Molecular marker for non-small cell lung cancer chemotherapy drug resistance and application thereof

Abstract

The invention discloses a molecular marker for non-small cell lung cancer chemotherapy resistance and application of the molecular marker, and relates to the technical field of biological medicine. Experiments prove that FBXL18 inhibits non-small cell lung cancer cell malignant phenotypes by degrading MDFI, MDFI expression in a sample of a non-small cell lung cancer chemotherapy drug resistance patient is remarkably increased while FBXL18 expression is reduced, and MDFI and FBXL18 can be clinically used as chemotherapy drug resistance markers for non-small cell lung cancer drug resistance diagnosis or prognosis evaluation; up-regulation of FBXL18 or / and down-regulation of MDFI can lead to apoptosis of cancer cells and enhance the curative effect of chemotherapeutic drugs, and the potential of FBXL18 as a chemotherapeutic drug resistance marker and a new target for targeted therapy is shown. According to the present invention, the non-small cell lung cancer tumor cell growth can be significantly inhibited by combining the FBXL18 up-regulation or / and MDFI down-regulation reagent with the cisplatin treatment, such that the FBXL18 can be adopted as the important target spot in the non-small cell lung cancer treatment, and the non-small cell lung cancer treatment strategy is expected to be expanded according to the target spot;

Description

Technical Field

[0001] This invention relates to a molecular marker for chemotherapy resistance in non-small cell lung cancer and its application, belonging to the field of biomedical technology. Background Technology

[0002] Lung cancer is one of the leading causes of cancer-related deaths worldwide, and its metastasis and treatment resistance pose significant clinical challenges. Non-small cell lung cancer (NSCLC) accounts for 85% of all lung cancers, and platinum-based chemotherapy is the first-line treatment. However, platinum resistance is widespread, severely impacting efficacy. Once cisplatin resistance develops, the disease often progresses rapidly, with reduced responsiveness to subsequent treatments, worsening prognosis, and a 5-year survival rate of only about 15%-20%. Cisplatin resistance remains a major challenge in the treatment of NSCLC. This is mainly attributed to tumor intrinsic heterogeneity, adaptive immune escape, and acquired chemotherapy resistance. This heterogeneity is not only reflected in genomic characteristics but also in the dynamic reprogramming of the tumor microenvironment (TME)—where cancer stem cells (CSCs) drive phenotypic plasticity, metastasis, and treatment failure. The ubiquitin-proteasome system (UPS), as a key regulator of oncogenic protein stability and cellular homeostasis, has its E3 ligase determining the specificity of degradation substrates. Recent studies have shown that abnormal ubiquitination participates in the pathogenesis of lung cancer by stabilizing oncogenic drivers such as β-catenin, a core regulator of epithelial-mesenchymal transition (EMT) and cell-cell sclerosis (CSC). However, the upstream mechanisms of β-catenin pathway activation involving novel E3 ligase substrates in metastasis remain incompletely elucidated. Although some studies have identified inhibitors such as SB 202190 and NDGA that can overcome cisplatin resistance, these drugs may have side effects and unstable efficacy, and are not yet widely used in clinical practice.

[0003] Currently, there is a lack of precise and efficient molecular markers for the diagnosis of chemotherapy resistance in non-small cell lung cancer (NSCLC) in clinical practice. This makes it difficult to predict whether patients will develop resistance in the early stages of treatment, thus hindering timely adjustments to treatment plans. Furthermore, the number of targeted therapeutic targets for chemotherapy resistance in lung cancer is very limited, making the development of new targeted therapy strategies urgent. Therefore, screening and identifying molecular markers that can be used for the diagnosis and prognostic assessment of chemotherapy resistance in lung cancer, and developing new therapeutic targets based on these markers, is of great significance for improving treatment outcomes for lung cancer patients.

[0004] The protein encoded by the FBXL18 gene belongs to the F-box protein family, possessing an F-box domain and leucine repeat sequences. It plays a crucial role in ubiquitination and protein degradation, while the leucine repeat sequences may be involved in protein-protein interactions. Current research indicates that FBXL18 participates in tumorigenesis, development, and drug resistance in various cancers, but its specificity varies depending on the cancer type. Although FBXL18 has been shown to participate in the antitumor effects of various malignant tumors, and is significantly upregulated in NSCLC with a worse prognosis in the high-expression group, its expression, regulatory mechanisms, and therapeutic potential in lung cancer drug resistance remain to be explored. A search revealed no studies related to FBXL18 and lung cancer drug resistance, and even fewer studies on the role of FBXL18 in cisplatin-based chemotherapy resistance in non-small cell lung cancer. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a molecular marker for chemotherapy resistance in non-small cell lung cancer and its application.

[0006] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: This invention protects the use of FBXL18 protein and / or MDFI protein as biomarkers in the preparation of products for detecting cisplatin-treated chemotherapy resistance in non-small cell lung cancer or in the preparation of pharmaceuticals for treating lung cancer.

[0007] This invention also protects the use of reagents for detecting FBXL18 protein expression levels in the preparation of products for detecting cisplatin-based chemotherapy resistance in non-small cell lung cancer or in the preparation of pharmaceuticals for treating non-small cell lung cancer.

[0008] Furthermore, the product for detecting cisplatin-treated chemotherapy resistance in non-small cell lung cancer includes a detection reagent for detecting the expression level of the biomarker FBXL18 protein in biological samples.

[0009] Furthermore, the biological sample is tumor tissue from a non-small cell lung cancer patient.

[0010] Furthermore, in the non-small cell lung cancer chemotherapy-resistant patient samples, MDFI expression was significantly increased while FBXL18 expression was decreased, and FBXL18 was negatively correlated with MDFI protein expression.

[0011] This invention also protects the use of agents that upregulate FBXL18 and / or downregulate MDFI in the preparation of products for treating non-small cell lung cancer or improving the sensitivity of non-small cell lung cancer to cisplatin chemotherapy or in combination with cisplatin for the treatment of non-small cell lung cancer.

[0012] Furthermore, the reagents for upregulating FBXL18 and / or downregulating MDFI protein expression are VPA or shRNA that inhibits MDFI protein expression.

