Molecular marker of powdery mildew-resistant gene PmX1 of Taimnonwei wheat and application of molecular marker
By developing a molecular marker for the powdery mildew resistance gene PmX1 in wheat (Timofibr), and using PN2 primers for PCR amplification and electrophoresis detection, the problem of frequent loss of powdery mildew resistance genes in wheat varieties was solved, achieving rapid and accurate breeding screening and cost reduction.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2025-12-09
- Publication Date
- 2026-04-21
AI Technical Summary
Powdery mildew resistance genes are frequently lost in existing wheat varieties, and there is a lack of effective new disease-resistant genes. Traditional breeding methods are inefficient and it is difficult to accurately screen for powdery mildew resistant plants.
Molecular markers for the powdery mildew resistance gene PmX1 in wheat were developed. PCR amplification and electrophoresis were performed using PN2 primers to rapidly identify whether the wheat carries the PmX1 gene. This information was then combined with marker-assisted selection (MAS) for breeding.
It enables rapid and accurate detection of powdery mildew resistance genes, improves breeding efficiency, shortens the breeding cycle, reduces costs, and reduces unnecessary backcrossing and field trial workload.
Smart Images
Figure CN121896385A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, specifically to the timofibrin wheat powdery mildew resistance gene. PmX1 Molecular markers and their applications. Background Technology
[0002] Wheat is an important global food crop, and its production is threatened by various diseases, among which wheat powdery mildew is caused by the grass family powdery mildew fungus (Brucea fulva). Blumeria graminis f.sp. tritici Powdery mildew is an airborne fungal disease characterized by diverse physiological races and rapid mutation. In the field of disease resistance breeding, although currently available wheat varieties contain effective powdery mildew resistance genes such as... Pm2, Pm4a, Pm4b and Pm21 While still playing a role, resistance is frequently lost in varieties, making the discovery and utilization of new disease-resistant genes particularly urgent.
[0003] Timofevir wheat ( Triticum timopheevii As a close relative of common wheat, 2n=4x=28, AtAtGG has rich genetic diversity and is an important gene source for discovering excellent disease-resistant genes and broadening the genetic basis of wheat. T. timopheevii It is resistant to fungal diseases such as leaf rust, powdery mildew, and stem rust. Triticum timopheevii It has also been proven to be abiotic stress resistance such as salt tolerance and traits affecting grain quality, using timofibrin wheat ( Triticum timopheevii With abundant genetic resources, several excellent genes for resistance to powdery mildew have been successfully discovered. Pm2, Pm6, Pm27, Pm37 This has provided new impetus for wheat genetic improvement and the enhancement of varietal resistance. The application of molecular breeding technology has significantly improved breeding efficiency. Through marker-assisted selection, target genes can be precisely integrated into new varieties while reducing the introduction of unwanted genes, thus accelerating the breeding process. Therefore, developing powdery mildew resistance genes is crucial. PmX1 Molecular markers, applied to molecular markers based on PmX1 Molecular marker-assisted selection breeding is of great significance for breeding wheat varieties resistant to powdery mildew, and thus effectively controlling wheat powdery mildew. Summary of the Invention
[0004] To address the aforementioned technical problems, the purpose of this invention is to provide a timofibrin wheat powdery mildew resistance gene. PmX1 Molecular markers and their applications: Amplification of molecular markers using primers to target wheat powdery mildew resistance genes. PmX1 Testing is conducted to purposefully select parent varieties in wheat breeding, providing guidance for breeding new wheat varieties resistant to powdery mildew.
[0005] The technical solution of this invention to solve the above-mentioned technical problems is as follows: providing a timofibrin wheat powdery mildew resistance gene. PmX1 The molecular marker was obtained by amplification using PN2 primers, which include an upstream primer PN2-F and a downstream primer PN2-R. The nucleotide sequence of the upstream primer PN2-F is shown in SEQ ID NO.1, specifically AGATTCGCCGGTGAACATGA, and the nucleotide sequence of the downstream primer ZLN2-R is shown in SEQ ID NO.2, specifically GTTACGGAGGTAGGACGCC.
[0006] Furthermore, the molecular markers were obtained by amplifying wheat genomic DNA using PN2 primer pairs.
[0007] Furthermore, the timofibrinogen wheat powdery mildew resistance gene PmX1 The CDS region sequence is shown in SEQ ID NO.3.
[0008] Furthermore, the timofibrinogen wheat powdery mildew resistance gene PmX1 Molecular markers in genes PmX1 The application of molecular markers in the detection, identification, and auxiliary identification of wheat powdery mildew resistance traits or in marker-assisted breeding.
[0009] A method for detecting powdery mildew resistance genes in timofibrin wheat samples PmX1 The method includes the following steps: (1) Extract genomic DNA from the wheat sample to be tested; (2) The PN2 primers described above were used to perform PCR amplification on the genomic DNA of the wheat sample to be tested to obtain the amplification primers; (3) Perform electrophoresis and detection on the amplification primers; if a specific band of 884 bp can be amplified, it indicates that the wheat sample to be tested carries the powdery mildew resistance gene. PmX1 Otherwise, the wheat sample to be tested does not carry the powdery mildew resistance gene. PmX1 .
