and a DNA modified magnetic microsphere (MB-DNA-Walker), wherein the fluorescent probe is synthesized by a low-temperature nucleation-high-temperature shell growth method, and is prepared by a ligand exchange combined photodynamic reaction process. During detection, the target miR-574 activates the MB-DNA-Walker, a large number of BHQ1-DNA chains complementary with the quantum dot probe are released under the action of endonuclease, and after the BHQ1-DNA is combined with the probe, the fluorescence intensity is reduced through a quenching effect; each miR-574 can be used for activating a plurality of MB-DNA-Walker and starting a signal amplification cascade, so that the efficient amplification of a fluorescence signal is realized. The detection limit is as low as 0.19 pM, the cell sample detection result is highly consistent with RT-PCR, and a new scheme is provided for the fields of early diagnosis of Alzheimer's disease and biomedical detection.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology, specifically relating to a biosensor for amplifying and detecting Alzheimer's disease biomarker signals based on InP quantum dots and miRNA-triggered DNA walkers, its preparation method, and its application. Background Technology

[0002] Alzheimer's disease (AD) is an insidious and irreversible progressive neurodegenerative disease characterized by the deposition of β-amyloid (Aβ) protein and tau protein tangles in the brain, leading to neuronal damage and cognitive and behavioral impairments. With the accelerating aging of the global population, the incidence of AD continues to rise, posing a serious challenge to the physical and mental health of the elderly and the social healthcare system. Because early symptoms of AD are atypical and the disease progression is irreversible, early diagnosis and intervention are crucial for clinical treatment. However, existing detection methods have significant limitations: cognitive function assessment is highly subjective and has limited diagnostic accuracy; imaging equipment such as magnetic resonance imaging (MRI) and positron emission tomography (PET) are expensive and complex to operate, making them difficult to widely apply for early screening.

[0003] In recent years, studies have found that some abnormally expressed microRNAs (miRNAs) in peripheral blood can regulate the production and clearance of Aβ and the phosphorylation of tau protein, becoming potential biomarkers for the early diagnosis of Alzheimer's disease (AD). Among them, miR-574-5p is closely related to the pathogenesis of AD. However, miRNAs are low in abundance and easily degraded in biological samples, posing a significant challenge to their highly sensitive and specific detection.

[0004] Quantum dots (QDs), as novel fluorescent labeling materials, have shown broad application prospects in the field of biomarker detection due to their tunable photoluminescence, excellent photostability, and biofunctionalizable surface. However, traditional II-VI group cadmium-based quantum dots have potential toxicity, limiting their biomedical applications. While cadmium-free quantum dots, represented by indium phosphide (InP), have solved the toxicity problem, they are sensitive to environmental factors such as water and oxygen. Surface modification can easily lead to abnormal exciton recombination within them, and the stress accumulation caused by lattice mismatch at the core-shell interface is not conducive to the growth of high-quality thick shells. This results in insufficient quantum yield, stability, and biocompatibility, making it difficult to meet the needs of accurate detection.

[0005] DNA walkers, as a type of DNA nanomachine with signal amplification capabilities, achieve highly sensitive detection of low-abundance biomolecules through target-specific activation. Their core principle is that after the target molecule activates the walker, it moves along a pre-defined DNA track and cleaves the substrate DNA, generating a detectable signal amplification effect. Among these, 3D DNA walkers have become the preferred technology for miRNA detection due to their higher walking efficiency and signal amplification capabilities. However, existing 3D DNA walkers mostly rely on traditional fluorescent labeling materials, resulting in problems such as poor signal stability and insufficient detection sensitivity. Furthermore, they lack effective integration with high-performance cadmium-free quantum dots, making it difficult to achieve accurate and efficient detection of AD-related miRNAs.

[0006] In summary, developing an integrated detection system based on high-quality InP core-shell quantum dots and a 3D DNA walker to address the problems of low sensitivity, insufficient specificity, high equipment dependence, and material toxicity / stability defects in existing AD biomarker detection is of great significance for promoting the development of early AD diagnostic technology. Summary of the Invention