[0013] Furthermore, the MDFIshRNA is a double-stranded DNA sequence, and the upstream and downstream strands of the double-stranded DNA sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention is the first to discover that FBXL18 expression is significantly reduced and MDFI expression is significantly increased in non-small cell lung cancer (NSCLC) resistant patient samples. FBXL18 knockdown reduces the sensitivity of NSCLC cells to cisplatin, while overexpression of FBXL18 enhances their chemosensitivity. FBXL18, as an E3 ubiquitin ligase, exerts its effect by targeting MDFI for K48 ubiquitination modification and mediating its degradation. Notably, the histone deacetylase inhibitor valproic acid (VPA) can upregulate FBXL18 expression and enhance the ubiquitin-dependent degradation of MDFI by promoting TIP60-mediated FBXL18 K365 acetylation, thereby exerting its antitumor effect. Drug screening revealed that VPA can upregulate FBXL18 and / or downregulate MDFI. In vivo experiments showed that VPA can synergistically inhibit tumor growth and reverse drug resistance with cisplatin, without significant toxicity. These findings reveal that the FBXL18-MDFI-β-catenin axis is a key regulator of cisplatin resistance, and suggest that agents that upregulate FBXL18 and downregulate MDFI could serve as potential therapeutic agents for restoring chemosensitivity in non-small cell lung cancer. This invention provides new insights for the treatment and research of drug-resistant non-small cell lung cancer, and has significant clinical and economic value.

[0015] This invention demonstrates that FBXL18 can serve as a biomarker for chemotherapy resistance in non-small cell lung cancer (NSCLC) patients. By detecting its expression level, it can predict the patient's response to chemotherapy, thereby guiding individualized treatment decisions for NSCLC patients and developing new intervention strategies for chemotherapy resistance. Interventions targeting FBXL18, such as FBXL18 overexpression, can serve as a new strategy for treating NSCLC resistance, improving the sensitivity of NSCLC patients to cisplatin chemotherapy. This indicates that reagents for FBXL18 overexpression can be used in combination with chemotherapy drugs for the treatment of NSCLC. Attached Figure Description

[0016] Figure 1 The expression of FBXL18 and MDFI in cisplatin-sensitive and drug-resistant lung cancer tissue samples is shown in the figure above, which is the result of the immunoblotting experiment, and the figure below is the quantitative statistical graph. Figure 2 Expression of MDFI and FBXL18 proteins in different lung tissues or cells. Figure 2 Image A shows the immunohistochemical staining results of lung cancer tissue treated with cisplatin. Figure 2 Figure B shows the immunoblotting results of MDFI and FBXL18 proteins in normal lung epithelial cells and lung cancer cells. Figure 3 The spectrum of the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector; Figure 4 Figure A shows the expression of MDFI in cisplatin-sensitive and drug-resistant cells. Figure 4 Figure B shows the morphological observation results of cisplatin-sensitive and drug-resistant cells; Figure 5 The results of half-maximal inhibitory concentration (IC50) assay in cells after MDFI gene knockdown; Figure 6 The spectrum of the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector; Figure 7 The results of half-maximal inhibitory concentration (IC50) assays in different cells after FBXL18 gene knockdown / overexpression are shown. Figure 7 A, Figure 7 B. Figure 7 C represents the half-maximal inhibitory concentration (IC50) of A549, H1299, and A549 / DDP cells after overexpression of FBXL18. Figure 7 D、 Figure 7 E, Figure 7 F represents the half-maximal inhibitory concentration (IC50) of A549, H1299, and A549 / DDP cells after FBXL18 knockdown; Figure 8 FBXL18 inhibits lung cancer malignancy by suppressing MDFI, in which... Figure 8 Figure A shows the co-localization results of FBXL18 and MDFI in cells using multiplex immunofluorescence: Figure 8 B and Figure 8 C represents the EdU detection results graph and statistical graph, respectively. Figure 8 D is the result image displayed by the CCK-8 assay. Figure 8 E and Figure 8 F represents the results of the wound healing experiment and the staining diagram. Figure 8 G and Figure 8 H represents the results of the Transwell experiment; Figure 9 The figure shows the experimental results related to MDFI promoting β-catenin nuclear transport to regulate downstream signaling. Figure 9 A shows the results of the KEGG enrichment analysis. Figure 9 B is the correlation analysis plot between MDFI and EMT biomarkers. Figure 9 C is a correlation analysis diagram of MDFI and EMT-induced transcription factors. Figure 9 D is the result of the Western blot analysis; Figure 9 E represents the results of the rescue experiment. Figure 9 F and Figure 9 G represents the Western blot results of nuclear and cytoplasmic protein expression, respectively. Figure 9 H and Figure 9 Figure I shows the results of the rescue experiment; Figure 10 FBXL18 regulates downstream signaling pathways by ubiquitinizing and degrading MDFI. Figure 10 A represents the mRNA expression level of MDFI after FBXL18 overexpression; Figure 10 Figure B shows the results of the Co-IP experiment used to detect the interaction between FBXL18 and MDFI proteins; Figure 10 C represents the rescue experiment diagram; Figure 10 D、 Figure 10 E, Figure 10 F, Figure 10 G, Figure 10 H and Figure 10 Figure I shows a series of experiments used to identify MDFI as a ubiquitinated substrate protein; Figure 10 J、 Figure 10 K represents the Western blot results of FBXL18 ubiquitinated MDFI. Figure 10 L and Figure 10 M is a Western blot result of MDFI detection via ubiquitination of the K48 type ubiquitin chain; Figure 10 N is the Western blot result of detecting the interaction sites between FBXL18 and MDFI; Figure 10 O is a schematic diagram of potential interaction sites between FBXL18 and MDFI; Figure 10 P is a Western blot result showing whether the regulatory function is retained after detecting the FBXL18 interaction site with the mutation; Figure 11 The diagram shows the impact of VPA. Figure 11 Figure A shows the results of Western blot analysis of FBXL18 and MDFI expression after cell treatment with gradient concentrations of VPA. Figure 11 B represents the cell viability after VPA treatment as determined by the CCK-8 assay. Figure 11 C is the half-maximal inhibitory concentration (IC50) after VPA treatment. 50 )value, Figure 11 D and Figure 11 E represents the colony formation capability assessment results and statistical graphs under different conditions in the colony formation experiment. Figure 11 F and Figure 11 G represents the results and statistical graphs of flow cytometry assessment of anti-apoptotic ability under different conditions; Figure 12 The effect of VPA on the regulation of cisplatin resistance in lung cancer in vivo. Figure 12 A represents a tissue sample of A549 lung cancer xenograft from a mouse. Figure 12 B represents the tumor volume and mouse body weight data measured every 5 days after tumor cell injection. Figure 12 C and Figure 12 Figure E shows the results of immunohistochemical (IHC) staining of A549 tumor tissue sections. Figure 12 D represents the weight data of the A549 xenograft. Results are presented as **mean ± standard deviation (mean ± SD)**. Figure 12 F represents a tissue sample of H1299 lung cancer xenograft in a mouse. Figure 12 After G was injected with H1299 tumor cells, the tumor volume and mouse body weight were measured every 5 days. Figure 12 H and Figure 12 J: Immunohistochemical (IHC) staining results of H1299 tumor tissue sections. Figure 12 I represents the weight data of the H1299 xenograft. Detailed Implementation

