Application of reagent for detecting tsRNA molecular marker in intestinal mucosa tissue in preparation of Crohn disease diagnostic kit

By detecting the expression of tRF-28-PW5SVP9N1503 in the intestinal mucosal tissue of CD patients and using real-time PCR technology, the sensitivity and specificity problems of Crohn's disease diagnosis have been solved, enabling early and non-invasive CD diagnosis and improving diagnostic accuracy and detection rate.

CN121896348AActive Publication Date: 2026-04-21NINGBO FIRST HOSPITAL
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NINGBO FIRST HOSPITAL
Filing Date
2026-03-24
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Current technologies lack highly sensitive and specific diagnostic methods for Crohn's disease. Traditional serological markers are difficult to distinguish CD from other inflammatory bowel diseases. Imaging examinations are costly and unsuitable for large-scale screening. Colonoscopy is highly invasive and lacks evidence of accuracy.

Method used

tRF-28-PW5SVP9N1503 was used to detect tsRNA molecular markers in intestinal mucosal tissue by quantitative real-time PCR. Specific quantitative real-time PCR primers were designed to detect the expression level of tRF-28-PW5SVP9N1503, and its characteristic of being significantly downregulated in the intestinal mucosal tissue of CD patients was used for early diagnosis.

Benefits of technology

It enables early, non-invasive, and accurate diagnosis of Crohn's disease, with high sensitivity and specificity, effectively distinguishing healthy individuals from CD patients, improving the detection rate, and facilitating early detection and timely treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896348A_ABST
    Figure CN121896348A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue to preparation of a Crohn disease diagnostic kit, the reagent is characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, the sequence of the tsRNA molecular marker is GCCGTGATAGTGGTTAGTACTCT, the reagent for detecting the tsRNA molecular marker in the intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upstream and downstream primers, and the primer sequence of the tsRNA molecular marker in the intestinal mucosa tissue is shown in the description. The upstream primer is AATG CCGTGATCGTATAGTGGTT, and the downstream primer is TATCCTTGTTGACGACTGGTTGAC, and the downstream primer is The method has the advantages that absolute quantitative detection of target molecules can be rapidly and accurately completed only with a small amount of samples, and the method is used for early screening and identification of Crohn's disease and is high in sensitivity and specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of a reagent for detecting tsRNA molecular markers in plasma in the preparation of diagnostic or detection kits for Crohn's disease. Background Technology

[0002] Crohn's disease (CD) is a subtype of inflammatory bowel disease (IBD) that can affect the entire digestive tract from the mouth to the anus. It is characterized by transmural inflammation, which persists even during remission, increasing the risk of complications such as intestinal stricture, perforation, and fistula. However, there is currently no gold standard for the diagnosis of CD, requiring a comprehensive assessment combining clinical manifestations, laboratory tests, imaging studies, endoscopy, and pathological examination. Traditional serological markers lack specificity and are difficult to differentiate CD from other IBDs, therefore they are not recommended by guidelines for the diagnosis of CD. Furthermore, imaging examinations (such as CT and MRI) are costly and unsuitable for large-scale screening and frequent follow-up. Although guidelines recommend colonoscopy as a routine examination for CD diagnosis, treatment evaluation, and disease monitoring, colonoscopy, as an invasive procedure, is not only far more expensive than imaging and serological screening, but also lacks high-quality evidence regarding the accurate time points for assessment.

[0003] With the emergence and development of various testing technologies, the application of non-invasive monitoring methods in the early diagnosis and detection of diseases has rapidly increased. tRNA-derived small RNAs (tsRNAs) are a class of novel non-coding small RNAs produced by the specific cleavage of mature or precursor tRNAs. They are approximately 14-40 nucleotides in length and are widely distributed in eukaryotes and prokaryotes. In recent years, the research value of tsRNAs in digestive system diseases has received increasing attention. tsRNAs have been confirmed to be closely related to the development of esophageal cancer, gastric cancer, and colorectal cancer, demonstrating their broad application prospects as early diagnostic biomarkers. Therefore, exploring and screening tsRNA molecular markers specifically expressed in Crohn's disease is of great significance for achieving early, non-invasive, and accurate diagnosis of Crohn's disease. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a reagent with high sensitivity and high specificity for detecting tsRNA molecular markers in intestinal mucosal tissue and its application in the preparation of Crohn's disease diagnostic kits. tRF-28-PW5SVP9N1503 is significantly downregulated in the intestinal mucosal tissue of CD patients.