[0007] This invention aims to address the technical problems of the short sequence and low expression level of miR-574, a potential biomarker for Alzheimer's disease, the insufficient sensitivity and specificity of existing detection methods, and the toxicity defects of traditional quantum dots. It provides a biosensor for amplifying and detecting Alzheimer's disease biomarkers based on InP quantum dots and miRNA-triggered DNA walkers, along with its preparation method and applications. This invention overcomes the technical bottleneck of existing low-abundance biomarker detection, meets the demand for precise biomarker detection, and improves detection efficiency and accuracy.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A biosensor for amplifying and detecting Alzheimer's disease signals based on InP quantum dots and a miRNA-triggered DNA walker includes a fluorescent probe and a DNA walker. The fluorescent probe is InP / ZnSe / ZnS QDs@MPA@DNA, prepared by covalently coupling InP / ZnSe / ZnS QDs@MPA with the DNA sequence NH2-GCAGGAGTCATACCATGTGTAGATATGACT after activation by EDC / sulfo-NHS. The DNA walker uses carboxyl magnetic microspheres as a carrier, with the surface modified with double-stranded DNA and a supporting DNA strand. The double-stranded DNA is formed by the walking DNA strand and the protective DNA strand, wherein the supporting DNA strand sequence is NH2-TTTTTTAGCTCAGGATCCTCATATGACTCCTGCTAGAGA--BHQ1, the walking DNA strand sequence is NH2-TTTTTTTTTTTTTTTTTTTTTTTTTTTGATCCTGAGTGTGTTTTTTTT, and the protective DNA strand sequence is AAAAAAACACACTCACACACACACACTCA (as shown in SEQ ID NO). As shown in .1).

[0009] The method for preparing the above-mentioned biosensor includes the following steps: (1) Preparation of InP / ZnSe / ZnS QDs@MPA@DNA: a. Mix InP / ZnSe / ZnS QDs, ammonia, butanol, and 3-MPA precursor at 55-65℃ for 20-30 h until complete separation. After complete separation, irradiate the lower layer of QDs aqueous solution with UV light at 70-80℃ for 35-45 minutes to redissolve it in water. Add acetonitrile and centrifuge. Resuspend the centrifuged InP / ZnSe / ZnS QDs@MPA in water for later use. b. Add EDC and sulfo-NHS to Hepes buffer, then add InP / ZnSe / ZnS QDs@MPA, and sonicate at 2-5℃. After washing, centrifuge, collect the precipitate and react with DNA at 35-38℃ for 1-3 h, then wash and centrifuge. Resuspend the prepared InP / ZnSe / ZnS QDs@MPA@DNA in Hepes buffer to obtain a 0.2-0.3 mg / mL fluorescent probe solution, store at 2-5℃ for later use. The DNA sequence is NH2-GCAGGAGTCATACCATGTGTAGATATGACT. (2) Preparation of DNA walkers: The carboxyl magnetic microsphere solution was washed with PBS buffer, and EDC solution and sulfo-NHS solution were added. The mixture was stirred and activated at 35-38℃ for 20-40 min. After magnetic separation and washing, the microspheres were resuspended in PBS buffer to obtain a carboxyl magnetic microsphere suspension of 0.2-0.3 mg / mL. The walking strand DNA and the protecting strand DNA were mixed and incubated at 35-38℃ for 1-3 h to form double-stranded DNA. The double-stranded DNA was thoroughly mixed with the supporting strand, and the above carboxyl magnetic microsphere suspension was added. The mixture was stirred and reacted at 35-38℃ for 5-7 h. The DNA walkers were obtained by magnetic separation and dispersed in Hepes buffer for later use.

[0010] Further, in step a, the concentration of InP / ZnSe / ZnS QDs is 5~15 mg / mL, the 3-MPA precursor is composed of 3-MPA and ZnCl2 solution in a volume ratio of 4:1, the final concentration of ZnCl2 in the precursor is 0.6~1 mmol / L, the volume ratio of InP / ZnSe / ZnS QDs, ammonia, butanol and the precursor is 2:2:1:1, and the wavelength of UV light irradiation is 350~380 nm.

[0011] Further, in step b, the Hepes buffer has a pH of 10 and a concentration of 20-30 mmol / L, the InP / ZnSe / ZnSQDs@MPA concentration is 5-15 mg / mL, the EDC concentration is 0.2-0.25 mol / L, the sulfo-NHS concentration is 0.08-0.1 mol / L, the DNA concentration is 5-15 mmol / L, and the volume ratio of InP / ZnSe / ZnS QDs@MPA, DNA, EDC, and sulfo-NHS is 2:2:1:1. Further, in step (2), the concentration of the carboxyl magnetic microsphere solution is 4~6 mg / mL, the concentration of EDC is 0.05~0.15 mol / L, the concentration of sulfo-NHS is 0.2~0.5 mol / L, and the volume ratio of the carboxyl magnetic microsphere solution, EDC, and sulfo-NHS is 1:10:10; the activation conditions for the carboxyl magnetic microspheres are stirring at 37±2℃ for 25~35 minutes, the molar ratio of walking strand DNA, protecting strand DNA, and supporting strand DNA is 1:2:30, the concentrations of walking strand DNA, protecting strand DNA, and supporting strand DNA are all 9~11 μM, and the volume ratio of the carboxyl magnetic microsphere suspension, supporting strand, and double-stranded DNA is 20:10:1; the pH of the PBS buffer is 7.4 and the concentration is 0.01~0.02 mol / L; the pH of the Hepes buffer is 10 and the concentration is 20~30 mmol / L, and the volume of the Hepes buffer and the volume of the PBS buffer resuspended in the PBS buffer are 10~ ... The buffer solutions have the same volume.