[0017] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but the present invention is not limited to the following technical solutions. It should be noted that, where specific techniques or conditions are not specified in the embodiments, experimental results can be obtained by following the descriptions in relevant literature or product instructions in the field. Reagents, instruments, cells, and animal models used, unless otherwise specified by manufacturer, are all conventional products that can be purchased on the market.

[0018] Example 1: Expression detection of FBXL18 and MDFI in lung cancer patients and cisplatin-treated non-small cell lung cancer patients resistant to chemotherapy. The samples were obtained from the First Affiliated Hospital of Kunming Medical University, and a total of 45 non-small cell lung cancer tissue specimens were collected. Semi-quantitative scoring was performed by immunohistochemistry (IHC). The scoring criteria were negative (0 points), weakly positive (1 point), moderately positive (2 points), and strongly positive (3 points). Chemotherapy response was determined according to RECIST criteria, divided into drug resistance (PD / SD) and drug sensitivity (CR / PR). The FBXL18 IHC score was defined as X, and the MDFI IHC score was defined as Y.

[0019] Table 1. Raw data on FBXL18 and MDFI expression and chemotherapy response in 45 lung cancer tissue specimens.

[0020] As shown in Table 1 above, the negative correlation between FBXL18 and MDFI protein expression exhibits significant clinical stratification characteristics. Semi-quantitative immunohistochemical analysis revealed that 45 lung cancer tissue samples could be divided into three categories (see Table 2) based on the expression ratio (Y / X) of FBXL18 and MDFI and the intragroup correlation coefficient: a strongly negatively correlated group (15 cases, r = -0.918), a moderately negatively correlated group (15 cases, r = -0.652), and a weakly negatively correlated group (15 cases, r = -0.289). The strongly negatively correlated group was characterized by low FBXL18 expression (X≤1) and high MDFI expression (Y≥2), while the weakly negatively correlated group was characterized by high FBXL18 expression (X≥2) and low MDFI expression (Y≤1), suggesting that the inverse expression pattern of these two proteins has a clear clinical difference in lung cancer tissues. The degree of negative correlation between FBXL18 and MDFI showed a significant positive correlation with cisplatin chemotherapy resistance in lung cancer patients. The resistance rate in the strong negative correlation group was as high as 93.3% (14 / 15), with only one patient showing chemotherapy sensitivity. In the moderate negative correlation group, the resistance rate was 53.3% (8 / 15), with the number of sensitive and resistant cases being roughly equal. In the weak negative correlation group, the resistance rate was only 6.7% (1 / 15), with the remaining 14 patients showing sensitivity to cisplatin chemotherapy. The differences in resistance rates among the three groups were statistically significant (P < 0.001), clearly demonstrating that the stronger the negative correlation between FBXL18 and MDFI, the more significant the resistance to cisplatin chemotherapy in lung cancer patients.

[0021] Table 2. Correlation analysis of FBXL18 and MDFI expression with cisplatin chemotherapy resistance in 45 samples.

[0022] The negative correlation between FBXL18 and MDFI can serve as a potential predictor of cisplatin chemotherapy resistance in lung cancer. Combining protein expression characteristics with clinical outcomes, a strong negative correlation phenotype of low FBXL18 expression and high MDFI expression is a high-risk feature for cisplatin chemotherapy resistance in lung cancer patients; conversely, a weak negative correlation phenotype of high FBXL18 expression and low MDFI expression is closely related to chemotherapy sensitivity. This result suggests that detecting the correlation between FBXL18 and MDFI expression in lung cancer tissues can serve as an effective molecular indicator for predicting the efficacy of cisplatin chemotherapy in small cell lung cancer patients, providing a reference for the development of individualized clinical treatment plans.

[0023] Clinical sample analysis showed that in 45 cisplatin-sensitive and cisplatin-resistant lung cancer tissues, the resistant group showed significantly increased MDFI expression and decreased FBXL18 expression. Figure 1Immunohistochemical staining of lung cancer tissues showed that in the pathologically significant reaction group, FBXL18 showed moderate positive expression, MDFI showed weak positive expression, and β-catenin was localized to the cell membrane. In contrast, the chemotherapy-resistant group showed weaker FBXL18 expression, moderate to strong MDFI expression, and strong nuclear and cytoplasmic β-catenin staining. A significant negative correlation was observed between FBXL18 and MDFI expression (Table 2), a result consistent in all four lung cancer cell lines. Figure 2 A, Figure 2 B).

[0024] Example 2: Effects of FBXL18 and MDFI intervention on cisplatin-treated lung cancer chemotherapy resistance 2.1 Effect of MDFI knockdown on cisplatin-treated lung cancer chemotherapy resistance A549, H1299, and cisplatin-resistant A549 / DDP cells were treated with shRNA targeting and knocking down MDFI, with a negative control included. The treated cells were seeded in 96-well plates, and after cell attachment, gradient concentrations of cisplatin solution were added for incubation. After incubation, CCK-8 reagent was added to each well, and the cells were cultured for a further period. Cell morphology changes were observed, and the absorbance at 450 nm was measured using a microplate reader. The half-maximal inhibitory concentration (IC50) of cisplatin for each cell group was calculated based on the absorbance values. 50 ).