[0005] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: the application of a reagent for detecting tsRNA molecular markers in intestinal mucosal tissue in the preparation of Crohn's disease diagnostic kit, wherein the eRNA molecular marker is tRF-28-PW5SVP9N1503, and the nucleotide sequence of tRF-28-PW5SVP9N1503 is shown in SEQ ID NO.1: GCCGTGATCGTATAGTGGTTAGTACTCT.

[0006] Furthermore, the reagent for detecting tsRNA molecular markers in intestinal mucosal tissue includes upstream and downstream primers for tRF-28-PW5SVP9N1503 real-time PCR. The sequence of the upstream primer for tRF-28-PW5SVP9N1503 real-time PCR is 5'-AATGCCGTGATCGTATAGTGGTT-3', and the sequence of the downstream primer for tRF-28-PW5SVP9N1503 real-time PCR is 5'-TATCCTTGTTGACGACTGGTTGAC-3'.

[0007] Furthermore, the reagent for detecting tsRNA molecular markers in intestinal mucosal tissue also includes upstream and downstream primers for the internal reference gene U6SnRNA real-time PCR. The sequence of the upstream primer for U6SnRNA real-time PCR is 5'-CAGCACATATACTAAAATTGGAACG-3', and the sequence of the downstream primer for U6SnRNA real-time PCR is 5'-ACGAATTTGCGTGTCATCC-3'.

[0008] Compared with existing technologies, the advantages of this invention are as follows: This invention discloses the application of a reagent for detecting tsRNA molecular markers in intestinal mucosal tissue in the preparation of Crohn's disease diagnostic or detection kits. It is the first to disclose tRF-28-PW5SVP9N1503 for early diagnosis or detection of Crohn's disease, which is derived from tRNA-His-GTG-1-1 (chromosome 1 chr1:146038044-146038115), and is significantly lowly expressed in the intestinal mucosal tissue of CD patients. Detection of tRF-28-PW5SVP9N1503 using collected intestinal mucosal tissue provides a convenient, rapid, and efficient method for early molecular diagnosis of CD patients. Only a small amount of sample is required for rapid and accurate relative quantification of the target molecule. This detection method is not affected by genomic DNA, effectively distinguishes healthy individuals from CD patients, and exhibits high sensitivity, strong specificity, and high accuracy, thus improving the detection rate of Crohn's disease and facilitating its early detection and timely treatment. Attached Figure Description

[0009] Figure 1 This is a cluster analysis diagram of tsRNA levels in the intestinal mucosa of CD patients. Red indicates expression levels above the mean, blue indicates expression levels below the mean, c represents the CD patient group, and N represents the healthy group. Figure 2 The image shows a volcano plot of differential tsRNA expression levels between the intestinal mucosal lesion group and the normal group in CD patients. Red represents high expression in the lesion group with a difference greater than 1.5 times, and green represents low expression in the lesion group with a difference greater than 1.5 times. c refers to the CD patient group, and N refers to the healthy group. Figure 3 The expression level of tRF-28-PW5SVP9N1503 in the intestinal mucosal tissue of blank control and colitis mice; Figure 4 Quantitative analysis of tRF-28-PW5SVP9N1503 expression level using Hairpin-it™ tsRNA; Figure 5 Agarose gel electrophoresis image of the tRF-28-PW5SVP9N1503 / U6 SnRNA amplification product; Figure 6 To analyze the significant differences in the expression levels of tRF-28-PW5SVP9N1503 in the intestinal mucosal tissues of healthy individuals and Crohn's disease patients; Figure 7 ROC curve and diagnostic value of tRF-28-PW5SVP9N1503 in intestinal mucosal tissue of CD patients. Detailed Implementation

[0010] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0011] Specific Implementation Example 1: Screening of tRF-28-PW5SVP9N1503 molecular markers.