[0012] The application of the above-mentioned biosensor in detecting miRNA-574 includes the following steps: (1) Add gradient concentrations of target miRNA-574 and Nt.BsmAI enzyme to the DNA walker, incubate at 37±1℃ for 1-3 hours, collect the intermediate DNA containing BHQ1 by magnetic separation, and disperse it in Hepes buffer; incubate the intermediate DNA and fluorescent probe at 37±1℃ for 1-2 hours, measure the fluorescence intensity at an excitation wavelength of 450 nm, establish a standard curve with the concentration of target miRNA-574 as the abscissa and the fluorescence intensity as the ordinate, and obtain the standard curve equation; (2) Add the test sample containing the target miRNA-574 to the DNA walker, then add Nt.BsmAI enzyme, and measure the fluorescence intensity at an excitation wavelength of 450 nm according to step (1). Substitute the fluorescence intensity into the standard curve equation to obtain the concentration of the target miRNA-574 in the test sample.

[0013] Further, in step (1), the concentration range of target miRNA-574 is 0.01 pM to 1000 pM, the volume ratio of DNA walker, target miRNA-574 and fluorescent probe is 1:10:1, and 0.1 to 1 UNt.BsmAI enzyme is required for every 100 μL of target miRNA-574.

[0014] Furthermore, the standard curve covers two linear ranges: the linear equation is F=55843.405-24265.807C when the range is 0.01~1.0 pM; and the linear equation is F=30788.648-4.490C when the range is 10~1000 pM.

[0015] The application of the above-mentioned biosensors in the preparation of early diagnostic kits for Alzheimer's disease.

[0016] Detection Principle: A signal amplification sensor for the AD biomarker (miR-574-5p) was designed based on high-quality InP core-shell quantum dots and magnetic microspheres, combined with enzyme-assisted amplification technology (3D DNA walker). First, high-quality, green, and environmentally friendly InP / ZnSe / ZnS core-shell quantum dots were synthesized using a "low-temperature nucleation and high-temperature shell growth" method. Combining thermodynamic and kinetic growth, ligand exchange was performed on the hydrophobic quantum dots, followed by kinetic growth to prepare a high-quality hydrophilic InP / ZnSe / ZnS quantum dot@MPA probe with DNA modification. Second, the 3D DNA walker uses magnetic nanoparticles with good magnetic orientation and manipulability as its carrier. Under the combined action of the target miR-574 and the Nt.A1WI cleavage enzyme, the MBs-DNA-Walker is activated, releasing a substrate fragment containing the complementary InP@MPA@NH2-DNA sequence (BHQ1-DNA). The 3D DNA Walker's protector strand captures the target miR-574-5p, activating the 3D DNA Walker to begin its journey. When the walking strand pairs complementary with the BHQ1-modified support, a cleavage site specific to the Nt.A1WI cleavage enzyme is generated. Nt.A1WI cleaves the support, producing a large number of BHQ1-containing intermediates. Finally, the BHQ1-containing intermediates pair complementary with InP / ZnSe / ZnS QDs@MPA@NH2-DNA. At this point, the fluorescence of InP / ZnSe / ZnS QDs@MPA@NH2-DNA is in a low-fluorescence state (off state). The fluorescence intensity changes with the target concentration, establishing a linear relationship between the target and fluorescence intensity. This sensor not only ensures the specificity of the miR-574 reaction but also provides a significantly enhanced signal, thereby greatly improving detection sensitivity.

[0017] The present invention has the following beneficial effects:

[0018] Highly sensitive and specific detection: Utilizing the enzyme-assisted signal amplification effect of DNA walkers and combined with high-luminescence InP quantum dot probes, ultrasensitive detection of miR-574-5p is achieved with a detection limit as low as 0.19 pM; relying on the specific recognition mechanism of complementary nucleic acid base pairing, it can effectively distinguish target molecules from interfering molecules, resulting in excellent detection specificity.