[0025] The methods for constructing and transfecting the MDFI shRNA lentiviral vector are as follows: Main reagents: vector (Hanbio Biotechnology), DH5α competent cells (TIANGEN, catalog number CB101-02), phanta Max-Super-Fidlity DNA polymerase (Vazyme, catalog number P505-D1), HB-infusion™ (Hanbio Biotechnology), Plasmid DNA purification kit (MACHEREY-NAGEL, catalog number 740412), Gel DNA purification kit (Generay, catalog number GK2041), DNAladder (Generay), Restriction Endonuclease (Thermo Scientific), etc. Main instruments: PCR instrument (BIO-Rad, model T100), 384-well PCR instrument (Shanghai Qibu, model WSB-2P-384), centrifuge (Xiangyi, model TGL-16), 37℃ constant temperature incubator (Jinghong, model GNP 9050), constant temperature water bath (Yiheng, model HSWS26), ultra-clean workbench (Sujing, model SW-CJ-1B), micropipette (Thermo Scientific), ultraviolet imager (Taineng, model Tanon 1200), nucleic acid electrophoresis instrument (Taineng, model EPS 300), horizontal electrophoresis tank (Taineng, model HE-120), etc.

[0026] The sequence design and synthesis of MDFI shRNA were completed by Wuhan Hanheng Biotechnology Co., Ltd. Vector and target gene information confirmation: The pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO interference vector was selected, and its vector map is shown below. Figure 3As shown, the information on each element of the vector (such as 5'LTR, 3'LTR, U6 promoter, CMV promoter, etc.) and the target gene MDFI is clearly defined. MDFI target genes: Three interference targets were designed. The siRNA1 sequence is CCAGGGCAGCAAGAAGAGTAA (SEQ ID NO: 1), with the upstream chain of the corresponding shRNA1 sequence being GATCCGCCAGGGCAGCAAGAAGAGTAACTCGAGTTACTCTTCTTGCTGCCCTGGTTTTTTG (SEQ ID NO: 2) and the downstream chain being AATTCAAAAAACCAGGGCAGCAAGAAGAGTAACTCGAGTTACTCTTCTTGCTGCCCTGGCG (SEQ ID NO: 3). The siRNA2 sequence is CACTTCTGCCGAATGACTCTG (SEQ ID NO: 4), with the upstream chain of the corresponding shRNA2 sequence being GATCCGCACTTCTGCCGAATGACTCTGCTCGAGCAGAGTCATTCGGCAGAAGTGTTTTTTG (SEQ ID NO: 5) and the downstream chain being AATTCAAAAAACACTTCTGCCGAATGACTCTGCTCGAGCAGAGTCATTCGGCAGAAGTGCG (SEQ ID NO: 5). (SEQ ID NO: 6); the siRNA3 sequence is GTTCCTGACGCTGTGCAACAT (SEQ ID NO: 7), the corresponding upstream chain of the shRNA3 sequence is: GATCCGTTCCTGACGCTGTGCAACATCTCGAGATGTTGCACAGCGTCAGGAACTTTTTTG (SEQ ID NO: 8), and the downstream chain is AATTCAAAAAAGTTCCTGACGCTGTGCAACATCTCGAGATGTTGCACAGCGTCAGGAACG (SEQ ID NO: 9). Primers were synthesized by a biotechnology company and purified by PAGE, and diluted to 100 μM.

[0027] Primer annealing to form double-stranded fragments with sticky ends: Prepare a 20 μL reaction system containing 2 μL 10*oligo buffer, 1 μL Primer F, 1 μL Primer R, and 16 μL H2O. The annealing program is 95℃ for 10 min, 75℃ for 10 min, 55℃ for 10 min, 35℃ for 10 min, and 15℃ for 10 min. Vector digestion: Add 1 μL vector DNA (1 μg / μL), 4 μL 10*buffer, 32 μL DdH2O, 11.5 μL restriction endonuclease, and 21.5 μL restriction endonuclease to a 40 μL digestion system. Incubate at 37℃ for 1-2 h, then perform agarose gel electrophoresis to recover the target fragment. If single enzyme digestion is used, the system needs to be adjusted. The 20 μL ligation reaction system contains 4 μL of annealing product, X μL of enzyme-digested vector (≥50 ng), 2 μL of T4 ligase buffer, 1 μL of T4 ligase, and (13-X) μL of H2O. Ligate at 22°C for 1-2 hours or at 16°C overnight. Remove DH5α competent cells from the -80°C freezer and immediately thaw on ice. Gently aliquot into 50 μL tubes (20 μL is sufficient for plasmid transformation). Add no more than 1 / 10 of the ligation product to the competent cells and incubate on ice for 20-30 minutes. Heat shock at 42°C for 90 seconds, followed immediately by incubation on ice for 2-3 minutes. Add 500 μL of antibiotic-free LB medium to a clean bench and gently invert 3-5 times. Incubate at 37°C with shaking at 230 rpm for 45-60 minutes. Spread the bacterial culture onto solid plates containing the appropriate antibiotic and incubate upside down at 37°C for 12-16 hours.

[0028] Bacterial culture PCR identification: Prepare a 10 μL PCR reaction system, including 5 μL of 2xHieff PCR Master MIX (Dye), 10.5 μL of primers, 20.5 μL of primers, 2 μL of bacterial culture, and 2 μL of ddH2O (scale up proportionally when preparing the mix).

[0029] PCR program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30-60 sec / kb, 25 cycles; 72℃ final extension for 10 min; store at 12℃. Sequencing: Select PCR-positive clones for sequencing. Compare the sequencing results with the target sequence; if they match, the target plasmid has been successfully constructed. Plasmid extraction: Amplify the successfully sequenced clones in bacterial culture. Extract and purify the plasmid according to the Plasmid DNA purification kit instructions. The extracted plasmid should have a concentration greater than 200 ng / μL, and a pH between 1.8 and 2.0 (specific requirements may vary depending on the kit). After QC verification, it can be used for subsequent transfection.

[0030] MDFI shRNA lentiviral transfection: 293T packaging cell line (adherent epithelioid cells, growth medium: DMEM containing 10% FBS) and *E. coli* DH5α strain. The lentiviral packaging system was a three-plasmid system, including a shuttle plasmid carrying MDFI shRNA, psPAX2 vector, and pMD2G vector. Experimental reagents: fetal bovine serum (Thermo, catalog number 26050070), trypsin (Thermo, catalog number LP0042), plasmid DNA extraction kit (Tiangen, catalog number DP117), DMEM (Thermo, catalog number 11965118), Lipofiter™ transfection reagent (Hanbio Biotechnology, catalog number HB-TRCF-1000), PBS (Thermo, catalog number 10010001), etc. Experimental instruments: cell culture incubator (Thermo, model 3111), biosafety cabinet (Labconco, model DELTA A2), high-speed refrigerated centrifuge (Thermo, model ST40 R), inverted biological microscope (Olympus, model CKX53), ultra-fast refrigerated centrifuge (Hitachi, model CP-100WX), etc.