[0012] Step 1: Screening for tsRNAs with significant differences Surgical specimens of intestinal mucosal tissue from lesion sites and normal sites were collected from three patients with Crohn's disease (CD) at the First Affiliated Hospital of Ningbo University. Informed consent was obtained from all patients or their families before sample collection. Relevant patient information was complete, and a clinical data database was established according to regulations. Sample collection followed specific inclusion and exclusion criteria: Inclusion criteria: Healthy control group: a. Age 18-75 years; b. No definitive diagnosis of inflammatory bowel disease (IBD) based on endoscopy and biopsy results. CD group: a. Age 18-75 years; b. Meeting the diagnostic criteria for CD.

[0013] Exclusion criteria: a. Pregnant or lactating women; b. Any intestinal disease that may interfere with test results; c. Inability to tolerate colonoscopy; d. Inability to cooperate due to mental illness.

[0014] The collected tissue samples were sent to DataSpectrum (Shanghai) Biotechnology Co., Ltd. for tiRNA & tRF sequencing. The expression levels (CPM values) of the sequenced tsRNAs (including tRF and tiRNA) were analyzed using the heatmap 2 software package in R. The results are as follows: Figure 1 As shown in the diagram, the tsRNA level clustering analysis plot shows that each row represents one tsRNA and each column represents one sample. Red indicates that the expression level is higher than the average, and blue indicates that the expression level is lower than the average. The hierarchical clustering results clearly present the significant differences in tsRNA expression profiles among samples.

[0015] Further, a volcano plot of tsRNA expression levels was drawn, and the results are as follows: Figure 2 As shown, red / green circles represent statistically significant differentially expressed tsRNAs with a fold change of at least 1.5 and a p-value ≤ 0.05 (red: upregulated; green: downregulated). Gray circles represent non-differentially expressed tsRNAs with FC and / or q values ​​that do not meet the cutoff threshold. Volcano plot analysis revealed a total of 46 significantly differentially expressed tsRNAs. Compared to normal mucosal tissue, 30 tsRNAs were upregulated and 16 tsRNAs were downregulated in CD lesion mucosal tissue.

[0016] Step 2: Identification of tRF-28-PW5SVP9N1503 marker Table 1. Sixteen tsRNAs that were significantly downexpressed in Crohn's disease according to sequencing results.

[0017] As shown in Table 1, tRF-28-PW5SVP9N1503 is one of the 16 tsRNAs with significantly low expression, and it has an ID in the MINTbase public database. The nucleotide sequence of tRF-28-PW5SVP9N1503 is as follows: GCCGTGATCGTATAGTGGTTAGTACTCT. It is derived from tRNA-His-GTG-1-1, and its sequence is as follows: GCCGTGATCGTATAGTGGTTAGTACTCTGCGTTGTGGCCGCAGCAACCTCGGTTCGAATCCGAGTCACGGCACCA. Further human-mouse sequence alignment revealed that the sequence of tRF-28-PW5SVP9N1503 is identical in both human and mouse sources. Simultaneously, reverse transcription real-time quantitative PCR was used to detect it in the intestinal mucosa tissue of a mouse model of chronic colitis induced by DSS, and the results are as follows... Figure 3 The results showed that the expression level of tRF-28-PW5SVP9N1503 in the intestinal mucosa tissue of DSS-induced colitis mice was significantly lower than that in the control group, consistent with the sequencing results. These results indicate that tRF-28-PW5SVP9N1503 has potential diagnostic or prognostic value for Crohn's disease and warrants further validation and testing of its diagnostic value.

[0018] Specific Implementation Example 2: Validation of the diagnostic value of the tRF-28-PW5SVP9N1503 molecular marker.