[0019] Simple to operate and highly efficient in detection: Integrating the targeted enrichment and magnetic separation properties of magnetic microspheres, the detection process can be performed without washing, simplifying the experimental procedure and reducing the difficulty of operation; each target molecule can activate multiple DNA walkers and start signal amplification, which greatly shortens the detection time and improves the detection efficiency, making it suitable for batch sample screening.

[0020] High clinical translational value and strong versatility: The detection results of actual cell samples are highly consistent with the clinical gold standard RT-PCR technology, which has good clinical application prospects and can help with the early diagnosis and efficacy monitoring of Alzheimer's disease; The technical framework of "cadmium-free quantum dots + DNA walker" is versatile and can be extended to the detection of other low-abundance biomolecules by replacing the target sequence of the probe, providing a new technical path for the field of biomedical detection. Attached Figure Description

[0021] Figure 1 A schematic diagram illustrating the principle of InP / ZnSe / ZnS QDs@MPA and MBs-DNA-Walker for detecting miRNA-574-5p.

[0022] Figure 2 Preparation process of InP / ZnSe / ZnS@MPA@DNA quantum dots (A); transmission electron microscope images of hydrophobic quantum dots (B) and water-soluble quantum dots (C); time-resolved photoluminescence spectrum of water-soluble InP / ZnSe / ZnS@MPA quantum dots (D); Fourier transform infrared spectrum of InP / ZnSe / ZnS quantum dots and InP / ZnSe / ZnS@MPA quantum dots (E); ultraviolet (F) and fluorescence (G) spectra of hydrophobic InP / ZnSe / ZnS quantum dots and InP / ZnSe / ZnS@MPA quantum dots, and photographs of hydrophobic quantum dots and InP / ZnSe / ZnS@MPA under room light (F inset) and 365 nm ultraviolet light (G inset) (top layer: H2O; bottom layer: n-octane).

[0023] Figure 3Structural characterization of InP / ZnSe / ZnS@MPA@DNA and MBs-DNA-Walker: fluorescence spectra before and after the addition of FAM-DNA (A); dynamic light scattering (DLS) measurements (B), zeta potential (C), UV fluorescence (D), and electrophoresis analysis (E) of InP / ZnSe / ZnS@MPA and InP / ZnSe / ZnS@MPA@DNA; UV-Vis absorption spectrum (F), electrophoresis analysis (G), and fluorescence spectra after the addition of S-Cy3 or W-Cy3 (H) of MBs-DNA-Walker. Figure 4 shows the feasibility study of the scheme design (Control is buffer solution only); Figure 5 Linear relationship between miRNA-574-5p concentration and systemic fluorescence intensity in the range of 0.01 pM to 1 pM (A); Linear relationship between miRNA-574-5p concentration and systemic fluorescence intensity in the range of 10 pM to 1000 pM (B). Figure 6 This is due to the specificity of the scheme.

[0024] Figure 7 This is a correlation graph between real sample clinical results and the test results of this protocol. Detailed Implementation

[0025] All DNA samples used in this application are commercially available products.

[0026] (I) Preparation and characterization of InP / ZnSe / ZnS QDs@MPA

[0027] Two mL of InP / ZnSe / ZnS quantum dots (10 mg / mL), 2 mL of ammonia, 1 mL of butanol, and 1 mL of 3-MPA precursor (0.8 mL of 3-mercaptopropionic acid, with a final ZnCl2 concentration of 0.8 mM in the precursor) were mixed at 60 °C for 24 h. After complete separation, the lower layer of the quantum dots aqueous solution was irradiated with UV light (365 nm) at 75 °C for 40 min and redissolved in 2 mL of water. The quantum dots were then resuspended in water by adding 30 mL of acetonitrile and centrifuging to achieve a quantum dot concentration of 10 mg / mL. Given the thermosensitive dynamic equilibrium of ligand adsorption-desorption on the quantum dot surface, the ligand exchange temperature and UV irradiation time were systematically optimized. The optimal reaction temperature was determined to be 75 °C, and the optimal UV irradiation time was 35 min, balancing ligand coupling efficiency and photostability. The prepared InP / ZnSe / ZnS core-shell quantum dots (for detailed preparation process, see Lv Y, Li L, et al. Aminophosphate precursors for the synthesis of near-unityemitting InP quantum dots and their application in liver cancer Diagnosis. Exploration, 2022, 2:20220082. DOI: 10.1002 / EXP.20220082) had an average particle size of 8.23 ​​± 1.65 nm. Figure 2 (B) The average particle size of InP / ZnSe / ZnS@MPA QDs formed by photodynamic growth slightly increased to 9.1 ± 1.63 nm. Figure 2 (C). Fluorescence lifetime is 89.21 ns (C). Figure 2 The presence of both hydrophobic and hydrophilic ligands was verified by Fourier transform infrared spectroscopy. Figure 2Inductively coupled plasma (ICP) analysis further confirmed the ligand exchange efficiency and the thickening of the ZnS substrate, manifested as an increase in the Zn / In and S / P atomic ratios. Optical characterization using UV-Vis and photoluminescence (PL) spectroscopy revealed minimal shifts in the absorption and emission peaks, and the spectral shapes of both InP / ZnSe / ZnS and InP / ZnSe / ZnS@MPA quantum dots remained consistent (Figures 2F-G). The formation of clear, transparent solutions with distinct interfaces provided direct evidence of successful phase transfer. Quantitative analysis showed that the InP / ZnSe / ZnS@MPA quantum dots retained 78.6% of the fluorescence intensity of the parent quantum dots, with photoluminescence quantum yields of 54% and 58.8%, respectively. The water-soluble InP / ZnSe / ZnS@MPA quantum dots also exhibited excellent acid and alkali resistance, thermal stability, and resistance to photobleaching.

