Methods and compositions for dwarf plants to increase harvest yield by manipulating gibberellin metabolism

Abstract

The present disclosure provides compositions and methods for altering gibberellin (GA) content in corn or other cereal plants. Also provided are methods and compositions for altering the expression of a gene associated with gibberellin biosynthesis by repressing, mutagenizing and / or editing a specific subtype of the endogenous GA3 oxidase gene. Further provided are modified plant cells and plants having mutations or genomic edits that reduce the expression and / or activity of the endogenous GA3 oxidase gene, comprising, in particular, reduced gibberellin levels and improved phenotypes or traits in a female organ or ear, such as reduced plant height and increased lodging resistance, however, no special shape exists.

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Provisional Application Serial Nos. 63 / 520,915 and 63 / 520,898, filed on August 21, 2023, the full text of which is incorporated herein by reference.

[0002] Merging of sequence lists A sequence listing file named "BCS236343_SeqListing", which is 492 kilobytes in size (measured in MS-WINDOWS) and was created on August 15, 2024, is submitted with this application and is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure relates to compositions and methods for improving traits (such as lodging resistance and increased yield) of monocotyledonous or cereal plants (including maize). Background Technology

[0004] Gibberellin (gibberellic acid, or GA) is a plant hormone that regulates many major plant growth and development processes. In the 20th century, manipulation of GA levels in semi-dwarf wheat, rice, and sorghum varieties led to increased yields and reduced lodging in these cereal crops, largely contributing to the Green Revolution. However, successful yield increases through GA pathway manipulation have not been achieved in other cereal crops, such as maize. In fact, some mutations in GA pathway genes are associated with various incompatible aberrations or severely reduced plant height in maize, preventing researchers from using GA pathway manipulation to find semi-dwarf, high-yielding maize varieties.

[0005] There is a need in the field to develop monocotyledonous or cereal crop plants, such as maize, that have mutations in genes that affect plant height and increase yield and / or lodging resistance without the presence of heterosis or severe reduction in plant height. Attached Figure Description

[0006] Figure 1 The study showed reduced plant height in maize inbred plants expressing the GA20 oxidase repressor construct across eight transformation events compared to inbred control plants; Figure 2A The study showed a reduced average plant height in hybrid maize plants expressing the GA20 oxidase repressor construct compared to hybrid control plants. Figure 2B An image showing a wild-type hybrid control plant (left) next to a hybrid maize plant (right) expressing a GA20 oxidase repressor construct with reduced plant height; Figure 3A The study showed an increase in average stem diameter in hybrid maize plants expressing the GA20 oxidase repressor construct compared to hybrid control plants; Figure 3B The image shows a cross-section (right) of the stalk of a hybrid maize plant expressing the GA20 oxidase repressor construct with increased stalk diameter, next to a cross-section (left) of the stalk of a wild-type hybrid control plant; Figure 4 The study showed an increase in average fresh ear weight in hybrid maize plants expressing the GA20 oxidase repressor construct compared to hybrid control plants. Figure 5 The study showed that, in response to wind events that caused significant lodging in hybrid control plants, hybrid maize plants expressing the GA20 oxidase repressor construct had increased mean fresh ear weight in two field trials compared to wild-type hybrid control plants. Figure 6 The increased harvest index of hybrid maize plants expressing the GA20 oxidase repressor construct was shown compared to hybrid control plants; Figure 7 The study showed an increase in the estimated mean grain yield of hybrid maize plants expressing the GA20 oxidase repressor construct compared to hybrid control plants. Figure 8 The increased mean yield score of hybrid maize plants expressing the GA20 oxidase repressor construct is shown compared to hybrid control plants; Figure 9 The changes in plant height over time between transgenic maize plants and controls were shown during developmental stages V11 to beyond R1. Figure 10 The stable oxygen isotope ratio (δ¹²) in leaf tissue at the R5 stage, used as an indicator of stomatal conductance, is shown in comparison between transgenic maize plants and controls. 18 A graph showing the measurement results of O and water content; Figure 11 The graph shows the root penetration rate during developmental stages V10 to over R2, measured under both SAP and HD conditions using sensors at different soil depths to compare transgenic and control plants. These sensors detect changes in water content, thus indicating the presence of roots at that depth. Figure 12A The study showed the difference in stomatal conductance between transgenic maize plants and controls in the morning and afternoon during normal and drought conditions in a greenhouse. Figure 12B The differences in photosynthesis between transgenic maize plants and controls during the morning and afternoon periods were shown in a greenhouse under normal and drought conditions. Figure 13AThe differences in miRNA expression levels in whole stem tissue or isolated vascular and non-vascular stem tissue of transgenic maize plants compared to controls were shown; and Figure 13B The study showed differences in the expression levels of GA20 oxidase 3 and GA20 oxidase 5 mRNA transcripts in whole stem tissue or isolated vascular and non-vascular stem tissues of transgenic maize plants compared to controls.

[0007] Figure 14 This illustrates the different conjugations of inversion editing in the 3' UTR of the Zm.GA3ox_1 gene, where hybridization between complementary UTR sequences of wild-type and inversion-edited alleles leads to RNA repression or silencing of the Zm.GA3ox_1 gene only in heterozygous plants. Figure 14 C), while for wild-type alleles ( Figure 14 A) or inversion editing of alleles ( Figure 14 B) Homozygous plants will not exhibit complementary sequence hybridization and RNA suppression or silencing of the Zm.GA3ox_1 gene. Edited alleles containing an inverted Zm.GA3ox_1 gene in the 5' UTR of the Zm.GA3ox_1 gene can be prepared to produce a similar effect on Zm.GA3ox_1 gene expression.

[0008] Figure 15 A diagram comparing the wild-type (WT) and edited alleles of the Zm.GA3ox_1 gene is provided, in which the edited alleles have deletions and inversions in the 3' UTR region.

[0009] Figure 16 A diagram is provided showing the approximate location of gRNA target sites within the promoter region 2,000 bp upstream of the transcription start site (TSS) of the Zm.GA3ox_1 gene, which are used to generate mutations in the promoter region of the Zm.GA3ox_1 gene. Detailed Implementation

[0010] definition To aid in understanding this disclosure, several terms and abbreviations used herein are defined below: The term "and / or," when used in a list of two or more items, means that any of the listed items may be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" means one or both of A and B—that is, A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0011] As used herein, the term “approximately” is intended to define the numerical value it modifies, thus representing such a value as a variable within a certain error limit. When no specific error limit is listed, such as the standard deviation of the mean, the term “approximately” should be understood to mean the range that covers the listed values, as well as the range that includes significant figures through rounding up or down to that number.

[0012] As used in this article, "cereals" refers to grasses belonging to the Poaceae family (grasses). Poaceae ) or Poaceae ( Gramineae Monocotyledonous (monocotyledonous) crop plants that are typically harvested for their seeds include, for example, wheat, corn, rice, millet, barley, sorghum, oats, and rye. As commonly understood, "corn plant" or "maize plant" refers to the species maize (Corn). Zea mays Any plant and including all plant varieties that can be bred with maize, including wild maize species.

[0013] The term "percentage of identity" or "percentage of similarity" as used herein with respect to two or more nucleotide or protein sequences is calculated by: (i) comparing two optimally aligned sequences (nucleotides or proteins) on a comparison window; (ii) determining the number of positions in which identical nucleic acid bases (for nucleotide sequences) or amino acid residues (for proteins) are present in both sequences to produce a number of matching positions; (iii) dividing the number of matching positions by the total number of positions in the comparison window; and then (iv) multiplying this quotient by 100% to produce the percentage of identity. For calculating the "percentage of identity" between DNA and RNA sequences, uracil (U) in the RNA sequence is considered to be identical to thymine (T) in the DNA sequence. The "percentage of identity" may also be referred to as the "percentage of alignment identity" if the comparison window is defined as the alignment region between two or more sequences (i.e., excluding nucleotides at the 5' and 3' ends of the aligned polynucleotide sequence or amino acids at the N-terminus and C-terminus of the aligned protein sequence that are not identical between the compared sequences). If the "identity percentage" is calculated relative to a reference sequence without specifying a particular comparison window, it is determined by dividing the number of matching positions on the alignment region by the total length of the reference sequence. Therefore, for the purposes of this disclosure, when two sequences (query and topic) are optimally aligned (allowing gaps in their alignment), the "identity percentage" of the query sequence is equal to the number of identical positions between the two sequences divided by the total number of positions of the query sequence over its length (or comparison window), then multiplied by 100%.

[0014] It is recognized that the residue positions of dissimilar proteins often differ due to conserved amino acid substitutions, where amino acid residues are replaced by other amino acid residues of similar size and chemical properties (e.g., charge, hydrophobicity, polarity, etc.) and may therefore not alter the functional properties of the molecule. When sequences differ in conserved substitutions, the percentage of sequence similarity can be adjusted upwards to correct for the conservation of the dissimilar substitutions. Sequences that differ due to such conserved substitutions are referred to as having “sequence similarity” or “similarity.” Therefore, the “percentage of similarity” or “similarity percentage” for two or more protein sequences, as used herein, is calculated by: (i) comparing two best-aligned protein sequences on a comparison window, (ii) determining the number of positions in both sequences where the same or similar amino acid residues appear to produce the number of matching positions, (iii) dividing the number of matching positions by the total number of positions in the comparison window (or, if no comparison window is specified, by the total length of the reference or query protein), and then (iv) multiplying that quotient by 100% to produce the percentage of similarity. Conserved amino acid substitutions in proteins are known in the art.

[0015] To optimize sequence alignment and calculate their percentage of identity or similarity, various pairwise or multiple sequence alignment algorithms and programs are known in the art, such as ClustalW or Basic Local Alignment Search Tool® (BLAST®), which can be used to compare the sequence identity or similarity between two or more nucleotide or protein sequences. Although other alignment and comparison methods are known in the art, the alignment between two sequences (including the aforementioned percentage of identity) can be determined using the ClustalW or BLAST® algorithms; see, for example, Chenna R. et al., “Multiple sequence alignment with the Clustal series of programs,” Nucleic Acids Research 31 : 3497-3500 (2003); Thompson JD et al., "Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice," Nucleic Acids Research 22: 4673-4680 (1994); and Larkin MA et al., “Clustal W and ClustalX version 2.0,” Bioinformatics 23 : 2947-48 (2007); and Altschul, SF, Gish, W., Miller, W., Myers, EW & Lipman, DJ (1990) "Basic local alignment searchtool." J. Mol. Biol. 215:403-410 (1990), the entire contents and publications of the aforementioned documents are incorporated herein by reference.

[0016] The term "complementarity percentage" or "percentage complementarity" as used herein with respect to two nucleotide sequences is similar to the concept of identity percentage, but refers to the percentage of nucleotides in the query sequence that have optimal base pairing or hybridization with the target sequence when the query and target sequences are linearly aligned and have optimal base pairing without secondary folding structures such as loops, stems, or hairpins. This complementarity percentage can be between two DNA strands, two RNA strands, or a DNA strand and an RNA strand. The "complementarity percentage" is calculated by: (i) aligning the two nucleotide sequences in a linear and fully extended alignment (i.e., without secondary folding or secondary structures) on a comparison window to achieve optimal base pairing or hybridization; (ii) determining the number of base pairing positions between the two sequences on the comparison window to produce the number of complementary positions; (iii) dividing the number of complementary positions by the total number of positions in the comparison window; and (iv) multiplying this quotient by 100% to produce the complementarity percentage of the two sequences. Optimal base pairing of two sequences can be determined based on known pairings of nucleotide bases achieved through hydrogen bonding, such as GC, AT, and AU. If the "complementarity percentage" is calculated relative to a reference sequence without specifying a particular comparison window, the identity percentage is determined by dividing the number of complementary positions between the two linear sequences by the total length of the reference sequence. Therefore, for the purposes of this disclosure, when the two sequences (query and subject) are optimally base-paired (allowing for mismatches or non-base-paired nucleotides but without folds or secondary structures), the "complementarity percentage" of the query sequence is equal to the number of base-paired positions between the two sequences divided by the total number of positions in the query sequence over its length (or divided by the number of positions in the query sequence within the comparison window), then multiplied by 100%.

[0017] The term "operable link" refers to a functional link between a promoter or other regulatory element and an associated transcribed DNA sequence or coding sequence of a gene (or transgene), such that the promoter or the like operates or functions at least in certain cells, tissues, developmental stages and / or conditions to initiate, assist, influence, induce and / or promote the transcription and expression of the associated transcribed DNA sequence or coding sequence.

[0018] The term "plant expressible promoter" refers to a promoter that can initiate, assist, influence, induce and / or promote the transcription and expression of its associated transcribed DNA sequence, coding sequence or gene in plant cells or tissues.

[0019] The term "heterogeneous" in relation to a promoter or other regulatory sequence associated with a related polynucleotide sequence (e.g., a transcribed DNA sequence or coding sequence or gene) is a promoter or regulatory sequence that is not operatively linked to such a related polynucleotide sequence in nature, for example, the promoter or regulatory sequence has a different origin relative to the related polynucleotide sequence, and / or the promoter or regulatory sequence is not naturally present in the plant species transformed by the promoter or regulatory sequence to be used.

[0020] The term "recombinant" in relation to polynucleotide (DNA or RNA) molecules, proteins, constructs, vectors, etc., refers to a polynucleotide or protein molecule or sequence that is artificially created and not normally found in nature and / or exists in an environment not normally found in nature. This includes polynucleotide (DNA or RNA) molecules, proteins, constructs, etc., comprising combinations of two or more polynucleotide or protein sequences that would not naturally exist together in the same manner without human intervention, such as polynucleotide molecules, proteins, constructs, etc., comprising at least two operatively linked but heterologous polynucleotide or protein sequences. For example, the term "recombinant" can refer to any combination of two or more DNA or protein sequences in the same molecule (e.g., plasmid, construct, vector, chromosome, protein, etc.) where such combinations are artificial and not normally found in nature. As used in this definition, the phrase "not normally found in nature" means not found in nature without human introduction. Recombinant polynucleotide or protein molecules, constructs, etc., may contain polynucleotide or protein sequences that are (i) isolated from other naturally occurring polynucleotide or protein sequences that are adjacent to each other, and / or (ii) adjacent to other naturally occurring polynucleotide or protein sequences that are not adjacent to each other. Such recombinant polynucleotide molecules, proteins, constructs, etc., may also refer to polynucleotide or protein molecules or sequences that have been genetically engineered and / or constructed extracellularly. For example, recombinant DNA molecules may contain any engineered or artificial plasmids, vectors, etc., and may include linear or circular DNA molecules. Such plasmids, vectors, etc., may contain various maintenance elements, including prokaryotic origins of replication and selectable markers, and possibly one or more transgenes or expression cassettes in addition to plant selectable marker genes, etc.

[0021] As used herein, the term "separated" means at least partially separated from other molecules that are normally associated with it in their natural state. In one embodiment, the term "separated" means that a DNA molecule is separated from the nucleic acids that are normally side-attached to the DNA molecule in their natural state. For example, if a DNA molecule encoding a protein naturally present in bacteria is not found within the DNA of a bacterium whose DNA molecule encoding said protein is naturally found, then it is a separated DNA molecule. Thus, a DNA molecule that is fused to or operatively linked with one or more other DNA molecules that would not associate with in nature, for example, as a result of recombinant DNA or plant transformation techniques, is considered separated. Such molecules are considered separated even when integrated into the chromosome of a host cell along with other DNA molecules or when present in a nucleic acid solution.

[0022] As used herein, a “coding region” or “coding region” refers to a portion of a polynucleotide that encodes a functional unit or molecule (e.g., but not limited to mRNA, protein, or non-coding RNA sequence or molecule).

[0023] As used herein, “modified” in the context of plants, plant seeds, plant parts, plant cells, and / or plant genomes means, relative to wild-type or control plants, plant seeds, plant parts, plant cells, and / or plant genomes, an engineered alteration of the expression level and / or coding sequence of one or more GA oxidase genes, such as via (A) a transgenic event containing a repressor construct or transcribed DNA sequence encoding a non-coding RNA that represses one or more GA3 and / or GA20 oxidase genes, or (B) a genome editing event or mutation that affects (e.g., reduces or eliminates) the expression level and / or activity of one or more endogenous GA3 and / or GA20 oxidase genes. In practice, the term "modified" can further refer to a plant, plant seed, plant part, plant cell, and / or plant genome having one or more mutations affecting the expression of one or more endogenous GA oxidase genes (such as one or more endogenous GA3 and / or GA20 oxidase genes), introduced by chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis technique, or introduced by genome editing (i.e., targeted genome editing techniques). Therefore, for clarity, modified plants, plant seeds, plant parts, plant cells, and / or plant genomes include mutated, edited, and / or transgenic plants, plant seeds, plant parts, plant cells, and / or plant genomes having the expression level, expression pattern, and / or coding sequence of one or more modified GA oxidase genes relative to wild-type or control plants, plant seeds, plant parts, plant cells, and / or plant genomes. Modified plants or seeds may contain various molecular alterations affecting the expression of GA oxidase genes (such as GA3 and / or GA20 oxidase genes), including genetic and / or epigenetic modifications. It can induce mutagenesis, genome editing, or site-specific integration (e.g., but not limited to, using site-specific nucleases) and genetic transformation (e.g., but not limited to, using...) of modified plants, plant parts, seeds, etc. AgrobacteriumMethods of transformation or particle bombardment, or combinations thereof. Such “modified” plants, plant seeds, plant parts, and plant cells include those that are descendants, offspring, or derived from “modified” plants, plant seeds, plant parts, and plant cells that retain molecular alterations (e.g., alterations in expression levels and / or activity) to one or more GA oxidase genes. Modified seeds provided herein can produce modified plants provided herein. Modified plants, plant seeds, plant parts, plant cells, or plant genomes provided herein may contain recombinant DNA constructs or vectors or genome editing as provided herein. “Modified plant products” can be any product made from modified plants, plant parts, plant cells, or plant chromosomes or any part or component thereof provided herein.