[0019] In addition, intestinal mucosal tissue samples from 67 CD patients and 33 healthy individuals from the First Affiliated Hospital of Ningbo University were collected. Informed consent was obtained from all patients or their families, and relevant patient information was complete and a clinical data database was established in accordance with regulations. The sample inclusion and exclusion criteria were the same as those in Specific Implementation Example 1 above.

[0020] like Figure 4 As shown, the quantitative analysis of tRF-28-PW5SVP9N1503 includes reverse transcription using stem-loop reverse transcription primers and real-time quantitative PCR. The stem-loop reverse transcription primers bind to the 3' end of tsRNA, and reverse transcription occurs under the action of reverse transcriptase. Then, a quantitative PCR reaction system involving specific forward and reverse primers and fluorescent dyes is used to quantitatively detect the reverse transcription products. The specific steps are as follows: Step 1: Extract total RNA from tissues 20 mg of intestinal mucosal tissue was extracted into an autoclaved and RNase-free EP tube. Grinding beads were added, and the tissue was ground until no obvious particles were visible. The mixture was allowed to stand at room temperature for 5 minutes to fully lyse the tissue. Then, 100 μL of chloroform substitute was added, and the mixture was vortexed for 15 seconds. After standing at room temperature for 3 minutes, the mixture was centrifuged at 12000 g, 4°C for 2 minutes. The supernatant was carefully transferred to a new EP tube using a pipette. RNA was extracted from the supernatant using the Tissue RNAPurification Kit Plus from Shanghai Yishan Biotechnology Co., Ltd., following the manufacturer's instructions. The RNA concentration and A260, A280, and A320 values ​​were measured using a Nanodrop spectrophotometer. An A260 / 280 ratio within the range of 1.8-2.2 indicated acceptable RNA purity. The RNA was diluted with DEPC water to 100 ng / µL for subsequent experiments.

[0021] Step 2: Reverse transcription of total RNA into cDNA Follow the instructions for the Hairpin-it miRNAs RT-PCR Quantitation Kit manufactured by Shanghai Jima Pharmaceutical Technology Co., Ltd. Mix the tsRNA reverse transcription primers (10 mM 10 µL, included in the kit) and the U6 snRNA reverse transcription primers (10 mM 10 µL, included in the kit), and dilute them together to prepare a 10-fold 1 µM reverse transcription working solution. A single reverse transcription reaction will simultaneously yield tsRNA and U6 snRNA quantitative PCR cDNA templates.

[0022] Table 2. Reverse transcription reaction system (20µL):

[0023] cDNA synthesis reaction procedure: 26℃ for 40 min, 42℃ for 40 min, 85℃ for 10 min. The obtained cDNA can be stored at -20℃ and will remain stable for three days, or it can be directly used for quantitative PCR. For long-term storage, it can be frozen at -80℃.

[0024] Step 3: Real-time quantitative PCR The quantitative PCR reaction system was prepared as follows: 7.4 µL RNase-free H2O, 10 µL 2×Real-time PCR Master Mix (SYBR), 0.4 µL tRF-28-PW5SVP9N1503 / U6 SnRNA quantitative PCR primers (10 µM), 0.2 µL rTaq DNA polymerase (5 U / µL), and 2 µL cDNA. The sequence of the upstream primer for tRF-28-PW5SVP9N1503 was 5'-AATGCCGTGATCGTATAGTGGTT-3', and the sequence of the downstream primer was 5'-TATCCTTGTTGACGACTGGTTGAC-3'. U6 SnRNA was used as an internal reference gene, and the sequence of the upstream primer for U6 SnRNA quantitative PCR was 5'-CAGCACATATACTAAAATTGGAACG-3'. The sequence of the downstream primer for SnRNA real-time PCR was 5'-ACGAATTTGCGTGTCATCC-3'. The reaction program was 90℃ for 3 min; 95℃ for 12 seconds for 40 cycles; and 62℃ for 40 seconds for 40 cycles.