[0028] (ii) DNA functionalization modification of InP / ZnSe / ZnS QDs@MPA In 750 μL of 25 mM, pH 10 hydroxyethylpiperazine ethanesulfonic acid (Hepes) buffer, 50 μL of 0.226 M EDC and 50 μL of 0.09 M sulfo-NHS were added, followed by 100 μL of 10 mg / mL InP / ZnSe / ZnSQDs@MPA for activation. The mixture was then sonicated at 4 °C for 10 min. After washing with 25 mM, pH 10 Hepes buffer, the mixture was centrifuged for 30 min, and the precipitate was collected and reacted with 100 μL of 10 mM DNA (5'NH2-GCAGGAGTCATACCATGTGTAGATATGACT3') at 37 °C for 2 h. Subsequently, the mixture was washed with 25 mM, pH 10 Hepes buffer and centrifuged. The prepared InP / ZnSe / ZnS QDs@MPA@DNA was resuspended in 4 mL of 25 mM, pH 10 Hepes buffer and stored at 4 °C for later use.

[0029] After reacting with 2 μL of 10 nM FAM-modified DNA (FAM-DNA: 5' FAM-GCAGGAGTCATATCTAC3') complementary to 10 μL InP / ZnSe / ZnS QDs@MPA@DNA at 37 °C for 2 h, the precipitate was centrifuged three times in a high-speed centrifuge (20,000 rpm), and the supernatant was discarded. The precipitate was redispersed in 300 μL of 25 mM, pH 10 Hepes buffer, and fluorescence was measured. A broadened fluorescence peak was observed in the InP / ZnSe / ZnS@MPA@DNA and FAM-DNA systems, which was attributed to the spectral overlap between FAM (emission wavelength 518 nm) and InP / ZnSe / ZnS@MPA@DNA (emission wavelength 530 nm) (Figure 3A). Dynamic light scattering (DLS) measurements showed that the average particle size increased from 96.46 nm (InP / ZnSe / ZnS@MPA) to 148.4 nm (InP / ZnSe / ZnS@MPA@DNA; Figure 3B). After DNA ligation, the zeta potential changed from -50.6 mV to -33.3 mV (Figure 3C). UV fluorescence analysis showed that ligation with single-stranded DNA did not affect the optical properties of the InP / ZnSe / ZnS@MPA QDs (Figure 3D). In electrophoretic analysis (Figure 3E), the migration rate of the sample in lane 2 (InP / ZnSe / ZnS@MPA@DNA) was significantly lower than that in lane 1 (the original InP / ZnSe / ZnS@MPA quantum dots). This decrease in electrophoretic mobility is attributed to the increased particle size resulting from the binding of single-stranded DNA-NH2 to the InP / ZnSe / ZnS@MPA quantum dots. In summary, these results confirm that single-stranded DNA was successfully coupled with biocompatible InP / ZnSe / ZnS@MPA QDs.