[0024] As used herein, the term "control plant" (or similarly, "control" plant seeds, plant parts, plant cells, and / or plant genome) refers to a plant (or plant seed, plant part, plant cell, and / or plant genome) used for comparison with the modified plant (or modified plant seed, plant part, plant cell, and / or plant genome) and has the same or similar genetic background (e.g., the same parental line, hybrid line, inbred line, test species, etc.) as the modified plant (or plant seed, plant part, plant cell, and / or plant genome), except for transgenic and / or genome editing events affecting one or more GA oxidase genes. For example, a control plant may be an inbred line identical to the inbred line used to produce the modified plant, or a control plant may be the product of a hybridization of the same inbred parental line as the modified plant, except that no transgenic or genome editing events affecting one or more GA oxidase genes are present in the control plant. For comparison with modified plants, plant seeds, plant parts, plant cells, and / or plant genomes, "wild-type plant" (or similar "wild-type" plant seeds, plant parts, plant cells, and / or plant genomes) refers to a non-transgenic and non-genome-edited control plant, plant seed, plant part, plant cell, and / or plant genome. As used herein, a "control" plant, plant seed, plant part, plant cell, and / or plant genome may also be a plant, plant seed, plant cell, and / or plant genome with a similar (but different or dissimilar) genetic background to the modified plant, plant seed, plant part, plant cell, and / or plant genome, if considered sufficiently similar to compare the characteristics or traits to be analyzed.

[0025] As used herein, a “locus” is a chromosomal or genomic locus or region containing a polymorphic nucleic acid, a trait determinant, a gene, or a marker. A “locus” may be shared by two homologous chromosomes to refer to their respective loci or regions. As used herein, an “allelic gene” is an alternative nucleic acid sequence at a particular locus (e.g., a nucleic acid sequence of a gene or locus that is different from other alleles of the same gene or locus). Such alleles may be considered (i) wild-type, or (ii) mutant if one or more mutations or edits are present in the nucleic acid sequence of the mutant allele relative to the wild-type allele. As used herein, a “mutant gene” or “mutant allele” is a gene or allele that has one or more mutations or edits in the nucleic acid sequence of the gene or allele relative to the wild-type gene or wild-type allele, wherein the mutant gene or mutant allele has reduced and / or altered expression and / or reduced and / or altered activity relative to the wild-type gene or wild-type allele. As used herein, a "wild-type gene" or "wild-type allele" refers to a gene or allele that has the most common sequence or genotype in a particular plant species, or another sequence or genotype with a natural variation, polymorphism, or other silent mutation relative to the most common sequence or genotype that does not significantly affect the expression and activity of the gene or allele. In fact, a "wild-type" gene or allele does not contain any variation, polymorphism, or any other type of mutation that substantially affects the normal function, activity, expression, or phenotypic outcome of the gene or allele. A mutant allele of a gene can be a loss-of-function allele and / or have reduced or eliminated gene activity or expression levels relative to a wild-type allele. A mutant allele can be a sub-effective allele with reduced activity and / or expression relative to a wild-type allele. A mutant allele can be a null allele with no activity and / or expression relative to a wild-type allele. A mutant allele of a gene or locus can have one or more mutations introduced into the gene or locus via any mutagenesis and / or targeted genome editing technology. In diploid organisms such as maize, the first allele can appear on one chromosome, and the second allele can appear at the same locus on a second homologous chromosome. If one allele at a locus on a chromosome of a plant is a mutant allele and the other corresponding allele on the homologous chromosome of the plant is wild-type, then the plant is described as heterozygous for that mutant allele. However, if both alleles at a locus are mutant alleles, then the plant is described as homozygous for that mutant allele. A plant homozygous for the mutant allele at a locus can contain the same mutant allele or different mutant alleles (if they are heteroallelic or bialic).

[0026] As used herein, a “target site” for genome editing refers to the location within a plant genome where a site-specific nuclease binds to and cleaves a polynucleotide sequence, introducing a double-strand break (or single-strand cut) into the nucleic acid backbone of the polynucleotide sequence and / or its complementary DNA strand. A target site may contain at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, or 30 consecutive nucleotides. A “target site” for an RNA-guided nuclease may contain a sequence at the target site from either complementary strand of a double-stranded nucleic acid (DNA) molecule or a chromosome. Site-specific nucleases can bind to target sites, such as via non-coding guide RNA (e.g., but not limited to, CRISPR RNA (crRNA) or single guide RNA (sgRNA), as further described below). The non-coding guide RNAs provided herein can be complementary to the target site (e.g., complementary to either strand of the double-stranded nucleic acid molecule or chromosome at the target site). It will be understood that binding or hybridization of the non-coding guide RNA to the target site does not require perfect identity or complementarity. For example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 mismatches (or more) between the target site and the non-coding RNA may be permissible. “Target site” also refers to the location within the plant genome of a polynucleotide sequence that can be bound and cleaved by another site-specific nuclease, such as a broad-spectrum nuclease, zinc finger nuclease (ZFN), or transcription activator-like effector nuclease (TALEN), not guided by a non-coding RNA molecule, to introduce a double-strand break (or single-strand nick) into the polynucleotide sequence and / or its complementary DNA strand. As used herein, a “target region” or “target site” refers to a polynucleotide sequence or region flanked by two or more target sites. Without limitation, in some embodiments, the target region may be subjected to mutations, deletions, insertions, or inversions. As used herein, when used to describe a target region of a polynucleotide sequence or molecule, “flanked” means that two or more target sites of the polynucleotide sequence or molecule surround the target region, with one target site on each side of the target region. In addition to genome editing, the term “target site” can also be used in the context of gene repression to refer to a portion of an mRNA molecule (e.g., a “recognition site”) that is complementary to at least a portion of a non-coding RNA molecule (e.g., miRNA, siRNA, etc.) encoded by a repressor construct.

[0027] As used herein, a “donor molecule,” “donor template,” or “donor template molecule” (collectively, “donor template”) is defined as a nucleic acid molecule having a nucleic acid template or insert sequence for site-specific, targeted insertion or recombination into the plant cell genome by repairing nicks or double-strand DNA breaks in the plant cell genome. For example, a “donor template” can be used for site-specific integration of transgenic or repressor constructs, or as a template for introducing mutations such as insertions or deletions into the plant genome. The targeted genome editing techniques described herein may include the use of one or more, two or more, three or more, four or more, or five or more donor molecules or templates. A “donor template” can be a single-stranded or double-stranded DNA or RNA molecule or plasmid. An “insert sequence” of the donor template is a sequence designed for targeted insertion into the plant cell genome and can have any suitable length. For example, the length of the donor template insertion sequence can be between 2 and 50,000, between 2 and 10,000, between 2 and 5,000, between 2 and 1,000, between 2 and 500, between 2 and 250, between 2 and 100, between 2 and 50, between 2 and 30, between 15 and 50, between 15 and 100, between 15 and 500, between 15 and 1,000, between 15 and 5,000, between 18 and 30, between 18 and 26, between 20 and 26, between 20 and 50, between 20 and 100, between 20 and 250, 20... Nucleotides or base pairs between 1 and 500, 20 and 1000, 20 and 5000, 20 and 10,000, 50 and 250, 50 and 500, 50 and 1000, 50 and 5000, 50 and 10,000, 100 and 250, 100 and 500, 100 and 1000, 100 and 5000, 100 and 10,000, 250 and 500, 250 and 1000, 250 and 5000, or 250 and 10,000. The donor template may also have at least one homologous sequence or homologous arm, such as two homologous arms, to guide the integration of the mutant or insertion sequence into a target site within the plant genome via homologous recombination. The homologous sequence or homologous arm is identical or complementary to, or has a certain percentage of identity or complementarity with, the sequence at or near the target site within the plant genome. When the donor template contains both a homologous arm and an insertion sequence, the homologous arm will flank or surround the insertion sequence on the donor template.

[0028] The insert sequence of the donor template may contain one or more genes or sequences, each encoding a transcribed non-coding RNA or mRNA sequence and / or a translated protein sequence. The transcribed sequence or gene of the donor template may encode a protein or non-coding RNA molecule. The insert sequence of the donor template may contain a polynucleotide sequence that does not contain a functional gene or a complete gene sequence (e.g., the donor template may contain only regulatory sequences, such as promoter sequences, or only a portion of a gene or coding sequence), or may not contain any identifiable gene expression elements or any actively transcribed gene sequence. Furthermore, the donor template may be linear or circular, and may be single-stranded or double-stranded. The donor template may be delivered to cells as naked nucleic acid (e.g., via particle bombardment), as a complex with one or more delivery agents (e.g., liposomes, proteins, poloxamer, protein-encapsulated T-strands, etc.), or contained in bacterial or viral delivery media (e.g., respectively). Agrobacterium tumefaciens (or in twin viruses). The insertion sequence of the donor template provided herein may contain a transcribed DNA sequence that can be transcribed into an RNA molecule, which may be non-coding and may or may not be operatively linked to a promoter and / or other regulatory sequences.

[0029] According to some embodiments, the donor template may not contain an insert sequence, but instead contains one or more homologous sequences that contain one or more mutations, such as insertions, deletions, substitutions, etc., relative to the genomic sequence at the target site within the plant genome, such as at or near the GA3 oxidase or GA20 oxidase gene within the plant genome. Alternatively, the donor template may contain an insert sequence that does not contain a coding or transcribed DNA sequence, wherein the insert sequence is used to introduce one or more mutations into the target site within the plant genome, such as at or near the GA3 oxidase or GA20 oxidase gene within the plant genome.

[0030] The donor template provided herein may contain at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes or transcribed DNA sequences. Alternatively, the donor template may not contain genes. Without limitation, the genes or transcribed DNA sequences of the donor template may include, for example, insecticide resistance genes, herbicide tolerance genes, nitrogen use efficiency genes, water use efficiency genes, nutrient quality genes, DNA binding genes, selectable marker genes, RNAi or repressor constructs, site-specific genome-modifying enzyme genes, single guide RNA of a CRISPR / Cas9 system, geminivirus-based expression cassettes, or plant virus expression vector systems. According to other embodiments, the inserted sequence of the donor template may contain a transcribed DNA sequence encoding a non-coding RNA molecule that can target and repress GA oxidase genes such as GA3 oxidase or GA20 oxidase genes. The donor template may contain promoters, such as tissue-specific or tissue-preferred promoters, constitutive promoters, or inducible promoters. The donor template may include a leader sequence, enhancer, promoter, transcription start site, 5'-UTR, one or more exons, one or more introns, transcription termination site, region or sequence, 3'-UTR, and / or polyadenylation signal. The leader sequence, enhancer, and / or promoter may be operatively linked to a gene or transcribed DNA sequence encoding non-coding RNA, guide RNA, mRNA, and / or protein.

[0031] As used herein, a "vascular promoter" refers to a plant-expressible promoter that drives, induces, or initiates the expression of a transcribed DNA sequence or transgene operablely linked to such a promoter in one or more vascular tissues of the plant, even if the promoter is also expressed in other non-vascular plant cells or tissues. Such vascular tissues may include one or more of the plant's phloem, vascular parenchyma, and / or bundle sheath cells or tissues. Vascular promoters differ from constitutive promoters in that they have a regulated and relatively more limited expression pattern, encompassing one or more vascular tissues of the plant. Vascular promoters include vascular-specific promoters and vascular-biased promoters.

[0032] As used herein, a "leaf promoter" refers to a plant-expressible promoter that drives, induces, or initiates the expression of a transcribed DNA sequence or transgene operablely linked to such a promoter in one or more leaf tissues of a plant, even if the promoter is also expressed in other non-leaf plant cells or tissues. Leaf promoters include leaf-specific promoters and leaf-preferred promoters. The difference between a "leaf promoter" and a vascular promoter is that a leaf promoter is expressed primarily or exclusively in the leaf tissues of a plant relative to other plant tissues, while vascular promoters are expressed in vascular tissues, more generally including extra-leaf vascular tissues such as the stem or the vascular tissues of both stem and leaf.

[0033] As used herein, the term "homozygous" refers to a genotype containing two identical alleles at a given locus in a diploid genome, or a genotype containing two distinct mutant alleles at a given locus in a diploid genome. The latter genotype, containing two distinct mutant alleles, is also referred to as heteroallelic or cross-heterozygous, or heteroallelic combination. As used herein, "heterozygous" describes a genotype containing both a mutant allele and a wild-type allele at a given locus in a diploid genome.

[0034] As used herein, the “upstream region” of a plant gene (such as the GA20 oxidase or GA3 oxidase gene) refers to the promoter region and intergenic regions of the plant genome, including the genomic sequence of such regions, which are immediately upstream (in the 5' direction) of the gene’s transcription start site (i.e., immediately upstream of the transcribed DNA region or sequence and the 5' untranslated region of the gene). For clarity, the “upstream region” of a gene includes the gene’s “promoter region”.

[0035] As used herein, the “downstream region” of a plant gene (such as the GA20 oxidase or GA3 oxidase gene) refers to an intergenic region of the plant genome, including genomic sequences of such regions that are immediately downstream (in the 3' direction) of the transcription termination site of the gene (i.e., immediately downstream of the transcribed DNA region or sequence of the gene).

[0036] As used herein, an “intergenic region” of a plant gene refers to a region of the plant genome, including the genomic sequence of such a region that is immediately upstream (in the 5' direction) of the promoter region of a gene or immediately downstream (in the 3' direction) of the transcription termination site of a gene (i.e., immediately downstream of the transcribed DNA region or sequence of a gene), and extends into adjacent genes in the plant genome that are located upstream or downstream of the plant gene, but do not include any promoter or transcribed DNA region of the adjacent gene.

[0037] As used herein, the “promoter region” of a plant gene (such as the GA20 oxidase or GA3 oxidase gene) refers to a region of the plant genome that includes the genomic sequence of such a region being immediately upstream (in the 5' direction) of the transcription start site of the gene (i.e., immediately upstream of the transcribed DNA region or sequence of the gene and the 5' untranslated region), and includes or may include one or more promoters, enhancers or other regulatory expression elements of the gene.

[0038] As used herein, a “transcribed DNA region” of a plant gene (such as the GA20 oxidase or GA3 oxidase gene) refers to a region in the plant genome, including the genomic sequence of such a region that encodes pre-mRNA expressed by and transcribed from such a gene, which may include a 5' untranslated region (5' UTR), a 3' untranslated region (3' UTR), one or more exon sequences and / or one or more intron sequences.

[0039] describe Most grain-producing grasses, such as wheat, rice, and sorghum, produce male and female structures within each floret of the spike (i.e., they have a single reproductive structure). However, maize, or corn, is unique among grain-producing grasses in that it forms separate male inflorescences (tassels) and female inflorescences (ears). Maize produces fully dimorphic reproductive structures by selectively halting the development of male organs (anthers) in the spike florets and female organs (ovules) in the tassel florets during the early developmental stage. Precisely regulated gibberellin synthesis and signal transduction are crucial for regulating this selective cessation of development, with the female reproductive ear being most sensitive to disruption of the GA pathway. In fact, the "anther-ear" phenotype is the most common reproductive phenotype in GA maize mutants.