[0010] Furthermore, in step (2), during PCR amplification, the PCR amplification system is 10 μL, including: 1.0 μL of 50 ng / μL wheat genomic DNA, 5 μL of PCR Master Mix, 0.3 μL of upstream primer, 0.3 μL of downstream primer, and 3.4 μL of sterile deionized water.
[0011] Furthermore, in step (2), the PCR amplification procedure is as follows: 94℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 25 seconds, 72℃ extension for 5 seconds, 30 cycles; 72℃ extension for 10 minutes; 4℃ storage.
[0012] The present invention has the following beneficial effects: 1. The specific PN2 primers provided by this invention, combined with PCR amplification and electrophoresis detection techniques, can rapidly and accurately identify whether wheat carries the powdery mildew resistance gene in a short time (e.g., through an 884 bp specific band). PmX1 Compared to traditional phenotypic identification methods, this method avoids the drawbacks of environmental interference and long processing times, significantly improving detection efficiency and reliability.
[0013] 2. The molecular markers of this invention can be directly applied to early screening in disease-resistant breeding. Through marker-assisted selection (MAS), precise screening of those carrying [the markers] can be achieved. PmX1 Genetically modified plants reduce the workload of blind backcrossing and field trials, shorten the breeding cycle, and lower breeding costs. Attached Figure Description
[0014] Figure 1 Partial phenotypic identification results of Bgt1 strain infecting 234 wheat populations; Figure 2 A schematic diagram of the BSR mixing cell localization results; Figure 3 A schematic diagram of the genotype results for the common infiltration region of 234 materials; Figure 4 Identifying candidate genes for TWAS association analysis; Figure 5 Correlation analysis of PmX1 expression levels; Figure 6 This is a schematic diagram of the test results for wheat materials. Detailed Implementation
[0015] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0016] Example 1 Powdery mildew resistance gene PmX1 The screening and molecular marker selection process is as follows: (1) Using strain Bgt1 (collected from Jinzhong City, Shanxi Province and containing AvrPmX1 Phenotypic identification was performed on 234 wheat populations (partial phenotypic results are shown below). Figure 1 As shown in the figure, through GWAS and haplotype analysis, eight materials showed similar disease resistance haplotypes and cosegregation with the phenotype among all disease-resistant materials. The disease-resistant material PI170911 was selected for further analysis.
[0017] (2) The resistant material PI170911 was crossed with the susceptible material Fielder to obtain the F1 generation, which showed resistance. The F1 generation was then self-crossed to obtain the F2 generation. The resistance-susceptibility segregation ratio in the F2 population was 156:57, consistent with a 3:1 ratio, indicating that the resistance was controlled by a single dominant resistance gene. Subsequently, 50 plants of extreme resistance and 50 plants of susceptible material were used to construct resistance and susceptibility pools, respectively. Transcriptome sequencing was performed, and using the Fielder reference genome, the candidate regions were analyzed by calculating the differential SNP frequencies in the progeny, identifying chromosome 2B as a potential candidate region. Figure 2 As shown.
[0018] (3) Resequencing of PI170911 material and alignment to CS+ Triticum timopheevii By calculating similarity and depth comparisons on the merged reference genome, it was found that chromosome 2B was composed of... Triticum timopheevii The 2G chromosome has infiltrated into the wheat population. Among 234 wheat accessions, 11 other materials showed similar resistance spectra to PI170911. After comparison and in-depth statistical analysis, these 11 materials all showed infiltration on chromosome 2B. Triticum timopheevii The infiltration of the gene was common in the Chr2B:691-733M (CSv1.1). All 12 materials containing the infiltrated fragment exhibited resistant phenotypes, and the haplotypes in this region were clearly distinct from the other 222 wheat materials. Figure 3 As shown. Among them, Figure 3 In the graph on the right, the bar chart shows the phenotype of each wheat material against the Bgt1 strain, with a total of 0-4 levels. The lighter the color in the heatmap, the weaker the virulence, and the darker the color, the stronger the virulence.
[0019] (4) Due to the presence of recombination repression on wheat chromosomes, the gene could not be located using traditional genetic mapping. Therefore, the TWAS method was used to locate the gene. The 234 wheat materials were mapped using CS+... Triticum timopheevii Quantitative analysis was performed on the merged genome, and association analysis was conducted between the TPM of each gene and the phenotype. Significant picks were found within the Chr2G: 693-725M interval, which was filtered (TPM > 0.5 and -log). 10 (p-value)>4), the gene with the strongest association and that is also associated with disease resistance is Tritim_EIv0.3_0424440 (like Figure 4 (As shown).
[0020] (5) Differential expression analysis of the gene revealed significant differences in TPM values between infiltrated and non-infiltrated materials. Secondly, the TPM values of the gene showed significant changes between the TWAS results at 0 days and 8 days in the 12 infiltrated materials. Finally, phenotypic analysis showed a clear positive correlation between the gene's expression level and the resistance / susceptibility phenotype; that is, the gene was highly expressed in highly resistant varieties and lowly expressed or not expressed in susceptible varieties (e.g., ...). Figure 5 (As shown). In summary, we will Tritim_EIv0.3_0424440 Genes as PmX1 Candidate genes.