[0030] (III) Preparation of DNA-functionalized carboxyl magnetic microspheres (MBs-DNA-Walker) 10 μL of 5 mg / mL carboxyl magnetic microspheres (325 nm particle size, BBI, 100 mg, model J904AA0001) were washed three times with 1 mL of 0.01 M, pH 7.4 phosphate-buffered saline (PBS). Then, 100 μL of a mixed solution of 100 mM EDC and 100 μL of 300 mM sulfo-NHS was added, and the mixture was stirred at 37 °C for 30 min to activate the microspheres. After magnetic separation and washing (the entire process was performed on a magnetic rack: the carboxyl magnetic nanoparticle suspension was placed on the magnetic rack for 30 s to 2 min to allow the particles to adhere to the rack, the supernatant was aspirated, and then 500 μL of PBS (0.01 M, pH 7.4) was added and gently agitated until completely dispersed. The mixture was then magnetically collected again and the liquid was discarded. This cycle was repeated three times, with the last cycle involving aspirating as much residual liquid as possible before removing the microspheres from the magnetic field), and resuspended in 200 μL of PBS buffer (0.01 M, pH 7.4). 20 μL of 10 μM walking strand (Walking: NH2-TTTTTTTTTTTTTTTTTTTTTTTTTTTGATCCTGAGTGTGTTTTTTTT) and 40 μL of 10 μM protecting strand (Protect: AAAAAAACACACTCACACACACACACTCA, as shown in SEQ ID NO. 1) were mixed and incubated at 37°C for 2 h to form double-stranded DNA (dsDNA). 10 μL of this dsDNA was then thoroughly mixed with 100 μL of 10 μM supporting strand (Support: NH2-TTTTTTAGCTCAGGATCCTCATATGACTCCTGCTAGAGA--BHQ1), and 200 μL of the above carboxyl magnetic microsphere suspension was added. The mixture was stirred at 37°C for 6 h, and the MBs-DNA-Walker was obtained by magnetic separation and dispersed in 2 mL of 25 mM, pH 10 Hepes buffer. Transmission electron microscopy analysis showed that the monodisperse spherical particles with an average particle size of 325.26 ± 31.66 nm exhibited a red shift in absorption peak after DNA ligation due to increased size. Dynamic light scattering analysis showed that the absorption peak increased from 321.3 nm to 810.4 nm. Figure 3(F in Figure 3). Electrophoretic analysis confirmed the successful attachment of the DNA (Protect) component to the MB surface (G in Figure 3). To further verify this, 10 μL of MBs-DNA-Walker was taken, and 2 μL of 10 nM S-Cy3 (complementary to the supporting strand: Cy3-CTAGCAGGAGTCATA) and 2 μL of 10 nM W-Cy3 (complementary to the walking strand: Cy3-AACACACTCAGGATC) were added respectively. After reacting at 37℃ for 2 h, the mixture was centrifuged and washed three times (each time with 1 mL of 0.01 M, pH 7.4 PBS buffer), and the supernatant was discarded. The precipitate was redispersed in 300 μL of PBS (pH=7.4, 0.01 M) and fluorescence was measured. Fluorescence spectroscopy analysis of both showed a characteristic emission peak at 570 nm, corresponding to Cy3, which further confirmed the successful assembly of these two DNA components on the surface of the single-molecule magnet. Figure 3 (H). When the magnetic spheres were not coupled with DNA (black), no signal was detected when S-Cy3 and W-Cy3 were added. These multimodal characterization results confirm the successful construction of the 3D DNA walker single-molecule magnet platform.

[0031] (iv) Construction of an Alzheimer's disease signal amplification platform triggered by miRNA-triggered 3D DNA walker 1. Feasibility of the plan: such as Figure 4 The results showed that in the control group lacking either the Nt.A1WI endonuclease or the target miRNA-574, the DNA walker nanomachines failed to function properly, resulting in a plateau-like fluorescence signal. In contrast, when 100 pM of miRNA-574 was added to the reaction system, the protective strand of the 3D DNA walker specifically bound to miRNA-574, triggering the activation of the nanomachines. This activation initiated the movement behavior of the 3D DNA walker: when the walking strand bound to the BHQ1-modified support strand, a recognition site for the Nt.A1WI endonuclease was formed. Subsequently, Nt.A1WI catalyzed the cleavage of the support strand, generating a large number of BHQ1-bound intermediates. These BHQ1-labeled intermediates then bound to InP / ZnSe / ZnS QDs@MPA@DNA, causing fluorescence quenching of the QDs. These results confirm the feasibility of the protocol.

[0032] 2. Establishment of the standard curve: Add 100 μL of 0.01 pM–1000 pM target microRNA-574-5p (miRNA-574-5p) and 0.5 U of Nt.BsmAI enzyme to a 10 μL MBs-DNA-Walker walker system. Incubate at 37°C for 2 h to complete pairing and cleavage, generating intermediate DNA containing the quencher BHQ1 and releasing the walking probe. Obtain a large amount of intermediate DNA by magnetic separation, and finally disperse it in 100 μL of 25 mM, pH 10 Hepes buffer. Incubate this 100 µL of intermediate DNA with 10 µL of InP / ZnSe / ZnS QDs@MPA@DNA probe at 37°C for 1.5 h, and then measure the fluorescence spectrum of the paired product at an excitation wavelength of 450 nm. Figure 5 The fluorescence intensity of InP / ZnSe / ZnS QDs@MPA@DNA showed a concentration-dependent decreasing trend, weakening with increasing miRNA-574 concentration. Two distinct linear detection ranges were observed: for miRNA-574 concentrations between 0.01 pM and 1.0 pM, the linear equation was F = 55843.405 - 24265.807 C (R² = 0.997), with a detection limit of 0.19 pM; for miRNA-574 concentrations between 10 pM and 1000 pM, the equation was F = 30788.648 - 4.490 C (R² = 0.987), with a detection limit of 3.06 pM.