[0031] Specific steps: Passage 293T cells beforehand and culture them in a 37℃, 5% CO2 incubator. Observe the cell density before transfection; a confluence of 70-80% is sufficient for transfection. For example, using a 100mm dish, the complex composition includes 10μg pSPAX, 5μg pMD2G, 10μg shuttle plasmid, and 75μL Lipofiter™. Mix well and incubate at room temperature for 15 minutes. Transfection: Slowly add the lipid-transfected complex to the 293T cells and culture in a 37℃, 5% CO2 incubator. Medium change: Replace with fresh complete medium containing 10% fetal bovine serum 16 hours after transfection. Virus collection: Collect viral supernatant at 48 hours and 72 hours after transfection. At 48 hours, pour the medium into a 50mL centrifuge tube and add 10mL of fresh complete medium to continue culturing; at 72 hours, directly pour the medium into a 50mL centrifuge tube. Virus concentration and purification: Centrifuge at 2000×g for 10 min at 4℃ to remove cell debris, collect the supernatant and place it in an ultracentrifuge tube, centrifuge at 82700×g for 120 min at 4℃, resuspend the virus pellet in complete culture medium, and aliquot into sterile virus tubes. Store the virus at -80℃. The titers of HBLV-h-MDFI shRNA1-ZsGreen-PURO, HBLV-h-MDFI shRNA2-ZsGreen-PURO, and HBLV-h-MDFI shRNA3-ZsGreen-PURO were all 2×10⁻⁶. 8 TU / mL, the control titer for HBLV-ZsGreen-PURO NC is 2.5 × 10⁻⁶. 8 TU / mL. After comparing their silencing efficiency and effects on cell viability and damage, shRNA1 was found to be the most effective, and subsequent experiments used shRNA1.

[0032] The results showed that in the established cisplatin-resistant A549 / DDP cells, MDFI expression was significantly increased, accompanied by changes in cell morphology, including reduced cell size, increased nucleoli, and colony aggregation. Figure 4 A and Figure 4B). Effects of MDFI knockdown on cisplatin-resistant cells: Using the cisplatin-resistant cell line A549 / DDP as a model, MDFI was knocked down via shRNA (shMDFI). Western blot results showed that FBXL18 protein levels significantly increased after MDFI knockdown, along with enhanced apoptosis-related markers (such as Cleaved-PARP). Quantitative statistical plots visually demonstrated that FBXL18 expression was restored and apoptosis levels increased after MDFI knockdown. MDFI knockdown can restore FBXL18 expression and promote apoptosis in cisplatin-resistant cells. MDFI knockdown can reverse the cisplatin-resistant cell phenotype. This demonstrates that high MDFI expression is one of the key factors in cisplatin resistance in lung cancer, promoting resistance by inhibiting FBXL18 and upregulating β-catenin; MDFI knockdown can restore FBXL18 expression, induce apoptosis in drug-resistant cells, and reverse the cisplatin-resistant phenotype. Figure 5 As shown, knockdown of MDFI reverses the cisplatin-resistant phenotype. CCK-8 assay confirmed that knockdown of MDFI significantly reduced the half-maximal inhibitory concentration (WMC) of cisplatin in A549 (7.088 vs. 4.696 µg / mL, Δ = 2.392), H1299 (9.066 vs. 6.242 µg / mL), and A549 / DDP cells (20.72 vs. 12.58 µg / mL). Figure 5 ).

[0033] 2.2 Effect of FBXL18 gene knockdown / overexpression on the half-maximal inhibitory concentration (IC50) of cells The transcript overexpressing FBXL18 is identified as NM_024963.6; the expression vector for the gene knockout plasmid targeting MDFI is pcDNA3.1-CMV-MCS-3flag-EF1-ZsGreen-T2A-Puro, and the vector map is shown below. Figure 6 As shown. The sequence design and synthesis of FBXL18shRNA were completed by Wuhan Hanheng Biotechnology Co., Ltd. The double-stranded shRNA sequence was synthesized, and PAGE-purified oligo primers were diluted to 100 μM. The shRNA sequence is as follows: Upstream chain: GCUGAGAAGAAGAAGAUGA (SEQ ID NO: 10); Downstream chain: UCAUCUUCUUCUUCUUCAGC (SEQ ID NO: 11).

[0034] CCK-8 assay confirmed that overexpression of FBXL18 significantly reduced the half-maximal inhibitory concentration (WMC) of cisplatin in A549 (7.527 vs. 5.829 µg / mL, Δ = 1.698), H1299 (9.3 vs. 7.064 µg / mL, Δ = 2.236), and A549 / DDP cells (15.03 vs. 8.587 µg / mL, Δ = 6.443). Figure 7 Knockdown of FBXL18 significantly increased the half-maximal inhibitory concentration (WMC) of cisplatin in A549 (7.215 vs. 8.196 µg / mL, Δ = 0.981), H1299 (9.302 vs. 12.56 µg / mL, Δ = 3.258), and A549 / DDP cells (15.24 vs. 19.47 µg / mL, Δ = 4.23). Figure 7 Knockdown / overexpression of FBXL18 can reverse the drug resistance phenotype in lung cancer cells.

[0035] The results are as follows Figure 8 As shown: Immunofluorescence revealed that MDFI (yellow fluorescence) and FBXL18 (red fluorescence) significantly co-localized in the cytoplasm and perinuclear region, and both proteins exhibited a granular distribution. Figure 8 A), providing subcellular evidence for the functional interaction between the two. Edu and CCK-8 experiments showed that FBXL18 overexpression significantly inhibited the proliferation of A549 and H1299 cells, while MDFI overexpression partially reversed this effect and promoted NSCLC cell proliferation. Figure 8 BD). This indicates that FBXL18 can inhibit the viability of lung cancer cells, further confirming the inhibitory effect of FBXL18 on lung cancer cell growth, and this inhibitory effect is closely related to MDFI. The scratch healing assay showed that FBXL18 overexpression significantly inhibited the migration of A549 cells (48 hours) and H1299 cells (from 24 hours), suggesting a cell line-specific time response. MDFI overexpression can reverse the inhibitory effect of FBXL18 on cell migration. Figure 8 EF) indicates that FBXL18 inhibits lung cancer cell migration via MDFI: Wound healing assays were used to detect cell migration ability, and the results showed that FBXL18 could inhibit lung cancer cell migration, suggesting that FBXL18 may inhibit cancer cell metastasis by affecting MDFI and thus altering the migration characteristics of lung cancer cells. Transwell assays further confirmed that FBXL18 overexpression reduced the invasiveness of both cell lines by more than 50%, while MDFI overexpression could partially reverse this effect. These results indicate that FBXL18 can inhibit the invasiveness of lung cancer cells, suggesting that FBXL18 may reduce the invasiveness of lung cancer cells and decrease the infiltration of cancer cells into surrounding tissues by inhibiting MDFI. Figure 8 These phenotypic results indicate that FBXL18 promotes MDFI proteasome degradation and inhibits nuclear translocation of β-catenin and downstream epithelial-mesenchymal transition (EMT). Therefore, when FBXL18 is overexpressed, the proliferation, invasion, and migration of lung cancer cells are all suppressed.