[0040] In contrast to maize, mutations in the gibberellin synthesis or signaling pathways that triggered the “Green Revolution” in wheat, rice, and sorghum have little effect on their reproductive structures because these crop species do not undergo selective cessation of grain development carrying panicles during development and are therefore insensitive to disruptions in GA levels. The same mutations have not been used in maize because, apart from extreme dwarfing in some cases, disruptions in GA synthesis and signaling pathways have repeatedly led to marked malformation and masculinization of the spike (“anther spike”) and male sterility (disrupted anther and microspore development). See, for example, Chen, Y. et al., “The Maize…” DWARF1 Encodes a Gibberellin 3-Oxidase and IsDual Localized to the Nucleus and Cytosol," Plant Physiology 166: 2028-2039 (2014). These GA mutant phenotypes (hypotypes) in maize result in significantly reduced grain production and yield. Furthermore, the production of anthers within the ear increases the likelihood of fungal or insect infection, which reduces the quality of grains produced on those mutant ears. Forward breeding for the development of semi-dwarf maize lines has not been successful, and the reproductive heteromorphism (and extreme dwarfism) of GA mutants has been difficult to overcome. Therefore, the same mutations in the GA pathway that triggered the Green Revolution in other grasses have not been successful in maize.

[0041] Despite these prior difficulties in achieving higher grain yields in maize through manipulation of the GA pathway, the inventors have discovered a method for manipulating GA levels in maize plants in a manner that reduces overall plant height and internode length and increases lodging resistance, without inducing reproductive heterosis previously associated with mutations in the GA pathway in maize. Further evidence suggests that these dwarf or semi-dwarf maize plants may also possess one or more additional traits, including increased stem diameter, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower ear height, increased leaf water content, improved drought tolerance, increased nitrogen use efficiency, increased water use efficiency, reduced anthocyanin content and area in leaves under normal or nitrogen- or water-limited stress conditions, increased ear weight, increased number of grains, increased grain weight, increased yield, and / or increased harvest index.

[0042] Repressing and / or reducing or decreasing the expression and / or activity of GA20 or GA3 oxidase genes can effectively achieve a dwarf, semi-dwarf phenotype with increased lodging resistance but no reproductive heterosis in the ear. Without being limited by theory, it is further proposed that restricting the repression of GA20 and / or GA3 oxidase genes to certain active GA-producing tissues, such as the vascular and / or leaf tissues of plants, may be sufficient to produce dwarf plants with increased lodging resistance but no significant heterosis in reproductive tissues. Expression of GA20 or GA3 oxidase repressor elements in a tissue-specific or tissue-preferred manner may be sufficient and effective to produce plants with a dwarf phenotype while avoiding potential heterosis in reproductive tissues previously observed with GA mutants in maize (e.g., by avoiding or restricting the repression of GA20 oxidase genes in those reproductive tissues). For example, GA20 and / or GA3 oxidase genes can be repressed using vascular promoters that drive expression in plant vascular tissues (such as the rice tungro baculovirus (RTBV) promoter). As supported by the following examples, the expression pattern of the RTBV promoter is enriched in the vascular tissues of maize plants relative to non-vascular tissues, and when operatively linked to repressor elements targeting the GA20 and GA3 oxidase genes, it is sufficient to produce a semi-dwarf phenotype in maize plants. Reducing the level of active GA in tissues of maize or cereal plants that produce active GA can reduce plant height and increase lodging resistance, and can prevent allergies in those plants without simultaneously significantly affecting or reducing the level of active GA in reproductive tissues (such as developing female organs or ears of plants). If the level of active GA in the stalks, stems, or internodes of maize or cereal plants can be reduced without significantly affecting the level of GA in reproductive tissues (e.g., female or male reproductive organs or inflorescences), maize or cereal plants with reduced plant height and increased lodging resistance can be produced without allergies in the reproductive tissues of the plant.

[0043] Therefore, this document provides recombinant DNA constructs and transgenic plants comprising a GA20 or GA3 oxidase repressor element or sequence operatively linked to a plant expressible promoter, which may be a tissue-specific or tissue-preferred promoter. Such tissue-specific or tissue-preferred promoters can drive the expression of their associated GA oxidase repressor element or sequence in one or more active GA-producing tissues of the plant to repress or reduce the level of active GA produced in those tissues. Such tissue-specific or tissue-preferred promoters can drive the expression of their associated GA oxidase repressor construct or transgene during one or more vegetative stages of development. Such tissue-specific or tissue-preferred promoters may also have little or no expression in one or more cells or tissues of developing female organs or ears of plants to avoid the possibility of allergies in those reproductive tissues. According to some embodiments, the tissue-specific or tissue-preferred promoter is a vascular promoter, such as the RTBV promoter. The sequence of the RTBV promoter is provided herein as SEQ ID NO: 65, and a truncated form of the RTBV promoter is further provided herein as SEQ ID NO: 66.

[0044] For a given plant species, active or biologically active gibberellins (i.e., "active gibberellins" or "active GA") are known in the art, as distinguished from inactive GA. For example, active GAs in maize and higher plants include the following: GA1, GA3, GA4, and GA7. Therefore, "active GA-producing tissue" is a plant tissue that produces one or more active GAs.

[0045] Besides repressing the GA20 oxidase gene in the active GA-producing tissues of plants using vascular tissue promoters, repressing the same GA20 oxidase gene with various constitutive promoters also induces a dwarf, semi-dwarf phenotype in maize, but without any visible isomorphism in the ear. Given that mutations in the GA pathway have previously been shown to induce isomorphism in reproductive tissues, it is surprising that constitutive repression of GA20 oxidase does not induce a similar reproductive phenotype in the ear. Therefore, constitutive promoters can be used to repress one or more GA20 oxidase genes to produce dwarf, lodging-resistant maize or cereal plants without any significant or observable reproductive isomorphism in the plant. Other surprising observations were made when the same GA20 oxidase repressor construct was expressed in the stem, leaves, or reproductive tissues. As further described below, targeting and repressing the same GA20 oxidase gene in the stem or ear tissues of maize plants does not induce a dwarf, semi-dwarf phenotype. Furthermore, direct expression of the GA20 oxidase repressor construct in the reproductive tissue of maize ears using a female reproductive tissue (ear) promoter did not induce any significant or observable heteromorphism in the ears. However, expression of the same GA20 oxidase repressor construct in leaf tissue was sufficient to induce a moderate dwarf phenotype without significant or observable reproductive heteromorphism in the plant.

[0046] Unbound by theory, the dwarf semi-dwarf phenotype in maize and other cereals may result from adequate expression levels of repressor constructs targeting certain GA oxidase genes in the active GA-producing tissues of the plant. At least for the targeted repression of certain GA20 oxidase genes in maize, restricted expression patterns to avoid reproductive ear tissues may not be necessary to avoid reproductive heteromorphism in developing ears. However, low levels and / or expression of GA20 or GA3 oxidase repressor constructs in a limited number of plant tissues may not be sufficient to induce a significant dwarf semi-dwarf phenotype. Given that the observed semi-dwarf phenotype with targeted GA20 oxidase repression results from shortened internodes, it is surprising that repression of GA20 oxidase genes in at least some stem tissues is insufficient to cause internode shortening and reduced plant height. Unbound by theory, repression of certain GA oxidase genes in active GA-producing tissues and / or cells of the plant, and not necessarily in stem or internode tissues, may be sufficient to produce semi-dwarf plants, even if the dwarf trait is caused by internode shortening. Given that GA can migrate via the vascular system of plants, manipulating GA oxidase genes in plant tissues that produce active GA can lead to dwarf, semi-dwarf plants, even if this can be largely achieved by repressing the level of active GA produced in non-stem tissues (i.e., sites of action far from the stem, where reduced internode elongation leads to a semi-dwarf phenotype). Indeed, repressing certain GA20 oxidase genes in leaf tissues has been found to induce a moderate semi-dwarf phenotype in maize plants. Given that expressing GA20 oxidase repressor constructs using several different “stem” promoters does not produce a semi-dwarf phenotype in maize, it is noteworthy that expressing the same GA20 oxidase repressor construct using the RTBV vascular promoter is effective in consistently producing a semi-dwarf phenotype, exhibiting high penetrance across events and germplasm. This semi-dwarf phenotype has also been observed when expressing the same GA20 oxidase repressor construct using other vascular promoters.

[0047] According to embodiments of this disclosure, modified cereal or maize plants are provided that possess at least one beneficial agronomic trait and at least one substantially or completely free of heteromorphic female reproductive organs or ears. Beneficial agronomic traits may include, for example, shorter plant height, shorter internode length in one or more internodes, larger (thicker) stem or culm diameter, increased lodging resistance, improved drought tolerance, increased nitrogen use efficiency, increased water use efficiency, deeper roots, larger leaf area, earlier canopy closure, and / or increased harvestable yield. Heteromorphism may include male (tassel or anther) sterility, reduced grain or seed number, and / or the presence of one or more masculinized or male (or virgin) reproductive structures in the plant's female organs or ears (e.g., anther ears). This document provides a modified cereal or maize plant that does not exhibit significant heteromorphism in its reproductive tissues. Such modified cereal or maize plants may possess female reproductive organs or ears that are normal relative to control or wild-type plants. In practice, a modified cereal or maize plant is provided, comprising at least one reproductive organ or ear that is free from or does not exhibit, or is substantially or completely devoid of heteromorphisms, including male sterility, reduced grain or seed number, and / or masculinized structures in one or more female organs or ears. As used herein, if a visual examination of a female organ or ear in a plant at a later stage of the reproductive stage reveals the absence or near absence of male reproductive structures, then the female organ or ear of a plant (such as maize) is “substantially devoid” of male reproductive structures. If a visual examination of a female organ or ear in a plant (such as maize) at a later stage of the reproductive stage reveals the absence, non-observation, or inability to observe male reproductive structures, then the female organ or ear of a plant (such as maize) is “completely devoid” of mature male reproductive structures. The number of kernels or seeds in each female organ or ear of a plant (such as maize) that has no significant heteromorphism and substantially lacks male reproductive structures in its ear may be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% of the number of kernels or seeds in each female organ or ear of a wild-type or control plant. Similarly, the average kernel or seed weight in each female organ or ear of a plant (such as maize) that has no significant heteromorphism and substantially lacks male reproductive structures in its ear may be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% of the average kernel or seed weight in each female organ or ear of a wild-type or control plant.The female organs or ears of plants completely lacking mature male reproductive structures (such as maize) may have approximately the same number of kernels or seeds per female organ or ear as the wild type or control. In other words, the reproductive development of the plant's female organs or ears may be normal or substantially normal. However, the number of seeds or kernels per female organ or ear can depend on other factors affecting the plant's resource utilization and development. In practice, the number of kernels or seeds per female organ or ear, and / or the weight of kernels or seeds per female organ or ear, may be approximately the same as or greater than that of wild-type or control plants.

[0048] Gibberellins, plant hormones, play important roles in the development of many plants, including germination, cell elongation, flowering, embryogenesis, and seed development. Certain biosynthetic enzymes (e.g., GA20 oxidase and GA3 oxidase) and catabolic enzymes (e.g., GA2 oxidase) in the GA pathway are key to influencing the level of active GA in plant tissues. Therefore, in addition to repressing certain GA20 oxidase genes, it has been proposed that repressing GA3 oxidase genes constitutively, tissue-specifically, or tissue-preferredly can also produce maize plants with a dwarf phenotype and increased lodging resistance, potentially increasing yield, but without heteromorphism in the ear. Therefore, according to some embodiments, constructs and transgenes containing a GA3 oxidase repressor element or sequence are provided, which is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter, such as a vascular or leaf promoter. According to some embodiments, the tissue-specific or tissue-preferred promoter is a vascular promoter, such as the RTBV promoter. However, other types of tissue-specific or tissue-preferred promoters could potentially be used to inhibit GA3 oxidase in active GA-producing tissues of maize or cereals to produce a semi-dwarf phenotype without significant heteromorphism.

[0049] According to embodiments of the present invention, any method known in the art for repressing target genes can be used to repress the GA oxidase gene, including the expression of antisense RNA, double-stranded RNA (dsRNA), or inverted repeat RNA sequences, or co-repression or RNA interference (RNAi) achieved by expressing small interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (ta-siRNA), or microRNA (miRNA). Furthermore, sense and / or antisense RNA molecules targeting coding and / or non-coding genomic sequences or regions within or near the GA oxidase gene can be used to induce gene silencing. Therefore, any of these methods can be used to target and repress endogenous GA20 oxidase or GA3 oxidase genes in a tissue-specific or tissue-preferred manner. See, for example, U.S. Patent Application Publications 2009 / 0070898, 2011 / 0296555, and 2011 / 0035839, the contents and disclosures of which are incorporated herein by reference.

[0050] As used herein, the term "repression" refers to a reduction, decrease, or elimination of the expression level of such target mRNAs and / or proteins encoded by a target gene in a plant, plant cell, or plant tissue at one or more plant developmental stages, compared to the expression level of such target mRNAs and / or proteins in a wild-type or control plant, cell, or tissue at one or more plant developmental stages. According to some embodiments, a modified or transgenic plant is provided having a GA20 oxidase gene expression level that is reduced by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in at least one plant tissue compared to a control plant. According to some embodiments, a modified or transgenic plant is provided having a GA3 oxidase gene expression level that is reduced by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in at least one plant tissue compared to a control plant. According to some implementation schemes, a modified or transgenic plant is provided having a GA20 oxidase gene expression level that is reduced by 5%-20%, 5%-25%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-75%, 5%-80%, 5%-90%, 5%-100%, 75%-100%, 50%-100%, 50%-90%, 50%-75%, 25%-75%, 30%-80%, or 10%-75% in at least one plant tissue compared to a control plant. According to some embodiments, a modified or transgenic plant is provided having a GA3 oxidase gene expression level that is reduced by 5%-20%, 5%-25%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-75%, 5%-80%, 5%-90%, 5%-100%, 75%-100%, 50%-100%, 50%-90%, 50%-75%, 25%-75%, 30%-80%, or 10%-75% compared to a control plant in at least one plant tissue. According to these embodiments, at least one tissue of the modified or transgenic plant having reduced GA20 oxidase and / or GA3 oxidase gene expression levels includes one or more active GA-producing tissues of the plant during one or more vegetative stages of development, such as vascular and / or leaf tissues of the plant.

[0051] In some embodiments, the repression of the endogenous GA20 oxidase gene or GA3 oxidase gene is tissue-specific (e.g., only in leaves and / or vascular tissues). The repression of the GA20 oxidase gene or GA3 oxidase gene can be constitutive and / or vascular or leaf tissue-specific or preferred. In other embodiments, the repression of the GA20 oxidase gene or GA3 oxidase gene is constitutive and non-tissue-specific. According to some embodiments, compared to the same tissue of a control plant, the expression of the endogenous GA20 oxidase gene and / or GA3 oxidase gene is reduced in one or more tissue types of modified or transgenic plants (e.g., in leaves and / or vascular tissues), such as one or more active GA-producing tissues.

[0052] According to embodiments of this disclosure, a recombinant DNA molecule, construct, or vector is provided comprising a repressive element targeting a GA20 oxidase or GA3 oxidase gene operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter expressible in a plant. The repressive element may comprise a transcribed DNA sequence of at least 19 nucleotides in length, such as from about 19 nucleotides to about 27 nucleotides in length, or 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length, wherein the transcribed DNA sequence corresponds to at least a portion of the target GA oxidase gene to be repressed, and / or a complementary DNA sequence thereof. The length of the repressor element can be 19-30, 19-50, 19-100, 19-200, 19-300, 19-500, 19-1000, 19-1500, 19-2000, 19-3000, 19-4000, or 19-5000 nucleotides. The length of the repressor element can be at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides or more (e.g., at least 25, at least 30, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, at least 1500, at least 2000, at least 3000, at least 4000, or at least 5000 nucleotides). Depending on the length and sequence of the repressor element, if the non-coding RNA molecule encoded by the repressor element can still fully hybridize and bind to the target mRNA molecule of the GA20 oxidase or GA3 oxidase gene, one or more sequence mismatches or non-complementary bases, such as 1, 2, 3, 4, 5, 6, 7, 8 or more mismatches, can be allowed without loss of repression. In fact, RNAi repressor elements of length ranging from about 19 nucleotides to about 27 nucleotides, or even shorter, can have one or more mismatches or non-complementary bases but still effectively repress the target GA oxidase gene. Therefore, the sense or antisense repressor element sequence can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical or complementary to the corresponding sequence or its complement of at least one segment or portion of the target GA oxidase gene.