[0033] 3. Specificity and anti-interference: such as Figure 6 To evaluate the specificity of this approach, interfering substances miR-365, miR-141, miR-135, and miR-21 were selected, with the concentration of each interfering miRNA set to 100 times the target miR-574-5p concentration (500 pM). All other procedures and the establishment of the standard curve were identical—this high interference ratio was intended to simulate a complex biological background. Despite the presence of these excessive interfering substances, the DNA nanomachines still exhibited a significant fluorescent response to the perfectly complementary miR-574-5p, with negligible signal cross-reactivity to the interfering species (Figure 6). This result confirms the high target specificity of the nanomachines.

[0034] 4. Real Sample Detection: To further verify the application potential of this protocol in complex samples, RNA was extracted from N2A cells (for details, see Conesa A, Madrigal P, Tarazona S, et al. RNAquality control: assessment and improvement prior to RNA sequencing [J]. Methods, 2020, 183: 47-56. DOI: 10.1016 / j.ymeth.2020.03.011.), and this RNA was used to replace the miR-574-5p (10 pM to 1000 pM) directly added to the above system for detection. The results showed that this protocol is highly comparable to RT-PCR. The linear regression equation between this protocol and RT-PCR was Y = 1.009X -10.634, with a correlation coefficient as high as 0.979 (Figure 7). This also demonstrates that the scheme has high specificity and high efficiency in recognizing target microRNAs in complex systems, which is of great significance for implementing effective prevention strategies and treatments in early diagnosis.

[0035] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the specific implementation of the present invention and not to limit it. Those skilled in the art should understand that any equivalent substitutions or obvious modifications made to the implementation of the present invention without changing its performance or use, without departing from the spirit of the present invention, should be covered within the scope of protection claimed by the present invention.

Claims

1. A biosensor for amplifying and detecting Alzheimer's disease signals based on InP quantum dots and miRNA-triggered DNA walkers, characterized in that, The device includes a fluorescent probe and a DNA walker. The fluorescent probe is InP / ZnSe / ZnS QDs@MPA@DNA, which is prepared by covalently coupling InP / ZnSe / ZnS QDs@MPA with DNA of the sequence NH2-GCAGGAGTCATACCATGTGTAGATATGACT after activation by EDC / sulfo-NHS. The DNA walker uses carboxyl magnetic microspheres as carriers, with the surface modified with double-stranded DNA and supporting DNA. The double-stranded DNA is formed by the walking DNA and the protecting DNA. The supporting DNA sequence is NH2-TTTTTTAGCTCAGGATCCTCATATGACTCCTGCTAGAGA--BHQ1, the walking DNA sequence is NH2-TTTTTTTTTTTTTTTTTTTTTTTTTTTGATCCTGAGTGTGTTTTTTTT, and the protecting DNA sequence is AAAAAAACACACTCACACACACACACTCA.

2. A method for preparing the biosensor according to claim 1, characterized in that, Includes the following steps: (1) Preparation of InP / ZnSe / ZnS QDs@MPA@DNA: a. Mix InP / ZnSe / ZnS QDs, ammonia, butanol, and 3-MPA precursor at 55-65℃ for 20-30 h until complete separation. After complete separation, irradiate the lower layer of QDs aqueous solution with UV light at 70-80℃ for 35-45 minutes to redissolve it in water. Add acetonitrile and centrifuge. Resuspend the centrifuged InP / ZnSe / ZnS QDs@MPA in water for later use. b. Add EDC and sulfo-NHS to Hepes buffer, then add InP / ZnSe / ZnS QDs@MPA, and sonicate at 2~5℃; After washing and centrifugation, the precipitate was collected and reacted with DNA at 35-38℃ for 1-3 h. After washing and centrifugation, the prepared InP / ZnSe / ZnS QDs@MPA@DNA was resuspended in Hepes buffer to obtain a 0.2-0.3 mg / mL fluorescent probe solution, which was stored at 2-5℃ for later use. The DNA sequence was NH2-GCAGGAGTCATACCATGTGTAGATATGACT. (2) Preparation of DNA walker: The carboxyl magnetic microsphere solution was washed with PBS buffer, and EDC solution and sulfo-NHS solution were added. The mixture was stirred at 35~38℃ for 20~40 min to activate it. After magnetic separation and washing, the DNA was resuspended in PBS buffer to obtain a carboxyl magnetic microsphere suspension of 0.2-0.3 mg / mL. The walking strand DNA and the protecting strand DNA were mixed and incubated at 35-38℃ for 1-3 h to form double-stranded DNA. The double-stranded DNA was thoroughly mixed with the supporting strand, and the above carboxyl magnetic microsphere suspension was added. The mixture was stirred at 35-38℃ for 5-7 h. The DNA walker was obtained by magnetic separation and dispersed in Hepes buffer for later use.