[0036] Example 3: MDFI enhances lung cancer cell proliferation, migration, invasion, and cisplatin resistance by activating the Wnt / β-catenin signaling pathway and epithelial-mesenchymal transition (EMT). Total RNA was extracted from A549, H1299, and A549 / DDP cells for enrichment analysis and transcriptome sequencing. Functional enrichment analysis of differentially expressed genes was performed using the GO and KEGG databases to screen signaling pathways significantly associated with MDFI expression, with a focus on analyzing the association between the Wnt / β-catenin signaling pathway and EMT and drug resistance-related genes. MDFI overexpression and knockdown model construction and biomarker detection: The transcript for overexpressing MDFI was designated as the classic transcript NM_001300806.2. An MDFI overexpression vector (pcDNA3.1-MDFI) and a shRNA interference vector targeting MDFI were constructed and transfected into lung cancer cell lines, as in Example 2. An empty vector transfection group was also included as a negative control. After 48–72 h of transfection, total and nuclear proteins were extracted from the cells. Western blot was used to detect the expression levels of β-catenin (total and nuclear proteins), EMT markers (E-cadherin, N-cadherin), EMT transcription factor (Snail), Wnt pathway-related molecules (AXIN1), invasion-related molecules (MMP7), and stemness markers (SOX2, CD133). qRT-PCR was used to detect the mRNA expression levels of these molecules. In the β-catenin inhibitor intervention experiment, MDFI-overexpressing cells were divided into a control group and an IWR-1 treatment group. Cells were incubated with IWR-1 at a final concentration of 10 μmol / L for 48 h. After cell collection, Western blot and qRT-PCR were used to detect changes in the expression of EMT markers (E-cadherin, N-cadherin) and stemness markers (SOX2, CD133). A cell model of MDFI knockdown was constructed, and nuclear proteins were extracted. Western blot was used to detect the expression level of β-catenin in the nucleus. Immunofluorescence staining was used to observe the intracellular localization and distribution of β-catenin. A cell model of MDFI overexpression was constructed by adding XAV939 (β-catenin degradation inducer) at a final concentration of 5 μmol / L or WGA (nuclear import inhibitor) at a final concentration of 20 μg / mL, and incubating for 48 h. An MDFI overexpression group without inhibitors was set up as a control. Total protein, cytoplasmic protein, and nuclear protein were extracted from cells in each group. Western blot was used to detect the expression levels of β-catenin in the cytoplasm and nucleus. A dual-luciferase reporter gene assay was used to detect the transcriptional activity of β-catenin. Simultaneously, changes in the expression of EMT markers and stemness markers were detected.

[0037] Enrichment analysis showed that MDFI was associated with the Wnt / β-catenin signaling pathway and was positively correlated with EMT markers, EMT transcription factors, and drug resistance-related genes. Figure 9(AC). Mechanistically, MDFI overexpression upregulated β-catenin, N-cadherin, snail, AXIN1, MMP7, SOX2, and the dryness marker CD133, while downregulating E-cadherin. MDFI knockdown produced the opposite effect. Figure 9 D). Treatment with the β-catenin inhibitor IWR-1 reversed the EMT phenotype induced by MDFI overexpression, reduced the expression of N-cadherin, snail, SOX2, and CD133, and restored the expression of E-cadherin. Figure 9 E).

[0038] Nuclear-cytoplasmic separation experiments showed that MDFI knockdown reduced the level of nuclear β-catenin in both cell lines, indicating that MDFI promotes the translocation of β-catenin into the nucleus. Figure 9 F, Figure 9 G). In the MDFI overexpression model, both cytoplasmic and nuclear MDFI levels increased, promoting β-catenin accumulation and nuclear translocation. Combined use of XAV939 or WGA effectively blocked the β-catenin signaling pathway. XAV939 reduced cytoplasmic and nuclear β-catenin, leading to downregulation of epithelial-mesenchymal transition (EMT) markers and stem cell markers. WGA specifically inhibited nuclear β-catenin accumulation and its transcriptional activity, indicating that MDFI-mediated nuclear localization of β-catenin is crucial for EMT activation. Figure 9 H, Figure 9 I). In summary, MDFI activates the Wnt / β-catenin pathway, promotes β-catenin nuclear translocation, and induces epithelial-mesenchymal transition, thereby enhancing malignant behavior.

[0039] Example 4: Effects of the interaction between FBXL18 and MDFI Protein-protein interaction prediction and structural simulation experiments: A bait vector for the FBXL18 gene was constructed and subjected to yeast two-hybrid sequencing (Y2H-Seq) with a non-small cell lung cancer cell cDNA library. Proteins interacting with FBXL18 were screened and interaction scores were calculated. The three-dimensional structures of FBXL18 and MDFI were predicted using AlphaFold, and the binding interface between the two was identified through molecular docking. Then, 60 ns molecular dynamics simulations were performed using GROMACS software to analyze parameters such as solvent accessible surface area (SASA), root mean square fluctuation (RMSF), root mean square deviation (RMSD), and radius of gyration (Rg). At the same time, the changes in the number of hydrogen bonds during the simulation were statistically analyzed and the Gibbs free energy landscape was calculated to evaluate the stability of the complex.

[0040] To verify the post-transcriptional regulation of MDFI by FBXL18, lung cancer cell lines were transfected. 48 h after transfection, the mRNA expression level of MDFI in the cells was detected by qRT-PCR, and the protein expression level of MDFI was detected by Western blot, thereby analyzing the regulatory mechanism of FBXL18 on MDFI.