[0053] The repressor element or transcribed DNA sequence of this disclosure for targeted repression of the GA oxidase gene may include one or more of the following: (a) a DNA sequence comprising at least one antisense DNA sequence, the at least one antisense DNA sequence being antisense or complementary to at least one segment or portion of the GA oxidase gene; (b) a DNA sequence comprising multiple copies of at least one antisense DNA sequence, the at least one antisense DNA sequence being antisense or complementary to at least one segment or portion of the GA oxidase gene; (c) a DNA sequence comprising at least one sense DNA sequence, the at least one sense DNA sequence containing at least one segment or portion of the GA oxidase gene. (d) A DNA sequence comprising multiple copies of at least one sense DNA sequence, each copy containing at least one segment or portion of a GA oxidase gene; (e) A DNA sequence comprising an inverted repeat sequence containing a segment or portion of a GA oxidase gene and / or transcribed into RNA for repressing RNA targeting a GA oxidase gene by forming double-stranded RNA, wherein the transcribed RNA comprises at least one antisense DNA sequence antisense or complementary to at least one segment or portion of a GA oxidase gene and at least one sense DNA sequence containing at least one segment or portion of a GA oxidase gene; (f) Transcribed into RNA for repressing RNA targeting a GA oxidase gene by forming double-stranded RNA. A DNA sequence comprising a single double-stranded RNA for repressing RNA targeting the GA oxidase gene and comprising a plurality of consecutive antisense DNA sequences and a plurality of consecutive sense DNA sequences, each of the plurality of consecutive antisense DNA sequences being antisense or complementary to at least one segment or portion of the GA oxidase gene, and each of the plurality of consecutive sense DNA sequences comprising at least one segment or portion of the GA oxidase gene; (g) transcribed into a DNA sequence comprising a plurality of antisense DNA sequences and a plurality of sense DNA sequences for repressing RNA targeting the GA oxidase gene by forming a plurality of double-stranded RNA, each of the plurality of antisense DNA sequences being antisense or complementary to at least one segment or portion of the GA oxidase gene. The plurality of sense DNA sequences each contain at least one segment or portion of a gene targeting GA oxidase, wherein the plurality of antisense DNA segments and the plurality of sense DNA segments are arranged in a series of inverted repeat sequences; (h) a DNA sequence comprising nucleotides derived from miRNA, preferably plant miRNA; (i) a DNA sequence comprising a miRNA precursor encoding an artificial miRNA complementary to at least one segment or portion of a gene targeting GA oxidase; (j) a DNA sequence comprising nucleotides of siRNA; and (k) a DNA sequence transcribed into an RNA aptamer capable of binding a ligand.And (l) the DNA sequence transcribed into an RNA aptamer capable of binding ligands and the DNA transcribed into regulatory RNA capable of regulating the expression of genes targeting GA oxidase, wherein the regulation of genes targeting GA oxidase depends on the conformation of the regulatory RNA, and the conformation of the regulatory RNA is influenced by the allosteric binding state of the RNA aptamer to the ligands. Any of these gene repressive elements, whether transcribed into single-stranded or double-stranded RNA, can be designed to repress more than one GA oxidase target gene, depending on the number and sequence of the repressive elements.

[0054] Multiple sense and / or antisense repressor elements targeting more than one GA oxidase can be arranged in tandem, either continuously or in tandem segments or repeat sequences, such as tandem inverted repeats, which may also be interrupted by one or more spacer sequences, and each repressor element can target one or more GA oxidase genes. Furthermore, the sense or antisense sequence of the repressor element may not perfectly match or be complementary to the target GA oxidase gene sequence, depending on the sequence and length of the repressor element. RNAi repressor elements of about 19 to about 27 nucleotides in length, or even shorter, can have one or more mismatched or non-complementary bases and still effectively repress the target GA oxidase gene. Therefore, the sense or antisense repressor element sequence may be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the corresponding sequence or its complement of at least one segment or portion of the target GA oxidase gene, respectively.

[0055] For antisense repression, the transcribed DNA sequence or repressor element contains a sequence that is antisense or complementary to at least a portion or segment of the gene targeting GA oxidase. The repressor element may contain multiple antisense sequences complementary to one or more portions or segments of the gene targeting GA oxidase, or multiple copies of an antisense sequence complementary to the gene targeting GA oxidase. The antisense repressor element sequence may be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to a DNA sequence complementary to at least a segment or portion of the gene targeting GA oxidase. In other words, the antisense repressor element sequence may be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to the gene targeting GA oxidase or mRNA.

[0056] To repress the GA oxidase gene using inverted repeat sequences or transcribed dsRNA, the transcribed DNA sequence or repressive element may include a sense sequence containing a segment or portion of the GA oxidase gene and an antisense sequence complementary to the segment or portion of the GA oxidase gene, wherein the sense and antisense DNA sequences are arranged in tandem. As described above, each of the sense and / or antisense sequences may be less than 100% identical or complementary to the segment or portion of the GA oxidase gene. The sense and antisense sequences may be separated by spacer sequences, such that the RNA molecule transcribed from the repressive element forms a stem, loop, or stem-loop structure between the sense and antisense sequences. The repressive element may also contain multiple sense and antisense sequences arranged in tandem, which may also be separated by one or more spacer sequences. Such repressive elements containing multiple sense and antisense sequences may be arranged as a series of sense sequences followed by a series of antisense sequences, or as a series of sense and antisense sequences arranged in tandem. Alternatively, one or more sense DNA sequences may be expressed separately from one or more antisense sequences (i.e., one or more sense DNA sequences may be expressed from a first transcribed DNA sequence, and one or more antisense DNA sequences may be expressed from a second transcribed DNA sequence, wherein the first transcribed DNA sequence and the second transcribed DNA sequence are expressed as separate transcripts).

[0057] For the use of microRNA (miRNA) to repress the GA oxidase gene, the transcribed DNA sequence or repressive element may comprise a DNA sequence of a miRNA sequence naturally derived from a virus or eukaryote (e.g., animal or plant) or a miRNA sequence modified or derived from such a natural miRNA sequence. Such natural or naturally derived miRNA sequences may form a foldback structure and serve as a scaffold for a precursor miRNA (pre-miRNA), and may correspond to the stem region of a natural miRNA precursor sequence, such as from a natural (or naturally derived) primary-miRNA (pri-miRNA) or pre-miRNA sequence. However, in addition to these natural or naturally derived miRNA scaffolds or pre-processed sequences, the engineered or synthetic miRNA of this embodiment also comprises a sequence corresponding to a segment or portion of the GA oxidase gene. Therefore, in addition to the pre-processed or scaffold miRNA sequence, the repressive element may also comprise sense and / or antisense sequences corresponding to a segment or portion of the GA oxidase gene, and / or sequences complementary to them, although one or more sequence mismatches may be tolerated.

[0058] Engineered miRNAs can be used to target repressor genes with enhanced specificity. See, for example, Parizotto et al. Genes Dev.18:2237-2242 (2004), and U.S. Patent Application Publications Nos. 2004 / 0053411, 2004 / 0268441, 2005 / 0144669, and 2005 / 0037988, the contents and disclosures of which are incorporated herein by reference. miRNA is a non-protein-coding RNA. When a miRNA precursor molecule is cleaved, a mature miRNA is formed, typically about 19 to about 25 nucleotides in length (typically about 20 to about 24 nucleotides in plants), for example, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, and has a sequence corresponding to the gene and / or its complement intended to be repressed. The mature miRNA hybridizes with the target mRNA transcript and guides the protein complex to bind to the target transcript, which may inhibit translation and / or lead to transcript degradation, thereby negatively regulating or repressing the expression of the target gene. miRNA precursors in plants can also guide the isotropic production of siRNA and trans-acting siRNA (ta-siRNA), a process that requires RNA-dependent RNA polymerase to induce repression of the target gene. See, for example, Allen Cell 121:207-221(2005), Vaucheret Science STKE , 2005:pe43 (2005), and Yoshikawa et al. Genes Dev .,19:2164-2175 (2005), the contents and public information of which are incorporated herein by reference.

[0059] Plant miRNAs regulate their target genes by recognizing and binding to complementary or near-complementary sequences (miRNA recognition sites) in the transcripts of target mRNAs, which are then cleaved by RNase III enzymes (such as ARGONAUTE1). In plants, certain mismatches between a given miRNA recognition site and its corresponding mature miRNA are generally unacceptable, particularly mismatched nucleotides at positions 10 and 11 within the mature miRNA. Positions within the mature miRNA are shown in 5' to 3' orientation. Perfect complementarity between the given miRNA recognition site and its corresponding mature miRNA is typically required at positions 10 and 11 of the mature miRNA. See, for example, Franco-Zorrilla et al. (2007) Nature Genetics, 39:1033-1037; and Axtell et al. (2006) Cell, 127:565-577.

[0060] Many microRNA genes (MIR genes) have been identified and are publicly available in databases (“miRBase”, available online at microrna.sanger.ac.uk / sequences; see also Griffiths-Jones et al. (2003) Nucleic Acids Res., 31:439-441). MIR genes have been reported to exist in intergenic regions, both isolated and clustered in the genome, but can also be located entirely or partially within introns of other genes (both protein-coding and non-protein-coding). For a review of miRNA biogenesis, see Kim (2005) Nature Rev. Mol.Cell. Biol., 6:376-385. Transcription of MIR genes can be regulated, at least in some cases, by the promoters of the MIR genes themselves. Primary transcripts, known as "pri-miRNAs," can be quite large (several kilobases) and can be polycistronic, containing one or more pre-miRNAs (containing stem-loop foldback structures that are processed into mature miRNAs) as well as the 5' "cap" and polyadenylated tail common to mRNAs. See, for example, Kim (2005) Nature Rev. Mol. Cell. Biol., 6:376-385. Figure 1 .

[0061] Transgenic expression of miRNAs (whether naturally occurring or artificial sequences) can be used to regulate the expression of one or more target genes of the miRNA. The recognition sites of miRNAs have been validated in all regions of the mRNA, including the 5' untranslated region, coding region, intronic region, and 3' untranslated region, indicating that the position of the miRNA target or recognition site relative to the coding sequence does not necessarily affect repression (see, for example, Jones-Rhoades and Bartel (2004). Mol. Cell, 14:787-799; Rhoades et al. (2002) Cell, 110:513-520; Allen et al. (2004) Nat. Genet., 36:1282-1290; Sunkar and Zhu (2004) Plant Cell, 16:2001-2019). miRNAs are important regulatory elements in eukaryotes, and transgenic repression using miRNAs is an effective tool for manipulating biological pathways and responses. Descriptions of natural miRNAs, their precursors, recognition sites, and promoters are provided in U.S. Patent Application Publication No. 2006 / 0200878, the contents of which and their disclosures are incorporated herein by reference.

[0062] Artificial miRNA sequences can be designed by replacing nucleotides in the stem region of the miRNA precursor with sequences complementary to the intended target, as demonstrated by Zeng et al. (2002) Mol. Cell, 9:1327-1333. According to many implementations, the target can be a sequence of the GA20 oxidase gene or the GA3 oxidase gene. A non-limiting example of a general method for determining nucleotide variations in a natural miRNA sequence to produce an engineered miRNA precursor for a target of interest includes the following steps: (a) selecting a unique target sequence of at least 18 nucleotides that is specific to the target gene, for example, by using sequence alignment tools such as BLAST (see, for example, Altschul et al. (1990) J. Mol. Biol., 215:403-410; Altschul et al. (1997) Nucleic Acids Res., 25:3389-3402); cDNA and / or genomic DNA sequences can be used to identify orthologs of the target transcript and any potential matches with unrelated genes, thereby avoiding unintentional silencing or repression of non-target sequences; (b) targeting the target gene for which sequence analysis is not required (e.g., matching with sequences from non-target species), and targeting GC content, Reynolds score (see Reynolds et al. (2004) Nature Biotechnol., Each potential target sequence is scored using functional asymmetry characterized by a negative difference in free energy (“ΔΔG”) (see Khvorova et al. (2003) Cell, 115:209-216). Preferably, target sequences (e.g., 19-mer) with all or most of the following characteristics may be selected: (1) Reynolds score > 4, (2) GC content between about 40% and about 60%, (3) negative ΔΔG, (4) terminal adenosine, (5) lack of consecutive extensions of 4 or more identical nucleotides; (6) location close to the 3' end of the target gene; (7) minimal difference from miRNA precursor transcripts. In one aspect, the non-coding RNA molecules used herein to repress target genes (e.g., GA20 or GA3 oxidase genes) are designed to have target sequences exhibiting one or more, two or more, three or more, four or more, or five or more of the aforementioned characteristics.The position of every third nucleotide of the repressor element can be important in influencing RNAi efficacy; for example, the algorithm “siExplorer” is publicly available at rna.chem.tu-tokyo.ac.jp / siexplorer.htm (see Katoh and Suzuki (2007) Nucleic Acids Res., 10.1093 / nar / gkl1120); (c) determining the inverse complementary sequence of the selected target sequence (e.g., 19-mer) for the preparation of modified mature miRNA. The additional nucleotide at position 20 can be matched with the selected target or recognition sequence relative to the 19-mer sequence, and the nucleotide at position 21 can be selected to be unpaired to prevent the spread of silencing on the target transcript or to be paired with the target sequence to promote the spread of silencing on the target transcript; and (d) transforming the artificial miRNA into plants.

[0063] According to embodiments of this disclosure, a recombinant DNA molecule, construct, or vector is provided comprising a transcribed DNA sequence or repressive element encoding a miRNA or precursor miRNA molecule for targeted repression of a GA oxidase gene. Such transcribed DNA sequences and repressive elements may comprise sequences of at least 19 nucleotides in length corresponding to one or more GA oxidase genes and / or sequences complementary to one or more GA oxidase genes, but may permit one or more sequence mismatches or non-base-paired nucleotides.

[0064] One or more small interfering RNAs (siRNAs) can also be used to repress GA oxidase genes. The siRNA pathway involves the non-phase cleavage of a long double-stranded RNA intermediate (“RNA duplex”) into small interfering RNAs (siRNAs). siRNAs range in size or length from about 19 to about 25 nucleotides or base pairs, but common classes of siRNAs include those containing 21 or 24 base pairs. Therefore, a transcribed DNA sequence or repressive element can encode an RNA molecule of at least about 19 to about 25 nucleotides (or more) in length, such as at least 19, 20, 21, 22, 23, 24, or 25 nucleotides. For siRNA repression, a recombinant DNA molecule, construct, or vector is thus provided comprising a transcribed DNA sequence encoding an siRNA molecule for targeted repression of GA oxidase genes and a repressive element. Such transcribed DNA sequences and repressive elements can be at least 19 nucleotides in length and have sequences corresponding to one or more GA oxidase genes and / or sequences complementary to one or more GA oxidase genes.

[0065] The GA oxidase gene can also be repressed using one or more trans-acting small interfering RNAs (ta-siRNAs). In the ta-siRNA pathway, the miRNA is used to guide the isophase processing of the siRNA primary transcript in a process that requires RNA-dependent RNA polymerase to produce a double-stranded RNA precursor. A ta-siRNA is defined as a small RNA of about 21 nt that lacks secondary structure, lacks a miRNA target site that initiates double-stranded RNA production, requires DCL4 and RNA-dependent RNA polymerase (RDR6), and produces multiple precisely phased duplexes with a 2-nucleotide 3' overhang (see Allen et al. (2005) Cell, 121:207-221). The size or length of ta-siRNA ranges from about 20 to about 22 nucleotides or base pairs, but is most typically 21 base pairs. Therefore, the transcribed DNA sequence or repressor element of the present invention can encode an RNA molecule of at least about 20 to about 22 nucleotides in length (such as 20, 21, or 22 nucleotides). For ta-siRNA repression, a recombinant DNA molecule, construct, or vector is provided comprising a transcribed DNA sequence or repressive element encoding a ta-siRNA molecule for targeted repression of GA oxidase genes. Such transcribed DNA sequences and repressive elements may be at least 20 nucleotides in length and have sequences corresponding to one or more GA oxidase genes and / or sequences complementary to one or more GA oxidase genes. For methods of constructing suitable ta-siRNA scaffolds, see, for example, U.S. Patent No. 9,309,512, the entire contents of which are incorporated herein by reference.

[0066] According to embodiments of the present invention, a recombinant DNA molecule, vector, or construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA molecule that binds to or hybridizes with a target mRNA in plant cells, wherein the target mRNA molecule encodes a GA20 or GA3 oxidase gene, and wherein the transcribed DNA sequence is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter. In addition to targeting a mature mRNA sequence, the non-coding RNA molecule may alternatively target an intron sequence of a GA oxidase gene or mRNA transcript, or a GA oxidase mRNA sequence overlapping with both the coding and non-coding sequences. According to other embodiments, a recombinant DNA molecule, vector, or construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA (precursor) molecule, which is cleaved or processed into a mature non-coding RNA molecule that binds to or hybridizes with a target mRNA in plant cells, wherein the target mRNA molecule encodes a GA20 or GA3 oxidase protein, and wherein the transcribed DNA sequence is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter. For the purposes of this disclosure, a "non-coding RNA molecule" is an RNA molecule that does not encode a protein. Non-restricted examples of non-coding RNA molecules include microRNAs (miRNAs), miRNA precursors, small interfering RNAs (siRNAs), siRNA precursors, small RNAs (18-26 nt in length) and their encoding precursors, heterochromatin siRNAs (hc-siRNAs), Piwi-interacting RNAs (piRNAs), hairpin double-stranded RNAs (hairpin dsRNAs), trans-acting siRNAs (ta-siRNAs), naturally occurring antisense siRNAs (nat-siRNAs), CRISPR RNAs (crRNAs), tracer RNAs (tracrRNAs), guide RNAs (gRNAs), and single guide RNAs (sgRNAs).