3. The preparation method according to claim 2, characterized in that, In step a, the concentration of InP / ZnSe / ZnS QDs is 5~15 mg / mL, the 3-MPA precursor is composed of 3-MPA and ZnCl2 solution in a volume ratio of 4:1, the final concentration of ZnCl2 in the precursor is 0.6~1 mmol / L, the volume ratio of InP / ZnSe / ZnS QDs, ammonia, butanol and precursor is 2:2:1:1, and the wavelength of UV light irradiation is 350~380 nm.

4. The preparation method according to claim 2, characterized in that, In step b, the pH of the Hepes buffer is 10, the concentration is 20-30 mmol / L, the concentration of InP / ZnSe / ZnS QDs@MPA is 5-15 mg / mL, the concentration of EDC is 0.2-0.25 mol / L, the concentration of sulfo-NHS is 0.08-0.1 mol / L, the concentration of DNA is 5-15 mmol / L, and the volume ratio of InP / ZnSe / ZnS QDs@MPA, DNA, EDC, and sulfo-NHS is 2:2:1:

1.

5. The preparation method according to claim 2, characterized in that, In step (2), the concentration of the carboxyl magnetic microsphere solution is 4-6 mg / mL, the concentration of EDC is 0.05-0.15 mol / L, the concentration of sulfo-NHS is 0.2-0.5 mol / L, and the volume ratio of the carboxyl magnetic microsphere solution, EDC, and sulfo-NHS is 1:10:

10. The activation conditions for the carboxyl magnetic microspheres are stirring at 37±2℃ for 25-35 minutes, the molar ratio of walking strand DNA, protective strand DNA, and supporting strand DNA is 1:2:30, the concentration of walking strand DNA, protective strand DNA, and supporting strand DNA is 9-11 μM, and the volume ratio of the carboxyl magnetic microsphere suspension, supporting strand, and double-stranded DNA is 20:10:

1. The pH of the PBS buffer is 7.4 and the concentration is 0.01-0.02 mol / L. The pH of the Hepes buffer is 10 and the concentration is 20-30 mmol / L. The volume of the Hepes buffer is the same as the volume of the PBS buffer resuspended in the PBS buffer.

6. An application of the biosensor according to claim 1 in the detection of miRNA-574, characterized in that, Includes the following steps: (1) Add gradient concentrations of target miRNA-574 and Nt.BsmAI enzyme to the DNA walker, incubate at 37±1℃ for 1-3 hours, collect the intermediate DNA containing BHQ1 by magnetic separation, and disperse it in Hepes buffer; incubate the intermediate DNA and fluorescent probe at 37±1℃ for 1-2 hours, measure the fluorescence intensity at an excitation wavelength of 450 nm, establish a standard curve with the concentration of target miRNA-574 as the abscissa and the fluorescence intensity as the ordinate, and obtain the standard curve equation; (2) Add the test sample containing the target miRNA-574 to the DNA walker, then add Nt.BsmAI enzyme, and measure the fluorescence intensity at an excitation wavelength of 450 nm according to step (1). Substitute the fluorescence intensity into the standard curve equation to obtain the concentration of the target miRNA-574 in the test sample.

7. The application according to claim 6, characterized in that, In step (1), the concentration range of target miRNA-574 is 0.01 pM to 1000 pM, the volume ratio of DNA walker, target miRNA-574 and fluorescent probe is 1:10:1, and 0.1 to 1 U Nt.BsmAI enzyme is required for every 100 μL of target miRNA-574.

8. The application according to claim 6, characterized in that, The standard curve covers two linear ranges: the linear equation is F=55843.405-24265.807C when the range is 0.01~1.0 pM; and the linear equation is F=30788.648-4.490C when the range is 10~1000 pM.

9. The use of the biosensor of claim 1 in the preparation of an early diagnostic kit for Alzheimer's disease.

Images