[0041] Protein-protein direct interaction verification experiment (immunoprecipitation experiment): Endogenous and exogenous verification were carried out separately. For endogenous verification, total protein was extracted from lung cancer cells and immunoprecipitated (Co-IP) with FBXL18 specific antibody (Catalog number PC16039M, Abmart, WB-1:300, IHC-1:200, IF-1:200). The presence of MDFI in the precipitation product was detected by Western blot. For exogenous verification, 293T cells were co-transfected with Flag-FBXL18 and Myc-MDFI plasmids, and then immunoprecipitated with Flag and Myc tag antibodies respectively to verify the direct binding of the two.

[0042] Rescue experiment on FBXL18 regulation of downstream MDFI pathway: Lung cancer cells were transfected with plasmids and shRNA from various groups; 72 h after transfection, total cellular protein was extracted, and the expression levels of β-catenin, N-cadherin, SNAIL, AXIN1, MMP7, SOX2, CD133 and E-cadherin were detected by Western blot to clarify the mediating role of MDFI in the FBXL18 regulatory pathway.

[0043] Validation experiments on MDFI degradation mediated by the ubiquitin-proteasome pathway: 1) Proteasome inhibitor intervention experiment: FBXL18 overexpressing cells were divided into a control group and an MG132 treatment group. MG132 was added to the cells and incubated for 12 h. Changes in MDFI protein expression were detected by Western blot. 2) Protein half-life detection: FBXL18 overexpressing cells and control group cells were treated with cyclohexylimide (CHX) to a final concentration of 50 μg / mL. Cells were collected at 0 h, 2 h, 4 h, 6 h, and 8 h, respectively. MDFI protein content was detected by Western blot, and the half-life of MDFI in the two groups was calculated and compared. 3) Ubiquitination experiment: FBXL18 overexpression vector, MDFI overexpression vector, and HA-Ub plasmid were co-transfected into lung cancer cells. After adding MG132 to inhibit protein degradation, immunoprecipitation was performed using MDFI antibody, and the ubiquitination level of MDFI was detected by Western blot.

[0044] Validation experiment of key binding sites of FBXL18: Based on phosphorylation sites and UniProt prediction results, mutants of FBXL18 with lysine to arginine conversion (K48R, K167R, K340R, K706R) were constructed. Wild-type and each mutant FBXL18 vector were co-transfected with MDFI vectors into cells, and the binding ability of the two was detected by immunoprecipitation. At the same time, Western blot was used to detect the protein stability of each mutant and the expression level of downstream β-catenin pathway-related molecules to verify the function of key sites.

[0045] Y2H-Seq and AlphaFold structural simulations confirmed a high-probability interaction between FBXL18 and MDFI (interaction score: 0.9242) with a well-defined binding interface. Molecular dynamics simulations showed that the complex was stable, exhibiting the following characteristics: SASA convergence in the -430-450 region after 60 nanoseconds; low RMSF except for the flexible ring region (residues 400-450 and 800-850); and stable RMSD and Rg values ​​after initial equilibrium, indicating a compact structure. The number of hydrogen bonds and Gibbs free energy landscape further confirmed the stability and conformational adaptability of the complex.

[0046] The results showed that FBXL18 overexpression did not change MDFI mRNA levels but significantly reduced MDFI protein levels, confirming post-translational regulation. Figure 10 A). Immunoprecipitation assay confirmed that FBXL18 directly binds to MDFI ( Figure 10 B). Western blot analysis showed that FBXL18 overexpression inhibited MDFI protein and downstream β-catenin pathway activity—reducing the expression of β-catenin, N-cadherin, SNAIL, AXIN1, MMP7, SOX2, and CD133, while increasing E-cadherin expression. These effects were partially reversed by MDFI co-overexpression, confirming that FBXL18 regulates this pathway by targeting and degrading MDFI. Figure 10 C). The proteasome inhibitor MG132 blocked the degradation of MDFI, and cyclohexylimide tracking experiments showed that FBXL18 overexpression shortened the half-life of MDFI, indicating that it is regulated through the ubiquitin-proteasome system. Figure 10 DI). Ubiquitination experiments confirmed that FBXL18 mediates K48-linked polyubiquitination of MDFI, thereby promoting its degradation ( Figure 10 JM). Based on phosphorylation sites and UniProt predictions, lysine-arginine mutants of FBXL18 (K48R, K167R, K340R, K706R) were constructed. Co-immunoprecipitation experiments showed that wild-type FBXL18 and all mutants except K340R could bind to MDFI, indicating that lysine 340 is crucial for the interaction. Figure 10NO). While the K340R mutation does not affect the stability of FBXL18, it completely eliminates its ability to bind MDFI and regulate downstream signaling, suggesting that this site plays a crucial role in complex formation. Figure 10 P).

[0047] In summary, FBXL18, as an E3 ubiquitin ligase for MDFI, inhibits β-catenin signaling and epithelial-mesenchymal transition by promoting its K48-linked ubiquitination and degradation. This discovery reveals a novel regulatory axis targeting MDFI to drive lung cancer malignancies.

[0048] Example 5: Effects of upregulating FBXL18 and downregulating MDFI on non-small cell lung cancer

[0049] 5.1 Effects of VPA on non-small cell lung cancer cells (in vitro experiment) Drug screening and concentration optimization: Small molecule compounds targeting and regulating FBXL18 and MDFI expression were searched using the CTD database, and valproic acid (VPA) was identified as a candidate drug. The effects of different concentrations of VPA (0, 1, 2, 5, 10 mmol / L) on the viability of A549, H1299, and A549 / DDP cells were detected using the CCK-8 assay to screen for the optimal concentration that showed no significant cytotoxicity and effectively regulated target gene expression. Combined drug treatments and IC50 were also investigated. 50 Lung cancer cells were tested in three groups: control group (medium medium containing 0.1% DMSO), cisplatin monotherapy group (gradient concentrations of cisplatin), VPA monotherapy group (optimal concentration), and VPA + cisplatin combination group (optimal concentration of VPA pretreated for 24 h followed by gradient concentrations of cisplatin). Each group had three replicates. After culturing for 48 h, CCK-8 reagent was added and incubated for 2 h. The absorbance at 450 nm was measured using a microplate reader, and the half-maximal inhibitory concentration (IC50) of cisplatin in each group was calculated. 50In the colony formation assay, A549 and H1299 cells in logarithmic growth phase were divided into a control group, a VPA treatment group, a cisplatin treatment group, and a VPA + cisplatin combination group. An additional MDFI overexpression + combination drug group was also included. Cells from each group were seeded at a density of 500 cells per well in 6-well plates and cultured for 14 days. After the culture medium was discarded, cells were fixed with 4% paraformaldehyde, stained with crystal violet, and colonies with more than 50 cells were counted to calculate the colony formation rate. For apoptosis detection, cells were treated with the same groupings as in the colony formation assay. After 48 h of drug treatment, cells were collected, washed twice with pre-cooled PBS, and incubated with Annexin V-FITC and PI staining solution in the dark for 15 min. The apoptosis rate was detected by flow cytometry, and the data were analyzed using FlowJo software. The rescue experiment was conducted by constructing an MDFI overexpression vector and an empty control vector, which were then introduced into A549 and H1299 cells via liposome transfection. After 48 h of transfection, stable expression cell lines were selected, and then treated with VPA + cisplatin. Subsequently, colony formation experiments and apoptosis detection were carried out to verify the mediating role of MDFI in drug regulation pathways.