[0025] The PCR amplification products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 5 The amplified fragments of the upstream and downstream amplification products of tRF-28-PW5SVP9N1503 are 79bp in size, and the amplified fragments of the upstream and downstream amplification products of the internal reference gene U6 SnRNA are 76bp in size.

[0026] Simultaneously, fluorescence signals were collected, and each intestinal mucosal tissue sample was amplified using real-time quantitative PCR. Ct The values ​​were calculated for tRF-28-PW5SVP9N1503 and U6 snRNA in the three replicates of the sample. Ct Average value of tRF-28-PW5SVP9N1503 Ct Average minus U6 snRNA Ct The ΔCT value was obtained by averaging the ΔCT value, and the -ΔCT value was obtained by taking the negative value of the ΔCT value. Subsequently, statistical analysis was performed on tRF-28-PW5SVP9N1503 in intestinal mucosal tissue samples from healthy individuals and CD patients. The results are as follows: Figure 6 As shown, tRF-28-PW5SVP9N1503 was significantly underexpressed in the intestinal mucosa of CD patients compared to healthy individuals.

[0027] Further analysis of the diagnostic ability of the tRF-28-PW5SVP9N1503 marker using ROC curves: Based on the levels of tRF-28-PW5SVP9N1503 in healthy and Crohn's disease samples, the area under the ROC curve, sensitivity, specificity, positive predictive value, and negative predictive value of tRF-28-PW5SVP9N1503 levels in distinguishing between healthy individuals and Crohn's disease patients were analyzed to evaluate the diagnostic value of tRF-28-PW5SVP9N1503 in assessing intestinal mucosal tissue in Crohn's disease patients.

[0028] The results are as follows Figure 7 As shown, its area under the ROC curve is 0.826, sensitivity is 0.612, specificity is 0.892, positive predictive value is 0.911, negative predictive value is 0.569, and cutoff value is 0.504, which can be effectively used for the early diagnosis of Crohn's disease.

[0029] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. The application of a reagent for detecting tsRNA molecular markers in intestinal mucosal tissue in the preparation of a Crohn's disease diagnostic kit, characterized in that: The eRNA molecular marker is tRF-28-PW5SVP9N1503, and the nucleotide sequence of tRF-28-PW5SVP9N1503 is shown in SEQ ID NO.1: GCCGTGATCGTATAGTGGTTAGTACTCT.

2. The application according to claim 1, characterized in that: The reagent for detecting tsRNA molecular markers in intestinal mucosal tissue includes upstream and downstream primers for tRF-28-PW5SVP9N1503 real-time PCR. The sequence of the upstream primer for tRF-28-PW5SVP9N1503 real-time PCR is 5'-AATGCCGTGATCGTATAGTGGTT-3', and the sequence of the downstream primer for tRF-28-PW5SVP9N1503 real-time PCR is 5'-TATCCTTGTTGACGACTGGTTGAC-3'.

3. The application according to claim 1, characterized in that: The reagent for detecting tsRNA molecular markers in intestinal mucosal tissue also includes upstream and downstream primers for the internal reference gene U6 SnRNA real-time PCR. The sequence of the upstream primer for U6 SnRNA real-time PCR is 5'- CAGCACATATACTAAAATTGGAACG-3', and the sequence of the downstream primer for U6 SnRNA real-time PCR is 5'- ACGAATTTGCGTGTCATCC-3'.

Citation Information

Patent Citations

  • Molecular marker, kit and application thereof to IgA nephropathy

    CN109055539A

  • Relative quantitative detection method for stomach tissue tRF-28-ZJ47D112Z4DZ and application thereof

    CN114891884A

  • Application of tRFVal-AAC-035 to detection of diabetic cardiomyopathy

    CN116004617A

  • Tumor biomarker and cancer risk information generation method and device

    CN117594120A

  • ERNA molecular marker for auxiliary diagnosis of Crohn disease and application of eRNA molecular marker

    CN119061137A