[0067] According to embodiments of this disclosure, suitable tissue-specific or tissue-preferred promoters for expressing GA20 oxidase or GA3 oxidase repressor elements may include those promoters that drive or induce their associated repressor elements or sequences at least in the vascular and / or leaf tissues of maize or cereal plants, or, in the case of GA3 oxidase, may be expressed in other tissues. Expression of GA oxidase repressor elements or constructs using tissue-specific or tissue-preferred promoters may also occur in tissues other than the vascular and leaf tissues of cereal or maize plants, but preferably the level of active GA in developing reproductive tissues of the plant (particularly female reproductive organs or ears) is not significantly reduced or affected (relative to wild-type or control plants), so that the development of female organs or ears can proceed normally in transgenic plants without atypia in the ears and without loss of yield potential.

[0068] Any vascular promoter known in the art can potentially be used as a tissue-specific or tissue-preferred promoter. Examples of vascular promoters include the RTBV promoter (see, for example, SEQ ID NO: 65), known sucrose synthase gene promoters (such as the maize sucrose synthase-1 (Sus1 or Sh1) promoter (see, for example, SEQ ID NO: 67)), maize Sh1 gene paralog promoters, barley sucrose synthase promoter (Ss1) promoters, rice sucrose synthase-1 (RSs1) promoters (see, for example, SEQ ID NO: 68), or rice sucrose synthase-2 (RSs2) promoters (see, for example, SEQ ID NO: 69), and known sucrose transporter gene promoters (such as the rice sucrose transporter promoter (SUT1) (see, for example, SEQ ID NO: 69)). 70), or various known viral promoters, such as the dayflower yellow mottle virus (CoYMV) promoter, the wheat dwarf geminivirus (WDV) large intergenic region (LIR) promoter, the maize stripe geminivirus (MSV) capsid protein (CP) promoter, or the rice yellow stripe 1 (YS1) or OsYSL2 promoter (SEQ ID NO: 71), and any functional sequence portion or truncation of any of the aforementioned promoters having a similar expression pattern, such as a truncated RTBV promoter (see, for example, SEQ ID NO: 66).

[0069] Any leaf promoter known in the art can potentially be used as a tissue-specific or tissue-preferred promoter. Examples of leaf promoters include the maize pyruvate phosphate dikinase or PPDK promoter (see, for example, SEQ ID NO: 72), the maize fructose 1,6-bisphosphate aldolase or FDA promoter (see, for example, SEQ ID NO: 73), and the rice Nadh-Gogat promoter (see, for example, SEQ ID NO: 74), as well as any functional sequence portions or truncations of any of the aforementioned promoters with similar expression patterns. Other examples of leaf promoters from monocotyledonous plant genes include the ribulose diphosphate carboxylase (RuBisCO) or RuBisCO small subunit (RBCS) promoter, the chlorophyll a / b binding protein gene promoter, the phosphoenolpyruvate carboxylase (PEPC) promoter, and the Myb gene promoter, as well as any functional sequence portions or truncations of any of these promoters with similar expression patterns.

[0070] Any other vascular and / or leaf promoters known in the art may also be used, including promoter sequences of related genes with similar expression patterns from the same or different plant species or viruses (e.g., sucrose synthase, sucrose transporter, and viral gene promoter sequences). Promoter sequences highly homologous to any of the foregoing are also provided. For example, a vascular promoter may contain a DNA sequence that is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to any of the functional sequences in one or more of SEQ ID NO: 65, 66, 67, 68, 69, 70, and 71, or at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to any of the functional sequences in one or more of SEQ ID NO: 72, 73, and 74, or at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to any of the functional sequences in one or more of SEQ ID NO: 72, 73, and 74; and a constitutive promoter may contain a DNA sequence that is ... DNA sequences of one or more of 75, 76, 77, 78, 79, 80, 81, 82, and 83, any functional sequence portion or truncated, and / or any sequence complementary to any of the foregoing sequences that are at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical. Examples of vascular and / or leaf promoters may also include other known engineered and / or later-identified promoter sequences that exhibit expression patterns in the vascular and / or leaf tissues of cereal or maize plants. Furthermore, any known or later-identified constitutive promoter may also be used to express GA20 oxidase or GA3 oxidase repressor elements. Common examples of constitutive promoters are provided below.

[0071] As commonly understood in the art, the term "promoter" generally refers to a DNA sequence containing an RNA polymerase binding site, a transcription start site, and / or a TATA box that assists or promotes the transcription and expression of an associated transcribed polynucleotide sequence and / or gene (or transgene). Promoters can be synthetic or artificial, and / or engineered, modified, or derived from known or naturally occurring promoter sequences. Promoters can be chimeric promoters comprising a combination of two or more heterologous sequences. Therefore, the promoters of the present invention can include variants of promoter sequences that are compositionally similar to but not identical to other promoter sequences known or provided herein. Promoters can be classified according to various criteria associated with the expression pattern of the associated coding or transcribed sequence or gene (including transgene) operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters that drive expression in all or almost all tissues of a plant are called "constitutive" promoters. However, the expression levels achieved using "constitutive" promoters are not necessarily consistent across different tissue types and cells. Promoters that drive expression at certain stages or phases of development are called "developmental" promoters. Promoters that drive enhanced expression in certain tissues of a plant, relative to other plant tissues, are called “tissue-enhancing” or “tissue-preferred” promoters. Therefore, “tissue-preferred” promoters elicit relatively high, preferential, or dominant expression in specific plant tissues, but have lower levels of expression in other plant tissues. Promoters that are expressed in specific plant tissues and rarely or not expressed in other plant tissues are called “tissue-specific” promoters. Tissue-specific or tissue-preferred promoters can also be defined according to the specific or preferred tissue in which they drive the expression of their associated transcribed DNA sequence or repressor element. For example, a promoter that elicits specific expression in vascular tissues can be called a “vascular-specific promoter,” while a promoter that elicits preferential or dominant expression in vascular tissues can be called a “vascular-preferred promoter.” Similarly, a promoter that elicits specific expression in leaf tissues can be called a “leaf-specific promoter,” while a promoter that elicits preferential or dominant expression in leaf tissues can be called a “leaf-preferred promoter.” “Inducible” promoters are promoters that initiate transcription in response to environmental stimuli such as cold, drought, or light, or other stimuli such as trauma or chemical application. Promoters can also be classified according to their origin, such as heterologous, homologous, chimeric, and synthetic. A "heterologous" promoter is a promoter sequence that has a different origin from its associated transcribed, coding, or gene (or transgene) and / or is not naturally present in the plant species to be transformed as defined above.

[0072] Several GA oxidases in cereal plants are composed of families of related GA oxidase genes. For example, maize has a family of at least nine GA20 oxidase genes, including GA20 oxidase_1, GA20 oxidase_2, GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA20 oxidase_6, GA20 oxidase_7, GA20 oxidase_8, and GA20 oxidase_9. However, three known or potential GA3 oxidase genes exist in maize: GA3 oxidase_1, GA3 oxidase_2, and GA3 oxidase_3. The DNA and protein sequences of each of these GA20 oxidase genes are provided in Table 1 with SEQ ID NO, and the DNA and protein sequences of each of these GA3 oxidase genes are provided in Table 2 with SEQ ID NO.

[0073] Table 1. DNA and protein sequences of the GA20 oxidase gene in maize, represented by sequence identifiers.

[0074] Table 2. DNA and protein sequences of the GA3 oxidase gene in maize, represented by sequence identifiers.

[0075] The genomic DNA sequence of GA20 oxidase_3 is provided in SEQ ID NO: 34, and the genomic DNA sequence of GA20 oxidase_5 is provided in SEQ ID NO: 35. For the GA20 oxidase_3 gene, SEQ ID NO: 34 provides 3000 nucleotides (nucleotides 1-3000) upstream of the 5'-UTR of GA20 oxidase_3; nucleotides 3001-3096 correspond to the 5'-UTR; nucleotides 3097-3665 correspond to the first exon; nucleotides 3666-3775 correspond to the first intron; nucleotides 3776-4097 correspond to the second exon; nucleotides 4098-5314 correspond to the second intron; nucleotides 5315-5584 correspond to the third exon; and nucleotides 5585-5800 correspond to the 3'-UTR. SEQ ID NO: 34 also provides 3000 nucleotides (nucleotides 5801-8800) downstream of the end of the 3'-UTR. For the GA20 oxidase_5 gene, SEQ ID NO: 35 provides 3000 nucleotides (nucleotides 1-3000) upstream of the start codon of GA20 oxidase_5; nucleotides 3001-3791 correspond to the first exon; nucleotides 3792-3906 correspond to the first intron; nucleotides 3907-4475 correspond to the second exon; nucleotides 4476-5197 correspond to the second intron; nucleotides 5198-5473 correspond to the third exon; and nucleotides 5474-5859 correspond to the 3'-UTR. SEQ ID NO: 35 also provides 3000 nucleotides (nucleotides 5860-8859) downstream of the end of the 3'-UTR.

[0076] The genomic DNA sequences of GA3 oxidase_1 are provided in SEQ ID NO: 36, 168, and 174, the genomic DNA sequences of GA3 oxidase_2 are provided in SEQ ID NO: 37, 169, and 175, and the genomic DNA sequences of GA3 oxidase_3 are provided in SEQ ID NO: 170 and 176. While SEQ ID NO: 36 and 37 provide the 5'-UTR, exon, intron, and 3'-UTR sequences of the GA3 oxidase_1 and GA3 oxidase_2 genes, respectively, SEQ ID NO: 168 and 174, and SEQ ID NO: 169 and 175 further provide the upstream and downstream genomic sequences of the GA3 oxidase_1 and GA3 oxidase_2 genes, as well as additional 5' and 3' UTR sequences, respectively.

[0077] For the GA3 oxidase_1 gene, nucleotides 1-29 of SEQ ID NO: 36 correspond to the 5'-UTR; nucleotides 30-514 of SEQ ID NO: 36 correspond to the first exon; nucleotides 515-879 of SEQ ID NO: 36 correspond to the first intron; nucleotides 880-1038 of SEQ ID NO: 36 correspond to the second exon; nucleotides 1039-1158 of SEQ ID NO: 36 correspond to the second intron; nucleotides 1159-1663 of SEQ ID NO: 36 correspond to the third exon; and nucleotides 1664-1788 of SEQ ID NO: 36 correspond to the 3'-UTR. Alternatively, for the GA3 oxidase_1 gene, SEQ ID NO:168 provides 3000 nucleotides (nucleotides 1-3000) upstream of the GA3 oxidase_1 5'-UTR; nucleotides 3001-3161 of SEQ ID NO:168 correspond to the 5'-UTR; nucleotides 3162-3646 of SEQ ID NO:168 correspond to the first exon; nucleotides 3647-4011 of SEQ ID NO:168 correspond to the first intron; nucleotides 4012-4170 of SEQ ID NO:168 correspond to the second exon; nucleotides 4171-4290 of SEQ ID NO:168 correspond to the second intron; nucleotides 4291-4795 of SEQ ID NO:168 correspond to the third exon; and nucleotides 4796-5406 of SEQ ID NO:168 correspond to the 3'-UTR. SEQ ID NO: 168 also provides 3000 nucleotides (nucleotides 5407-8406) downstream of the end of the 3'-UTR.Alternatively, for the GA3 oxidase_1 gene, SEQ ID NO: 174 provides 7620 nucleotides upstream of the GA3 oxidase_1 5'-UTR (nucleotides 1-5620 of SEQ ID NO: 174 correspond to the upstream intergenic sequence, and nucleotides 5621-7620 of SEQ ID NO: 174 correspond to the GA3 oxidase_1 promoter region); nucleotides 7621-8029 of SEQ ID NO: 174 correspond to the 5'-UTR; nucleotides 8030-8514 of SEQ ID NO: 174 correspond to the first exon; nucleotides 8515-8887 of SEQ ID NO: 174 correspond to the first intron; nucleotides 8888-9046 of SEQ ID NO: 174 correspond to the second exon; nucleotides 9047-9166 of SEQ ID NO: Nucleotides 9167-9671 of SEQ ID NO: 174 correspond to the third exon; and nucleotides 9672-10276 of SEQ ID NO: 174 correspond to the 3'-UTR. SEQ ID NO: 174 also provides 3951 nucleotides of the intergenic sequence downstream of the 3'-UTR terminus (nucleotides 10277-14227 of SEQ ID NO: 174).

[0078] For the GA3 oxidase_2 gene, nucleotides 1-38 of SEQ ID NO: 37 correspond to the 5'-UTR; nucleotides 39-532 of SEQ ID NO: 37 correspond to the first exon; nucleotides 533-692 of SEQ ID NO: 37 correspond to the first intron; nucleotides 693-851 of SEQ ID NO: 37 correspond to the second exon; nucleotides 852-982 of SEQ ID NO: 37 correspond to the second intron; nucleotides 983-1445 of SEQ ID NO: 37 correspond to the third exon; and nucleotides 1446-1698 of SEQ ID NO: 37 correspond to the 3'-UTR. Alternatively, for the GA3 oxidase_2 gene, SEQ ID NO: 169 provides 3000 nucleotides (nucleotides 1-3000) upstream of the GA3 oxidase_2 5'-UTR; nucleotides 3001-3056 of SEQ ID NO: 169 correspond to the 5'-UTR; nucleotides 3057-3550 of SEQ ID NO: 169 correspond to the first exon; nucleotides 3551-3710 of SEQ ID NO: 169 correspond to the first intron; nucleotides 3711-3869 of SEQ ID NO: 169 correspond to the second exon; nucleotides 3870-3991 of SEQ ID NO: 169 correspond to the second intron; nucleotides 3992-4463 of SEQ ID NO: 169 correspond to the third exon; and nucleotides 4464-4581 of SEQ ID NO: 169 correspond to the 3'-UTR. SEQ ID NO: 169 also provides 3000 nucleotides (nucleotides 4582-7581) downstream of the end of the 3'-UTR.Alternatively, for the GA3 oxidase_2 gene, SEQ ID NO: 175 provides 7285 nucleotides upstream of the GA3 oxidase_2 5'-UTR (nucleotides 1-5385 of SEQ ID NO: 175 correspond to the upstream intergenic sequence, and nucleotides 5386-7385 of SEQ ID NO: 175 correspond to the GA3 oxidase_2 promoter region); nucleotides 7386-7831 of SEQ ID NO: 175 correspond to the 5'-UTR; nucleotides 7832-7926 of SEQ ID NO: 175 correspond to the first exon; nucleotides 7927-8086 of SEQ ID NO: 175 correspond to the first intron; nucleotides 8087-8245 of SEQ ID NO: 175 correspond to the second exon; nucleotides 8246-8371 of SEQ ID NO: Nucleotides 8372-8861 of SEQ ID NO: 175 correspond to the third exon; and nucleotides 8862-8967 of SEQ ID NO: 175 correspond to the 3'-UTR. SEQ ID NO: 175 also provides 7630 nucleotides of the intergenic sequence downstream of the 3'-UTR terminus (nucleotides 8968-16597 of SEQ ID NO: 175).

[0079] For the GA3 oxidase_3 gene, SEQ ID NO: 170 provides 3000 nucleotides (nucleotides 1-3000) upstream of the GA3 oxidase_3 5'-UTR; nucleotides 3001-3130 of SEQ ID NO: 170 correspond to the 5'-UTR; nucleotides 3131-3483 of SEQ ID NO: 170 correspond to the first exon; nucleotides 3484-3582 of SEQ ID NO: 170 correspond to the first intron; nucleotides 3583-3907 of SEQ ID NO: 170 correspond to the second exon; nucleotides 3908-3998 of SEQ ID NO: 170 correspond to the second intron; nucleotides 3999-4274 of SEQ ID NO: 170 correspond to the third exon; and nucleotides 4275-4332 of SEQ ID NO: 170 correspond to the 3'-UTR. SEQ ID NO: 170 also provides 3000 nucleotides (nucleotides 4333-7332) downstream of the end of the 3'-UTR. Alternatively, for the GA3 oxidase_3 gene, SEQ ID NO: 176 provides 7546 nucleotides upstream of the GA3 oxidase_3 5'-UTR (nucleotides 1-5546 of SEQ ID NO: 176 correspond to the upstream intergenic sequence, and nucleotides 5547-7546 of SEQ ID NO: 176 correspond to the GA3 oxidase_3 promoter region); nucleotides 7547-7751 of SEQ ID NO: 176 correspond to the 5'-UTR; nucleotides 7752-8104 of SEQ ID NO: 176 correspond to the first exon; nucleotides 8105-8205 of SEQ ID NO: 176 correspond to the first intron; nucleotides 8206-8530 of SEQ ID NO: 176 correspond to the second exon; nucleotides 8531-8621 of SEQ ID NO: Nucleotides 8622-8903 of SEQ ID NO: 176 correspond to the third exon; and nucleotides 8904-9178 of SEQ ID NO: 176 correspond to the 3'-UTR. SEQ ID NO: 176 also provides 6176 nucleotides of the intergenic sequence downstream of the 3'-UTR terminus (nucleotides 9179-15354 of SEQ ID NO: 176).