[0021] (6) Based on the cds region of the gene, molecular markers were designed using Primer 5.0 software. The presence of the gene in the material can be specifically detected by detecting the PN2 molecular marker. If a specific band of 884 bp can be amplified, it indicates that the sample to be tested carries the gene. PmX1 Genes; otherwise, the sample to be tested does not carry them. PmX1 Genes. For example, the gel image below (e.g.) Figure 6 As shown), 1-5 are wheat materials containing infiltrated fragments (5 materials were selected from the above 12 materials, carrying...). PmX1 (Gene), 6 is the susceptible variety Fielder, because it does not contain the disease-resistant gene. PmX1 Therefore, there are no bands. 7 is the susceptible variety CS, because it does not contain disease-resistant genes. PmX1 Therefore, there are no stripes.
[0022] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0023] SEQ ID NO.1:AGATTCGCCGGTGAACATGA SEQ ID NO.2:GTTTACGGAGGTAGGACGCC SEQ ID NO.3:CATGTCTGTGCTCTGTATTTTTGCTGGTAACACGTACGTACAGGGCTCCTTCATGTCTGTGACGAGACTCAGCATGGTTAATCTGCTGGCGTTTCTGCTGCTGCTGTTCTATGGAGCTGGCAACATCAATTGCTCAACGGTCAACCACGGGAACAGCACAGACATGCTCGCGTTGCTCGATTTCAAGGCGGCTACCAACGACCCAACAGGTGCCTTAAGATCATGGAACAGAAGCATCCACTACTGTAACTGGACGGGTGTCAGATGCAGCTCATTTAATACAAGGCGCGTCGCCGCTCTGCAACTCCCCGGCCAAAGCTTGTCAGGCGAGATCACCCCCTCACTTGGGAACTTGACGTTCCTTAGGATCCTCAATTTGTCCTACAATGACTTCGCCGGCCATTTACCTCCCCTGAACCTGAACCAGCTCCGTGAGCTGATCGTCCTTGACCTCAGCTCCAATTCATTTCAGGGGACAATTCCTGACTCACTGACAAACTGTTCAAACATAATGGCGCTGGATCTGTCTAGAAATATGCTACAAGGCCCGATCCCCACCAAAATTGGTTCGCTCTACAATCTAATCGGCATGGATCTTTCTAAGAATAATCTCACCGGAGTCATCCCACCAAGCATCAGCAATGCCACCCAGCTACAACTACTTAACCTTCGAGATAATCAACTACGAGGAAGCATACCTGCTGAACTTGGGCGACTGTCCAACATGCTCGTCTTGTTCTTTGGTGGAAATAGGCTGTCAGGCACCATACCTGATGTGTTTGGTCAACTCTCACAGCTCGTAAAGCTGGACCTAAGCTATAATAATCTCCAAGGCGTCCTACCTCCGT
Claims
1. Timofevir wheat powdery mildew resistance gene PmX1 Molecular markers, characterized by, The molecular marker was amplified using PN2 primers, which include an upstream primer PN2-F and a downstream primer PN2-R. The nucleotide sequence of the upstream primer PN2-F is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer PN2-R is shown in SEQ ID NO.
2.
2. The timofibrin wheat powdery mildew resistance gene as described in claim 1 PmX1 Molecular markers in genes PmX1 The application of molecular markers in the detection, identification, and auxiliary identification of wheat powdery mildew resistance traits or in marker-assisted breeding.
3. Detection of powdery mildew resistance genes in timofibrin wheat samples PmX1 The method is characterized by, Includes the following steps: (1) Extract genomic DNA from the wheat sample to be tested; (2) Using the PN2 primers described in claim 1, PCR amplification was performed on the genomic DNA of the wheat sample to be tested to obtain amplification primers; (3) Perform electrophoresis and detection on the amplification primers; if a specific band of 884 bp can be amplified, it indicates that the wheat sample to be tested carries the powdery mildew resistance gene. PmX1 Otherwise, the wheat sample to be tested does not carry the powdery mildew resistance gene. PmX1 .
4. The method for detecting powdery mildew resistance genes in timofibrin wheat samples as described in claim 3. PmX1 The method is characterized by, In step (2), the PCR amplification system is 10 μL, which includes: 1.0 μL of 50 ng / μL wheat genomic DNA, 5 μL of PCR Master Mix, 0.3 μL of upstream primer, 0.3 μL of downstream primer, and 3.4 μL of sterile deionized water.
5. The method for detecting powdery mildew resistance genes in timofibrin wheat samples as described in claim 3. PmX1 The method is characterized by, In step (2), the PCR amplification procedure is as follows: 94℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 25 seconds, 72℃ extension for 5 seconds, 30 cycles; 72℃ extension for 10 minutes; 4℃ storage.