[0050] The results are as follows Figure 11 The results showed that VPA combined with cisplatin further reduced the half-maximal inhibitory concentration (WMC) of cisplatin in A549 (6.708 vs. 5.083 µg / mL, Δ = 1.625), H1299 (9.847 vs. 7.655 µg / mL, Δ = 2.192), and A549 / DDP cells (21.5 vs. 16.49 µg / mL, Δ = 5.01). Colony formation assays showed that VPA synergistically inhibited the proliferation of A549 and H1299 cells with cisplatin, an effect partially offset by MDFI overexpression. Flow cytometry analysis further indicated that VPA alone significantly increased apoptosis, while combination with cisplatin induced a stronger apoptotic effect. However, MDFI overexpression significantly attenuated the pro-apoptotic effect of dual therapy. These results indicate that the FBXL18-MDFI-β-catenin axis drives chemoresistance in lung cancer by regulating epithelial-mesenchymal transition (EMT) and stem cell-related pathways. Targeting this axis with VPA may restore cisplatin sensitivity, providing a potential strategy for reversing chemoresistance.

[0051] 5.2 VPA and cisplatin synergistically inhibit tumor growth in vivo (in vivo experiment) The in vivo efficacy of VPA combined with cisplatin was evaluated using a nude mouse xenograft model. Female BALB / c nude mice (4-5 weeks old; Kunming Medical University Animal Experiment Center) were housed under specific pathogen-free conditions and received a total of 5 × 10⁵ VPA xenografts. 6 A549 or H1299 cells. Treatment begins when the tumor volume is approximately 100 mm.3 Treatment regimen: Cisplatin: 2 mg / kg, intraperitoneal injection, once weekly; VPA: 150 mg / kg, intraperitoneal injection, once daily; Combination therapy: Cisplatin + VPA. Tumor volume is calculated as (L×W). 2 ) / 2 calculation. Mice reached tumor size on day 21 or when the tumor volume reached 1500 mm. 3 Euthanasia was performed. Organs were harvested for hematoxylin-eosin (H&E) staining and IHC.

[0052] The results are as follows Figure 12 As shown, compared with the control group, both cisplatin (DDP) monotherapy and VPA monotherapy significantly inhibited the growth of A549 and H1299 tumors. The combination therapy group (DDP+VPA) showed the flattest tumor growth curve and the smallest final tumor volume among all groups, suggesting a synergistic anti-tumor effect. Immunohistochemical analysis showed that the combination therapy group had the lowest Ki67 positivity rate, confirming a significant inhibition of tumor cell proliferation. In the cisplatin monotherapy group, the expression of β-catenin, P-glycoprotein (P-gp), and MDFI was upregulated, while the expression of FBXL18 was downregulated, suggesting that cisplatin may induce chemotherapy resistance by activating the β-catenin signaling pathway and drug efflux proteins. In contrast, VPA monotherapy increased the expression of FBXL18 (P<0.05) and decreased the levels of β-catenin, P-gp, and MDFI, consistent with its in vitro mechanism of action. Notably, compared to monotherapy, the combination therapy did not significantly alter the expression of β-catenin, P-gp, or FBXL18, but it partially reduced MDFI expression, suggesting that dual targeting may counteract the compensatory resistance mechanism activated by monotherapy. VPA enhances the antitumor efficacy of cisplatin in vivo by upregulating FBXL18 and inhibiting the MDFI-β-catenin pathway. This combination therapy synergistically inhibits tumor growth, reduces proliferation, and modulates EMT / resistance markers without increasing toxicity, providing a potential strategy for overcoming chemotherapy resistance in lung cancer. This further validates the important role of the FBXL18-MDFI interaction in the development and progression of non-small cell lung cancer and cisplatin resistance.

Claims

1. The application of FBXL18 protein and / or MDFI protein as biomarkers in the preparation of products for detecting cisplatin-treated chemotherapy resistance in non-small cell lung cancer or in the preparation of drugs for treating lung cancer.

2. Application of reagents for detecting FBXL18 protein expression levels in the preparation of products for detecting cisplatin-based chemotherapy resistance in non-small cell lung cancer or in the preparation of drugs for treating non-small cell lung cancer.

3. The application as described in claim 1 or 2, characterized in that: The product described for detecting cisplatin-treated chemotherapy resistance in non-small cell lung cancer includes a reagent for detecting the expression levels of the biomarker FBXL18 protein or / and MDFI protein in biological samples.

4. The application as described in claim 3, characterized in that: The biological sample was tumor tissue from a non-small cell lung cancer patient.

5. The application as described in claim 3 or 4, characterized in that: In the non-small cell lung cancer chemotherapy-resistant patient samples, MDFI expression was significantly increased while FBXL18 expression was decreased, and FBXL18 was negatively correlated with MDFI protein expression.

6. The use of reagents that upregulate FBXL18 and / or downregulate MDFI in the preparation of products for the treatment of non-small cell lung cancer or to improve the sensitivity of non-small cell lung cancer to cisplatin chemotherapy or in combination with cisplatin for the treatment of non-small cell lung cancer.

7. The application as described in claim 6, characterized in that: The reagents used to upregulate FBXL18 and / or downregulate MDFI protein expression are VPA or shRNA that inhibits MDFI protein expression.

8. The application as described in claim 6, characterized in that: The MDFIshRNA is a double-stranded DNA sequence, and the upstream and downstream strands of the double-stranded DNA sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

Images