[0080] Note that for SEQ ID NO: 174, 175 and 176, the nucleotide boundaries between the upstream promoter and the intergenic region may not perfectly conform to the coordinates above, and promoters, expression (e.g., enhancers or repressors) and / or transcriptional regulatory elements may also be present in the upstream intergenic sequence of the corresponding gene.

[0081] In addition to phenotypic observations under repression of the GA20 oxidase_3 and / or GA20 oxidase_5 genes, or the GA3 oxidase gene, a semi-dwarf phenotype was also observed under repression of the GA20 oxidase_4 gene. The genomic DNA sequence of GA20 oxidase_4 is provided in SEQ ID NO: 38. For the GA oxidase_4 gene, SEQ ID NO: 38 provides nucleotides 1-1416 upstream of the 5'-UTR; nucleotides 1417-1543 of SEQ ID NO: 38 correspond to the 5'-UTR; nucleotides 1544-1995 of SEQ ID NO: 38 correspond to the first exon; nucleotides 1996-2083 of SEQ ID NO: 38 correspond to the first intron; nucleotides 2084-2411 of SEQ ID NO: 38 correspond to the second exon; nucleotides 2412-2516 of SEQ ID NO: 38 correspond to the second intron; nucleotides 2517-2852 of SEQ ID NO: 38 correspond to the third exon; nucleotides 2853-3066 of SEQ ID NO: 38 correspond to the 3'-UTR; and nucleotides 3067-4465 of SEQ ID NO: 38 correspond to the genomic sequence downstream of the 3'-UTR.

[0082] According to embodiments of this disclosure, a recombinant DNA molecule, vector, or construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least a segment or portion of an mRNA molecule in a plant that (i) is expressed by an endogenous GA oxidase gene and / or (ii) encodes an endogenous GA oxidase protein, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter, and wherein the plant is a cereal or maize plant.

[0083] According to some embodiments, the non-coding RNA molecule targets and represses GA20 oxidase genes, such as GA20 oxidase_3 and / or GA20 oxidase_5 genes, and contains a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 7, 8, 13, and 14. According to some implementation schemes, the non-coding RNA molecule is complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an endogenous GA20 oxidase protein in a plant that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to one or both of SEQ ID NO: 9 and 15. According to other embodiments, the non-coding RNA molecule may contain a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% similar to one or both of the untranslated or exon sequences in mature mRNA sequences. In addition to targeting mature mRNA sequences (including untranslated or exon sequences), the non-coding RNA molecule may also target intron sequences of the GA20 oxidase gene or transcript.

[0084] According to some implementation schemes, the non-coding RNA molecule targets and represses the GA3 oxidase gene and contains a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to one or more of SEQ ID NO: 28, 29, 31, 32, 171, and 172. According to other embodiments, the non-coding RNA molecule is complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an endogenous GA3 oxidase protein in a plant that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to one or both of SEQ ID NO: 30, 33, and 173. According to other embodiments, the non-coding RNA molecule may contain a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% similar to one or both of the untranslated or exon sequences in mature mRNA sequences. In addition to targeting mature mRNA sequences (including untranslated or exon sequences), the non-coding RNA molecule may also target intron sequences of the GA3 oxidase gene or transcript.

[0085] According to some implementation schemes, the non-coding RNA molecule targets and represses the GA20 oxidase_4 gene and contains a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of one or both of SEQ ID NO: 10 and 11. According to other embodiments, the non-coding RNA molecule is complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an endogenous GA20 oxidase protein in a plant that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to one or both of those in SEQ ID NO: 12. According to other embodiments, the non-coding RNA molecule may contain at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% similar to the endogenous GA20 oxidase protein encoded by SEQ ID NO: 12 in plants. In addition to targeting mature mRNA sequences (including untranslated or exon sequences or both), the non-coding RNA molecule may also target intron sequences of the GA20 oxidase gene or transcript.

[0086] According to many implementation schemes, the non-coding RNA molecule encoded by the transcribed DNA sequence of the recombinant DNA molecule, vector, or construct can be a precursor miRNA or siRNA that is processed or cleaved in plant cells to form a mature miRNA or siRNA targeting the GA20 oxidase or GA3 oxidase gene.

[0087] According to embodiments of the present invention, GA levels in the stalks or stems of cereal or maize plants can be reduced by repressing, mutagenesis, or editing a limited subset of genes within the GA oxidase family. Unbound by theory, it is proposed that repression of a limited number of genes within the GA oxidase family can produce a dwarf phenotype and lodging resistance in transgenic plants, but without allergy in the reproductive or ear tissues of the plant. This is due to differential expression among GA oxidase genes, adequate compensation from other GA oxidase genes in those reproductive tissues for the repressed GA oxidase gene, and / or incomplete repression of the targeted GA oxidase gene. Therefore, by utilizing tissue-specific or tissue-preferred promoters to restrict or repress the expression of GA oxidase genes, not only can allergy be avoided, but it is also proposed that repression can be targeted at a limited subset of GA oxidase genes (e.g., a limited number of GA20 oxidase genes) so that other GA oxidase genes within the same gene family (e.g., other GA20 oxidase genes) can compensate for the expression loss of the repressed GA oxidase gene in those tissues. Incomplete repression of GA oxidase genes can also allow sufficient levels of expression of the targeted GA oxidase gene in one or more tissues to avoid aberrations or undesirable traits in plants that would negatively impact crop yield, such as reproductive aberrations or excessively shortened plant height. Unlike mutations that completely destroy the gene's function, repression allows partial activity of the targeted gene to persist. Because different GA20 oxidase genes exhibit different expression patterns in plants, repression of a limited subset of GA20 oxidase genes can allow modification of certain traits while avoiding aberrations previously associated with GA mutants in cereals. In other words, growth, development, and reproductive traits or aberrations previously associated with GA mutants in maize and other cereal crops can be decoupled by targeting only a limited number or subgroups of GA20 or GA3 oxidase genes (i.e., one or more, but not all) and / or by incomplete repression of GA oxidase genes. By transgenically targeting subgroups of one or more endogenous GA3 or GA20 oxidase genes within plants, semi-dwarf plants can be produced using more general expression patterns (e.g., constitutive promoters) without significant reproductive heterosis and / or other undesirable traits, even when the transgenic construct is expressed in reproductive tissues. In fact, this paper provides repression elements and constructs that selectively target GA20 oxidase_3 and / or GA20 oxidase_5 genes (identified in Table 1 above) for repression, which can be operatively linked to vascular, leaf, and / or constitutive promoters.

[0088] Using repressor constructs that target only a limited subset of GA20 oxidase genes (such as GA20 oxidase_3, GA20 oxidase_4, and / or GA20 oxidase_5 genes) or GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, restricting the expression pattern of the repressor element may be less important for obtaining normal reproductive development and avoiding aberrations in female organs or ears in cereal or maize plants due to compensation from other GA20 and / or GA3 oxidase genes. Therefore, the expression of repressor constructs and elements that selectively or preferentially target, for example, the GA20 oxidase_3 and / or GA20 oxidase_5 genes, the GA20 oxidase_4 gene, and / or the GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, or similar genes and homologs in other cereal plants, can be driven by a variety of different plant-expressible promoter types, including constitutive and tissue-specific or tissue-preferred promoters, such as vascular or leaf promoters, which may include, for example, the RTBV promoters described above (e.g., promoters containing the RTBV (SEQ ID NO: 65) or truncated RTBV (SEQ ID NO: 66) sequences) and any other promoters that drive expression in tissues covering most or all of the vascular and / or leaf tissues of a plant. Any known or later-identified constitutive promoter with sufficiently high expression levels may also be used to target subgroups of GA20 and / or GA3 oxidase genes in maize, particularly the GA20 oxidase_3 and / or GA20 oxidase_5 genes, the GA20 oxidase_4 gene, and / or the GA3 oxidase_1, GA3 oxidase_2 and / or GA3 oxidase_3 genes, or the expression of repressor constructs of similar genes or homologs in other cereal plants.

[0089] Examples of constitutive promoters that can be used in monocotyledonous plants such as cereals or maize include, for example, various actin gene promoters, such as the rice actin 1 promoter (see, for example, U.S. Patent No. 5,641,876; also see SEQ ID NO: 75 or SEQ ID NO: 76) and the rice actin 2 promoter (see, for example, U.S. Patent No. 6,429,357; also see, for example, SEQ ID NO: 77 or SEQ ID NO: 78), CaMV 35S or 19S promoters (see, for example, U.S. Patent No. 5,352,605; for CaMV 35S, also see, for example, SEQ ID NO: 79), the maize ubiquitin promoter (see, for example, U.S. Patent No. 5,510,474), and the coix seed promoter (see, for example, Coix seed promoter). Coix lacryma-jobiPolyubiquitin promoters (see, for example, SEQ ID NO: 80), rice or maize Gos2 promoters (see, for example, Pater et al., The Plant Journal, 2(6):837-44 1992; for the rice Gos2 promoter, also see, for example, SEQ ID NO: 81), FMV 35S promoters (see, for example, U.S. Patent No. 6,372,211), dual-enhanced CMV promoters (see, for example, U.S. Patent No. 5,322,938), MMV promoters (see, for example, U.S. Patent No. 6,420,547; also see, for example, SEQ ID NO: 82), PCLSV promoters (see, for example, U.S. Patent No. 5,850,019; also see, for example, SEQ ID NO: 83), Emu promoters (see, for example, Last et al., Theor. Appl. Genet. 81:581 (1991); and Mcelroy et al., Mol. Gen. Genet. 231:150 (1991)), microtubule promoters from maize, rice or other species, lipoic acid synthase (nos) promoters, octopus alkaloid synthase (ocs) promoters, mannitol synthase (mas) promoters, or phytol dehydrogenase (e.g., maize Adh1) promoters, any other promoters known in the art or subsequently identified that provide constitutive expression in cereal or maize plants (including viral promoters), any other constitutive promoters known in the art that can be used in monocotyledonous or cereal plants, and any functional sequence portion or truncation of any of the foregoing promoters.

[0090] Sufficient expression levels of the transcribed DNA sequence of a non-coding RNA molecule that targets and represses GA oxidase genes may be necessary to produce a lodging-resistant, dwarf, semi-dwarf phenotype, as lower expression levels may not be sufficient to reduce active GA levels in the plant to a degree that elicits a significant phenotype. Therefore, tissue-specific and tissue-preferred promoters that drive the expression of their associated transcribed DNA sequences at moderate or strong levels in tissues that produce active GA in plants are likely preferred. Furthermore, such tissue-specific and tissue-preferred promoters should drive the expression of their associated transcribed DNA sequences during one or more vegetative stages of plant development, during which the plant is growing and / or elongating, including one or more of the following vegetative stages: V E , V1, V2, V3, V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, V14, Vn, V TExpression, such as during at least V3-V12, V4-V12, V5-V12, V6-V12, V7-V12, V8-V12, V3-V14, V5-V14, V6-V14, V7-V14, V8-V14, V9-V14, V10-V14, etc., or during any other range of vegetative phases in which plant growth and / or elongation is occurring.

[0091] According to many embodiments, plant-expressible promoters can preferably constitutively drive expression or be expressed in at least a portion of the vascular and / or leaf tissues of a plant. Different promoters that drive the expression of repressive elements targeting endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes, GA20 oxidase_4 genes, GA3 oxidase_1, GA3 oxidase_2 and / or GA3 oxidase_3 genes, or similar genes and homologs in other cereals can effectively reduce plant height and increase lodging resistance to varying degrees, depending on their specific expression patterns and intensities in the plant. However, some tissue-specific and tissue-preferred promoters that drive the expression of GA20 or GA3 oxidase repressive elements in plants may not produce significant dwarf or lodging-resistant phenotypes due to spatiotemporal expression patterns of the promoters during plant development, and / or because the expression levels or intensities of the promoters are too low or too weak. Furthermore, some repressor constructs, when expressed in plants, may only reduce, not eliminate, the expression of genes targeting GA20 or GA3 oxidases, and therefore, depending on the expression pattern and intensity achieved using a given promoter, the expression pattern and level of GA20 or GA3 oxidase repressor constructs achieved using such promoters may be insufficient to produce observable plant height and lodging resistance phenotypes in plants.

[0092] According to embodiments of the present invention, a recombinant DNA molecule, vector, or construct is provided for repressing one or more endogenous GA20 or GA3 oxidase genes in plants, comprising a transcribed DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least a segment or portion of an mRNA molecule expressed by an endogenous GA oxidase gene in a plant and encoding an endogenous GA oxidase protein, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter, and wherein the plant is a cereal or maize plant. As described above, in addition to targeting mature mRNA sequences, the non-coding RNA molecule may also target intron sequences of GA oxidase genes or transcripts. According to various embodiments, a non-coding RNA molecule may target and repress the GA20 oxidase_3 gene and contains a sequence that is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of at least 15, at least 16, at least 17, at least 18, at least 19, at least 19, or more than 27, consecutive nucleotides of SEQ ID NO: 7 or SEQ ID NO: 8. According to some embodiments, the non-coding RNA molecule targeting and repressing the GA20 oxidase_3 gene may be complementary to at least 19, but not more than 27, consecutive nucleotides of SEQ ID NO: 7 or SEQ ID NO: 8, such as to 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule can target and repress the GA20 oxidase gene and contains at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of ...According to another embodiment, the non-coding RNA molecule may contain a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of mRNA encoding an endogenous GA20 oxidase protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% similar ...

[0093] As mentioned above, non-coding RNA molecules can target the intron sequences of the GA oxidase gene, replacing exons, 5' UTRs, or 3' UTRs, or otherwise. Therefore, non-coding RNA molecules that target and repress the GA20 oxidase_3 gene may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 34, and / or SEQ ID NO: 34, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary sequences to nucleotides 3666-3775 or 4098-5314. It is important to note that the sequence provided for the GA20 oxidase_3 gene in this paper can vary across maize plants, lines, and germplasm due to gene polymorphism and / or the presence of different alleles. Furthermore, the GA20 oxidase_3 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecule. Therefore, a non-coding RNA molecule targeting the repression of the GA20 oxidase_3 gene can be more broadly defined as containing a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 34.

[0094] According to embodiments of this disclosure, a recombinant DNA molecule, vector, or construct for repressing the endogenous GA20 oxidase_5 gene in plants is provided, comprising a transcribed DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule targeting and repressing the GA20 oxidase_5 gene comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14. According to some implementation schemes, a noncoding RNA molecule that targets and represses the GA20 oxidase_5 gene may be complementary to at least 19 but no more than 27 consecutive nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14, such as 19, 20, 21, 22, 23, 24, 25, 26 or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule can target and repress the GA20 oxidase gene and contains a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to the sequence of ... According to another embodiment, the non-coding RNA molecule may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of ...5%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 10

[0095] As mentioned above, non-coding RNA molecules, in place of the exons or untranslated regions of the mature mRNA of the GA oxidase gene, or otherwise, can target the intron sequences of the GA oxidase gene. Therefore, non-coding RNA molecules that target and repress the GA20 oxidase_5 gene may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 35 or SEQ ID NO: 35, which are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to nucleotides 3792-3906 or 4476-5197. Due to gene polymorphism and / or the presence of different alleles, the sequence provided for GA20 oxidase_5 can vary across maize plants, lines, and germplasm. Furthermore, the GA20 oxidase_5 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecule. Therefore, a non-coding RNA molecule targeting the GA20 oxidase_3 gene for repression can be more broadly defined as containing a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 35.

[0096] According to another embodiment, a recombinant DNA molecule, vector, or construct for jointly repressing endogenous GA20 oxidase_3 and GA20 oxidase_5 genes in plants is provided, comprising a transcribed DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule targeting and repressing the GA20 oxidase_3 and GA20 oxidase_5 genes comprises the following sequence, which (i) is complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 7 and / or SEQ ID NO: 8 by at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100%, and (ii) is complementary to SEQ ID NO: 13 and / or SEQ ID NO: The 14-nucleotide sequence consists of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary. According to some implementation schemes of these schemes, the non-coding RNA molecule that jointly targets and represses the GA20 oxidase_3 and GA20 oxidase_5 genes may be complementary to at least 19 but no more than 27 consecutive nucleotides of (i) SEQ ID NO: 7 (and / or SEQ ID NO: 8) and (ii) SEQ ID NO: 13 (and / or SEQ ID NO: 14), such as to 19, 20, 21, 22, 23, 24, 25, 26 or 27 consecutive nucleotides.According to various embodiments, a non-coding RNA molecule that jointly targets and represses the GA20 oxidase_3 and GA20 oxidase_5 genes comprises the following sequence: (i) at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of an mRNA molecule encoding an endogenous GA20 oxidase protein identical to SEQ ID NO: 9 for at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% of the same gene; and (ii .... The non-coding RNA molecule is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of the same endogenous GA20 oxidase protein mRNA molecule. As mentioned above, the non-coding RNA molecule can target intron sequences of the GA oxidase gene. Therefore, the non-coding RNA molecule can target intron sequences of one or both of the GA20 oxidase_3 and / or GA20 oxidase_5 genes identified above.

[0097] According to specific embodiments, a non-coding RNA molecule encoded by a transcribed DNA sequence comprises (i) a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to SEQ ID NO: 39, 41, 43, or 45, and / or (ii) a sequence or repressor element encoding a non-coding RNA molecule that comprises a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to SEQ ID NO: 40, 42, 44, or 46. According to some embodiments, the non-coding RNA molecule encoded by a transcribed DNA sequence may comprise a sequence having one or more mismatches (such as 1, 2, 3, 4, 5, or more complementary mismatches) relative to a target or recognition site targeting the GA20 oxidase gene mRNA, such as a sequence that is almost complementary to SEQ ID NO: 40 but has one or more complementary mismatches relative to SEQ ID NO: 40. According to a specific implementation scheme, the non-coding RNA molecule encoded by the transcribed DNA sequence contains a sequence that is 100% identical to SEQ ID NO: 40, and is 100% complementary to the target sequence in the cDNA and coding sequence of GA20 oxidase_3 (i.e., SEQ ID NO: 7 and 8, respectively), and / or to the corresponding sequence of the mRNA encoded by the endogenous GA20 oxidase_3 gene. However, the sequence of the non-coding RNA molecule encoded by the transcribed DNA sequence that is 100% identical to SEQ ID NO: 40, 42, 44, or 46 may not be completely complementary to the target sequence in the cDNA and coding sequence of the GA20 oxidase_5 gene (i.e., SEQ ID NO: 13 and 14, respectively), and / or to the corresponding sequence of the mRNA encoded by the endogenous GA20 oxidase_5 gene. For example, the closest complementary match between the non-coding RNA molecule or miRNA sequence in SEQ ID NO: 40 and the cDNA and coding sequence of the GA20 oxidase_5 gene may include a mismatch at the first position of SEQ ID NO: 39 (i.e., the "C" at the first position of SEQ ID NO: 39 is replaced by a "G"; that is, G (TCCATCATGCGGTGCAACTA). However, despite this slight mismatch, the non-coding RNA molecule or miRNA sequence in SEQ ID NO:40 can still bind and hybridize with the mRNA encoded by the endogenous GA20 oxidase_5 gene.

[0098] According to embodiments of this disclosure, a recombinant DNA molecule, vector, or construct is provided for repressing one or more endogenous GA3 oxidase genes in a plant, comprising a transcribed DNA sequence encoding a non-coding RNA molecule, wherein the non-coding RNA molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least a segment or portion of an mRNA molecule expressed by an endogenous GA3 oxidase gene in a plant and encoding an endogenous GA3 oxidase protein, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter, and wherein the plant is a cereal or maize plant. In addition to targeting mature mRNA sequences, the non-coding RNA molecule may also target intron sequences of the GA3 oxidase gene or transcript.

[0099] According to some embodiments, a non-coding RNA molecule may target and repress the GA3 oxidase_1 gene and contains a sequence that is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of at least 15, at least 16, at least 17, at least 18, at least 19, at least 19, at least 27 consecutive nucleotides of SEQ ID NO: 28 or SEQ ID NO: 29. According to some embodiments, the non-coding RNA molecule targeting and repressing the GA3 oxidase gene may be complementary to at least 19, but not more than 27, consecutive nucleotides of SEQ ID NO: 28 or SEQ ID NO: 29, such as to 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule that targets and represses the GA3 oxidase gene comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides encoding an endogenous GA3 oxidase protein in plants, wherein the endogenous GA3 oxidase protein is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to SEQ ID NO: 30. According to another embodiment, the non-coding RNA molecule may contain a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of mRNA encoding an endogenous GA3 oxidase protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% similar ...

[0100] As mentioned above, non-coding RNA molecules, in place of exons, 5' UTRs, or 3' UTRs, or otherwise, can target intron sequences of the GA3 oxidase gene. Therefore, the non-coding RNA molecule targeting the GA3 oxidase_1 gene for repression may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of the sequence of GA3 oxidase_1. Due to gene polymorphism and / or the presence of different alleles, the sequence provided for GA3 oxidase_1 in this paper may vary across maize plants, lines, and germplasm. Furthermore, the GA3 oxidase_1 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecules. Therefore, a non-coding RNA molecule targeting and repressing the GA3 oxidase_1 gene can be more broadly defined as containing a sequence comprising at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% complementary to the sequence of SEQ ID NO: 36 and / or 168.

[0101] According to some embodiments, a non-coding RNA molecule may target and repress the GA3 oxidase_2 gene and contains a sequence that is complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides of SEQ ID NO: 31 or SEQ ID NO: 32 at at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%. According to some embodiments, the non-coding RNA molecule targeting and repressing the GA3 oxidase gene may be complementary to at least 19 but no more than 27 consecutive nucleotides of SEQ ID NO: 31 or SEQ ID NO: 32, such as to 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule that targets and represses the GA3 oxidase gene comprises at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to the sequence of ... According to another embodiment, the non-coding RNA molecule may contain a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of mRNA encoding an endogenous GA3 oxidase protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% similar ...

[0102] As mentioned above, non-coding RNA molecules, in place of exons, 5' UTRs, or 3' UTRs, or otherwise, can target intron sequences of the GA3 oxidase gene. Therefore, the non-coding RNA molecule targeting the GA3 oxidase_2 gene for repression may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of the sequence of GA3 oxidase_2. Due to gene polymorphism and / or the presence of different alleles, the sequences provided herein for GA3 oxidase_2 may vary across maize plants, lines, and germplasm. Furthermore, the GA3 oxidase_2 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecules. Therefore, a non-coding RNA molecule targeting and repressing the GA3 oxidase_2 gene can be more broadly defined as containing a sequence comprising at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% complementary to the sequence of SEQ ID NO: 37 and / or 169.

[0103] According to some implementation schemes, the non-coding RNA molecule can target and repress the GA3 oxidase_3 gene and contains a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 171 or SEQ ID NO: 172. According to some implementation schemes, a noncoding RNA molecule that targets and represses the GA3 oxidase gene may be complementary to at least 19 but no more than 27 consecutive nucleotides of SEQ ID NO: 171 or SEQ ID NO: 172, such as 19, 20, 21, 22, 23, 24, 25, 26 or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule that targets and represses the GA3 oxidase gene comprises at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to the sequence of ... According to another embodiment, the non-coding RNA molecule may contain a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of mRNA encoding an endogenous GA3 oxidase protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% similar ...

[0104] As mentioned above, non-coding RNA molecules can target intron sequences of the GA3 oxidase gene, replacing exons, 5' UTRs, or 3' UTRs, or other than these. Therefore, non-coding RNA molecules that target and repress the GA3 oxidase_3 gene may contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 170, and / or SEQ ID NO: 170, comprising sequences at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to nucleotides 3484-3582 or 3908-3998. Due to gene polymorphism and / or the presence of different alleles, the sequences provided for GA3 oxidase_3 in this study can vary across maize plants, lines, and germplasm. Furthermore, the GA3 oxidase_3 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecules. Therefore, non-coding RNA molecules targeting the GA3 oxidase_3 gene for repression can be more broadly defined as containing a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO:170.

[0105] According to specific embodiments, the non-coding RNA molecule encoded by a transcribed DNA sequence for targeting the GA3 oxidase gene comprises (i) a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to SEQ ID NO: 57 or 59, and / or (ii) a sequence or repressive element encoding the non-coding RNA molecule that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the sequence in SEQ ID NO: 58 or 60. According to some embodiments, the non-coding RNA molecule encoded by the transcribed DNA sequence may comprise a sequence having one or more mismatches (such as 1, 2, 3, 4, 5, or more complementary mismatches) relative to the target or recognition site of the GA3 oxidase gene mRNA, such as a sequence that is almost complementary to SEQ ID NO: 57 or 59 but has one or more complementary mismatches relative to SEQ ID NO: 57 or 59. According to a specific implementation scheme, the non-coding RNA molecule encoded by the transcribed DNA sequence contains a sequence that is 100% identical to SEQ ID NO: 58 or 60, which is 100% complementary to the target sequence in the cDNA and coding sequence of GA3 oxidase_1 or GA3 oxidase_2 in maize (i.e., SEQ ID NO: 28, 29, 31 and / or 32), and / or to the corresponding sequence of the mRNA encoded by the endogenous GA3 oxidase_1 or GA3 oxidase_2 gene.

[0106] According to some implementation schemes, the non-coding RNA molecule can target and repress the GA20 oxidase_4 gene and contains a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 10 or SEQ ID NO: 11. According to some implementation schemes, a noncoding RNA molecule that targets and represses the GA20 oxidase_4 gene may be complementary to at least 19 but no more than 27 consecutive nucleotides of SEQ ID NO: 10 or SEQ ID NO: 11, such as 19, 20, 21, 22, 23, 24, 25, 26 or 27 consecutive nucleotides. According to some implementation schemes, the non-coding RNA molecule that targets and represses the GA20 oxidase gene comprises at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotide sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to the sequence of ... According to another embodiment, the non-coding RNA molecule may contain a sequence that is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the sequence of mRNA encoding an endogenous GA20 oxidase protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% similar ...

[0107] As mentioned above, non-coding RNA molecules can target intron sequences of the GA20 oxidase gene, replacing exons, 5' UTRs, or 3' UTRs, or otherwise. Therefore, non-coding RNA molecules that target and repress the GA20 oxidase_4 gene may contain at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides of SEQ ID NO: 38, and / or SEQ ID NO: 38, comprising sequences at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% complementary to nucleotides 1996-2083 or 2412-2516. Due to gene polymorphism and / or the presence of different alleles, the sequences provided for GA20 oxidase_4 in this study can vary across maize plants, lines, and germplasm. Furthermore, the GA20 oxidase_4 gene can be expressed as an alternative splicing isoform, which can produce different mRNA, cDNA, and coding sequences that can influence the design of the repressor construct and non-coding RNA molecules. Therefore, non-coding RNA molecules targeting the GA20 oxidase_4 gene for repression can be more broadly defined as containing a sequence comprising at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 38.

[0108] According to specific embodiments, the non-coding RNA molecule encoded by a transcribed DNA sequence for targeting the GA20 oxidase_4 gene comprises (i) a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to SEQ ID NO: 61, and / or (ii) a sequence or repressive element encoding the non-coding RNA molecule that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to the sequence in SEQ ID NO: 62. According to some embodiments, the non-coding RNA molecule encoded by the transcribed DNA sequence may comprise a sequence having one or more mismatches (such as 1, 2, 3, 4, 5, or more complementary mismatches) relative to the target or recognition site of the GA20 oxidase gene mRNA, such as a sequence that is almost complementary to SEQ ID NO: 61 but has one or more complementary mismatches relative to SEQ ID NO: 61. According to the specific implementation scheme, the non-coding RNA molecule encoded by the transcribed DNA sequence contains a sequence that is 100% identical to SEQ ID NO: 62, which is 100% complementary to the target sequence in the cDNA and coding sequence of GA20 oxidase_4 in maize (i.e., SEQ ID NO: 10 or 11), and / or to the corresponding sequence of the mRNA encoded by the endogenous GA20 oxidase_4 gene.

[0109] According to embodiments of this disclosure, a recombinant DNA construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes, wherein the transcribed DNA sequence is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter, and wherein in one or more tissues of a plant transformed with the transcribed DNA sequence, the transcribed DNA sequence causes a reduction or decrease in the expression level of endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes. Such non-coding RNA molecules encoded by transcribed DNA sequences may contain the following sequences: (i) at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% identical to the endogenous GA20 oxidase protein in plants, which is ... 15 At least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% of the same endogenous GA20 oxidase protein mRNA molecule, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26 or at least 27 consecutive nucleotides, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100% complementary.

[0110] According to embodiments of this disclosure, a recombinant DNA construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, wherein the transcribed DNA sequence is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter, and wherein the transcribed DNA sequence causes a reduction or decrease in the expression levels of endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes in one or more tissues of a plant transformed with the transcribed DNA sequence. Such non-coding RNA molecules encoded by transcribed DNA sequences may contain the following sequences: (i) at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the mRNA molecule encoding an endogenous GA3 oxidase protein identical to SEQ ID NO: 30 in plants; (ii) at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 100% complementary to the mRNA molecule encoding an endogenous GA3 oxidase protein identical to SEQ ID NO: 30 in plants. 33. At least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 100% of the same endogenous GA3 oxidase protein mRNA molecule, at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% complementary to at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the same endogenous GA3 oxidase protein mRNA molecule, and / or (iii) complementary to the encoding plant SEQ ID NO: 173 At least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of the same endogenous GA3 oxidase protein mRNA molecule, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary.

[0111] According to embodiments of this disclosure, a recombinant DNA construct is provided comprising a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses the endogenous GA20 oxidase_4 gene, wherein the transcribed DNA sequence is operatively linked to a constitutive, tissue-specific, or tissue-preferred promoter, and wherein the transcribed DNA sequence causes a reduction or decrease in the expression level of the endogenous GA20 oxidase_4 gene in one or more tissues of a plant transformed with the transcribed DNA sequence. Such non-coding RNA molecules encoded by transcribed DNA sequences may include (i) a sequence that is complementary to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 consecutive nucleotides of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the same endogenous GA20 oxidase protein in plants as SEQ ID NO:12.

[0112] According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes, and / or has endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes edited by targeted genome editing techniques as provided herein, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a vascular promoter or a leaf promoter, and wherein the expression level of the endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes is eliminated, reduced, or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in one or more plant tissues (such as one or more vascular and / or leaf tissues) of the modified or transgenic plant compared to a wild-type or control plant. According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct containing a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes, and / or having endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes edited by targeted genome editing technology to reduce or eliminate their expression levels and / or activity, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter. Such as vascular promoters or leaf promoters, and wherein, compared with wild-type or control plants, the level of one or more active GAs (such as GA1, GA3, GA4 and / or GA7) is reduced or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or 100% in one or more plant tissues (such as one or more stems, internodes, vascular and / or leaf tissues or one or more stems and / or internodes) in the modified or transgenic plant.

[0113] According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, and / or has endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes edited by targeted genome editing techniques as provided herein, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or tissue-specific or tissue-specific promoter. Preferred promoters, such as vascular promoters or leaf promoters, and / or in which the expression levels of endogenous GA3 oxidase_1, GA3 oxidase_2 and / or GA3 oxidase_3 genes are eliminated, reduced or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or 100% in one or more plant tissues (such as one or more vascular and / or leaf tissues) of the modified or transgenic plant compared with wild-type or control plants. According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, and / or has endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes edited by targeted genome editing technology to reduce or eliminate their expression levels and / or activity, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a vascular promoter or a leaf promoter, and wherein one or more GA3 oxidase-1, GA3 oxidase_2, and / or GA3 oxidase_3 genes are expressed at levels and / or eliminated compared to wild-type or control plants. The levels of (such as GA1, GA3, GA4 and / or GA7) are reduced or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or 100% in one or more plant tissues (such as one or more stems, internodes, vascular and / or leaf tissues or one or more stems and / or internodes) in modified or transgenic plants.

[0114] According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses the endogenous GA20 oxidase_4 gene, and / or has an endogenous GA20 oxidase_4 gene edited by a targeted genome editing technique as provided herein, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a vascular promoter or a leaf promoter, and / or wherein the expression level of the endogenous GA20 oxidase_4 gene is eliminated, reduced, or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in one or more plant tissues (such as one or more vascular and / or leaf tissues) of the modified or transgenic plant compared to a wild-type or control plant. According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct containing a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses the endogenous GA20 oxidase_4 gene, and / or has an endogenous GA20 oxidase_4 gene edited by targeted genome editing technology to reduce or eliminate its expression level and / or activity, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a vascular promoter or a leaf promoter, and wherein, compared with wild-type or control plants, the level of one or more active GAs (such as GA1, GA3, GA4, and / or GA7) is reduced or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in one or more plant tissues (such as one or more stems, internodes, vascular and / or leaf tissues or one or more stems and / or internode tissues) of the modified or transgenic plant.

[0115] According to many embodiments, a modified or transgenic plant is provided, which is transformed with a recombinant DNA construct containing a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA20 oxidase_3, GA20 oxidase_4, and / or GA20 oxidase_5 genes; transformed with a recombinant DNA construct containing a transcribed DNA sequence encoding a non-coding RNA molecule targeting the repression of endogenous GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes; and / or has endogenous G... edited by targeted genome editing techniques as provided herein to reduce or eliminate its expression level and / or activity. A20 oxidase_3, GA20 oxidase_4, or GA20 oxidase_5 genes; and / or endogenous GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3 genes edited to reduce or eliminate their expression levels and / or activity as provided herein using targeted genome editing techniques, wherein the transcribed DNA sequence is operatively linked to a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a vascular promoter or a leaf promoter, and / or wherein the modified or transgenic plant has one or more of the following traits: semi-dwarf or reduced plant height or plant type, reduced internode length, increased lodging resistance, and / or increased stem or culm diameter. Such modified or transgenic plants may not exhibit any significant reproductive heterosis. Modified or transgenic plants may have one or more of the following additional traits: reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower spike height, increased leaf water content, improved drought tolerance, increased nitrogen use efficiency, increased water use efficiency, reduced anthocyanin content and anthocyanin area in leaves under normal and / or nitrogen- or water-limited stress conditions, increased spike weight, increased number of grains, increased grain weight, increased yield, and / or increased harvest index.According to many embodiments of these implementations, the expression levels and / or activities of endogenous GA20 oxidase_3, GA20 oxidase_4 and / or GA20 oxidase_5 genes, or endogenous GA3 oxidase_1, GA3 oxidase_2 and / or GA3 oxidase_3 genes, in one or more plant tissues (such as one or more vascular and / or leaf tissues) of the modified or transgenic plant may be eliminated, reduced, or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% compared to wild-type or control plants, and / or one or more GA20 oxidase_3 genes may be reduced. The levels of (such as GA1, GA3, GA4 and / or GA7) are reduced or decreased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or 100% in one or more plant tissues (such as one or more stems, internodes, vascular and / or leaf tissues, or one or more stems and / or internodes) in modified or transgenic plants.

[0116] According to many embodiments of the implementation described in the preceding paragraphs, the non-coding RNA molecule encoded by the transcribed DNA sequence of the recombinant DNA molecule, vector, or construct can be a precursor miRNA or siRNA that can subsequently be processed or cleaved in plant cells to form a mature miRNA or siRNA.

[0117] The recombinant DNA molecules, constructs, or vectors disclosed herein may comprise a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter (such as a constitutive or vascular and / or leaf promoter). For the purposes of this disclosure, the non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, encoded by the transcribed DNA sequence, may comprise a mature non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, and / or a precursor RNA molecule that can be processed in plant cells into a mature non-coding RNA molecule (such as miRNA or siRNA) that targets and represses an endogenous GA oxidase gene. In addition to its associated promoter, the transcribed DNA sequence encoding a non-coding RNA molecule for repressing endogenous GA oxidase genes can be operatively linked to one or more additional regulatory elements, such as enhancers, leader sequences, transcription start sites (TSS), linkers, 5' and 3' untranslated regions (UTRs), introns, polyadenylation signals, termination regions, or sequences, which are suitable, necessary, or preferred for enhancing, regulating, or allowing the expression of the transcribed DNA sequence in plant cells. Such additional regulatory elements can be optional and / or used to enhance or optimize the expression of transgenic or transcribed DNA sequences. As provided herein, the distinction between an "enhancer" and a "promoter" may be that an enhancer typically lacks a transcription start site, TATA box, or equivalent sequence and is therefore insufficient on its own to drive transcription. As used herein, a "leader sequence" can generally be defined as the DNA sequence of the 5'-UTR of the gene (or transgene) between the transcription start site (TSS) and the 5' end of the protein-coding sequence of the transcribed DNA sequence or transgene.

[0118] According to another embodiment, a method is provided for transforming plant cells, tissues, or explants with a recombinant DNA molecule or construct to produce transgenic or edited plants, the recombinant DNA molecule or construct comprising a transcribed DNA sequence or transgene operatively linked to a plant-expressible promoter. The transcribed DNA sequence may encode a non-coding RNA molecule that targets and represses a GA oxidase gene, or an RNA precursor processed into a mature RNA molecule (such as miRNA or siRNA) that targets and represses one or more GA oxidase genes. Alternatively, the transcribed DNA sequence may encode a site-specific nuclease and / or guide RNA for targeted genome editing of plants or plant genes. Many methods for transforming chromosomes or plastids in plant cells with recombinant DNA molecules or constructs are known in the art and can be used to produce transgenic plant cells and plants according to embodiments of the method according to the invention. Any suitable method or technique known in the art for transforming plant cells can be used according to the method of the invention. Effective methods for transforming plants include bacterial-mediated transformation, such as... soil bacilli Mediated or rhizobium ( Rhizobium Transformation mediated by bacteria, and transformation mediated by microparticles or particle bombardment. Various methods for transforming explants with transformation vectors via bacterial-mediated transformation or microparticle or particle bombardment, followed by culturing those explants to regenerate or develop into transgenic plants, are known in the art. Other methods for plant transformation, such as microinjection, electroporation, vacuum infiltration, pressurization, sonication, silicon carbide fiber agitation, and PEG-mediated transformation, are also known in the art.

[0119] Methods for transforming plant cells and explants are well known to those skilled in the art. Methods for transforming plant cells by bombarding them with particles coated with recombinant DNA are provided, for example, in U.S. Patent Nos. 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,153,812. Agrobacterium Mediated transformations are described, for example, in U.S. Patent Nos. 5,159,135; 5,824,877; 5,591,616; 6,384,301; 5,750,871; 5,463,174; and 5,188,958, all of which are incorporated herein by reference. Additional methods for transforming plants can be found, for example, in the Compendium of Transgenic Crop Plants (2009) Blackwell Publishing. Any suitable plant transformation methods known in the art or later developed may be used to transform plant cells or explants using any nucleic acid molecules, constructs, or vectors provided herein.

[0120] Depending on the method and explant used, transgenic plants produced by transformation methods can be chimeric or non-chimeric in response to the transformation event. Further methods are provided for expressing non-coding RNA molecules targeting and repressing endogenous GA oxidase genes in one or more plant cells or tissues under the control of plant-expressible promoters (such as constitutive, tissue-specific, tissue-biased, vascular, and / or leaf promoters as provided herein). Transformation methods can also be used to deliver editing machinery to plant cells or explants to perform desired edits in the plant genome. Transformation methods can be used to produce modified, edited, or transgenic cereal or maize plants with shorter, semi-dwarf plant types, reduced internode length, increased stem / stem diameter, and / or improved lodging resistance. Such modified, edited, or transgenic cereal or maize plants may further possess other traits that could benefit yield, such as reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, improved drought tolerance, increased nitrogen use efficiency, increased water use efficiency, higher stomatal conductance, lower ear height, increased leaf water content, reduced anthocyanin content and / or area in leaves under normal or nitrogen- or water-limited stress, increased ear weight, increased number of seeds or grains, increased seed or grain weight, increased yield, and / or increased harvest index. As used herein, “harvest index” refers to the mass of harvested grains divided by the total mass of aboveground biomass of the plant in the harvested area.

[0121] Transgenic plants expressing a GA oxidase transgene or non-coding RNA molecule that represses the endogenous GA oxidase gene, or modified plants with one or more mutations or edits in the GA oxidase gene, may have canopy closure earlier than wild-type or control plants (e.g., approximately one day earlier, or 12–48 hours, 12–36 hours, 18–36 hours, or approximately 24 hours earlier). Although transgenic plants expressing a GA oxidase transgene or non-coding RNA molecule that represses the endogenous GA oxidase gene and modified plants with one or more mutations or edits in the GA oxidase gene may have lower spike height than wild-type or control plants, spike height is generally at least 18 inches above ground level. Transgenic plants expressing a non-coding RNA molecule that represses the endogenous GA oxidase gene or modified plants with one or more mutations in the GA oxidase gene may have greater biomass and / or leaf area than wild-type or control plants during one or more late vegetative stages (e.g., V8–V12). Transgenic plants expressing GA oxidase transgenes or non-coding RNA molecules that target and repress the endogenous GA oxidase gene, or modified plants with one or more mutations or edits in the GA oxidase gene, may have deeper roots than wild-type or control plants during the late vegetative stage when grown in the field, possibly due to increased root penetration rate. These transgenic or modified plants may reach a depth of 90 cm earlier than wild-type or control plants (e.g., 10–25 days earlier, 15–25 days earlier, or 20 days earlier), which can occur through the plant's vegetative-reproductive transition (e.g., via V16 / R1 at approximately 50 days post-planting, compared to approximately 70 days post-planting for control plants).

[0122] One or more recipient cells or explants or cell targets for transformation include, but are not limited to, seed cells, fruit cells, leaf cells, cotyledon cells, hypocotyl cells, meristem cells, embryo cells, endosperm cells, root cells, bud cells, stem cells, pod cells, flower cells, inflorescence cells, stalk cells, pedicel cells, style cells, stigma cells, receptacle cells, petal cells, sepal cells, pollen cells, anther cells, filament cells, ovary cells, ovule cells, pericarp cells, phloem cells, bud cells, callus cells, chloroplasts, stomatal cells, trichome cells, root hair cells, storage root cells or vascular tissue cells, seeds, embryos, meristems, cotyledons, hypocotyls, endosperm, roots, buds, stems, nodes, callus, cell suspensions, protoplasts, flowers, leaves, pollen, anthers, ovaries, ovules, pericarps, buds and / or vascular tissues, or any transformable portion of any of the foregoing. For plant transformation, any one or more target cells, tissues, explants, etc., that can be used to receive the recombinant DNA transformation vector or molecule of this disclosure can be collectively referred to as "explants" for transformation. Preferably, the transformable or transformed explant cells or tissues can be further developed or regenerated into plants. Any cell or explant from which a fertile plant can grow or regenerate is considered a useful receiving cell or explant (i.e., a target explant for transformation) for carrying out this disclosure. Callus can be originated or created from a variety of tissue sources, including but not limited to embryos or parts of embryos, non-embryonic seed tissues, seedling apical meristems, microspores, etc. Any cell capable of proliferating into callus can serve as a receiving cell for transformation. Transformation methods and materials for preparing transgenic plants (e.g., various culture media and recipient target cells or explants, as well as methods for transformation and subsequent regeneration into transgenic plants) are known in the art.

[0123] Transformation of target plant material or explants can be practiced in tissue cultures on nutrient media, such as mixtures of nutrients that allow for in vitro cell growth or cell culture. As known in the art, transformed explants, cells, or tissues can undergo additional culturing steps, such as callus induction, selection, regeneration, etc. Transformation can also be performed without generating or using callus. Transformed cells, tissues, or explants containing a recombinant DNA sequence insertion or event can be grown, developed, or regenerated into transgenic plants in culture media, plugs, or soil according to methods known in the art. Transgenic plants can be further hybridized with themselves or other plants to produce transgenic seeds and progeny. Transgenic plants can also be prepared by hybridizing a first plant containing a recombinant DNA sequence or transformation event with a second plant lacking the insertion. For example, a recombinant DNA construct or sequence can be introduced into a first plant line that is easily transformed, and then hybridized with a second plant line to infiltrate the recombinant DNA construct or sequence into the second plant line. The offspring of these hybrids can be backcrossed into more desirable lines multiple times, such as through 6 to 8 generations or backcrosses, to produce offspring plants with genotypes essentially the same as the original parent lines but with the introduction of recombinant DNA constructs or sequences.

[0124] The transgenic, mutant, or edited plants, plant parts, cells, or explants provided herein may be superior varieties or superior lines. Superior varieties or superior lines are those obtained through breeding and selection for superior agronomic performance. The transgenic, mutant, or edited plants, cells, or explants provided herein may be hybrid plants, cells, or explants. As used herein, a “hybrid” is produced by crossing two plants from different varieties, lines, inbreds, or species so that the offspring contain genetic material from each parent. Those skilled in the art will recognize that higher hybrids can also be produced. For example, a first hybrid can be prepared by crossing variety A with variety B to create an A x B hybrid, and a second hybrid can be prepared by crossing variety C with variety D to create a C x D hybrid. The first and second hybrids can be further crossed to produce a higher hybrid (A x B) x (C x D) containing genetic information from all four parent varieties.

[0125] According to embodiments of this disclosure, a modified plant is provided comprising a GA oxidase repressor element targeting two or more GA oxidase genes, or a combination of two or more GA oxidase repressor elements and / or gene editing or mutation. The recombinant DNA construct or vector may comprise a single cassette or repressor element containing a transcribed DNA sequence designed or selected to encode a non-coding RNA molecule complementary to the recognition or target sequence of mRNAs of two or more GA oxidase genes, including at least a first GA oxidase gene and a second GA oxidase gene—that is, the mRNAs targeting GA oxidase genes share the same or nearly identical (or similar) sequences, such that the single repressor element and the encoded non-coding RNA molecule can target and repress each GA oxidase gene. For example, this document provides an expression cassette and a repressor construct comprising a transcribed DNA sequence encoding a single non-coding RNA molecule targeting and repressing the GA20 oxidase_3 and GA20 oxidase_5 genes.

[0126] According to other embodiments, the recombinant DNA construct or vector may contain two or more repressive elements or sequences, which may be stacked in tandem in a single expression cassette or in two or more expression cassettes. The recombinant DNA construct or vector may contain a single expression cassette or repressive element containing a transcribed DNA sequence encoding a non-coding RNA molecule comprising two or more target sequences arranged in tandem, including at least a first target sequence and a second target sequence, wherein the first target sequence is complementary to an mRNA recognition or target site of a first GA oxidase gene, and the second target sequence is complementary to an mRNA recognition or target site of a second GA oxidase gene, and wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter. The plant-expressible promoter may be a constitutive promoter, or a tissue-specific or tissue-preferred promoter, as provided herein. Non-coding RNA molecules can be expressed as pre-miRNAs, which are processed into two or more mature miRNAs, including at least a first mature miRNA and a second miRNA, wherein the first miRNA contains a targeting sequence complementary to the mRNA recognition or target site of a first GA oxidase gene, and the second miRNA contains a targeting sequence complementary to the mRNA recognition or target site of a second GA oxidase gene.

[0127] According to other embodiments, the recombinant DNA construct or vector may comprise two or more expression cassettes, including a first expression cassette and a second expression cassette. The first expression cassette contains a first transcribed DNA sequence operatively linked to a first plant-expressible promoter, and the second expression cassette contains a second transcribed DNA sequence operatively linked to a second plant-expressible promoter. The first transcribed DNA sequence encodes a first non-coding RNA molecule containing a target sequence complementary to the mRNA recognition or target site of a first GA oxidase gene, and the second transcribed DNA sequence encodes a second non-coding RNA molecule containing a target sequence complementary to the mRNA recognition or target site of a second GA oxidase gene. The first and second plant-expressible promoters may each be constitutive promoters, or tissue-specific or tissue-biased promoters, as provided herein, and the first and second plant-expressible promoters may be the same or different promoters.

[0128] According to other embodiments, two or more repressive elements or constructs targeting the GA oxidase gene and / or GA oxidase gene editing or mutation can be combined in modified plants by hybridizing two or more plants in one or more generations to produce modified plants with the desired combination of repressive elements and / or gene editing or mutation. According to these embodiments, a first modified plant containing a repressive element or construct targeting the GA oxidase gene (or GA oxidase gene editing or mutation) can be hybridized with a second modified plant containing a repressive element or construct targeting the GA oxidase gene (or GA oxidase gene editing or mutation) to produce modified progeny plants containing the first and second repressive elements or constructs, the repressive element or construct and GA oxidase gene editing or mutation, or the first and second GA oxidase gene editing or mutation. Alternatively, a modified plant containing two or more repressive elements or constructs targeting the GA oxidase gene and / or GA oxidase gene editing or mutation can be prepared by: (i) co-transforming a first repressive element or construct and a second repressive element or construct (each targeting the GA oxidase gene for repression); (ii) transforming the modified plant with the second repressive element or construct, wherein the modified plant already contains the first repressive element or construct; (iii) transforming the modified plant with the repressive element or construct, wherein the modified plant already contains the edited or mutated GA oxidase gene; (iv) transforming the modified plant with the construct to produce one or more edits or mutations in the GA oxidase gene, wherein the modified plant already contains the repressive element or construct; or (v) transforming with the construct to produce two or more edits or mutations in the GA oxidase gene.

[0129] According to embodiments of this disclosure, a modified plant comprising two or more constructs targeting and repressing a GA oxidase gene is provided. These constructs include a first recombinant DNA construct and a second recombinant DNA construct. The first recombinant DNA construct contains a first transcribed DNA sequence encoding a first non-coding RNA molecule complementary to a mRNA recognition or target sequence of a first GA oxidase gene. The second recombinant DNA construct contains a second transcribed DNA sequence encoding a second non-coding RNA molecule complementary to a mRNA recognition or target sequence of a second GA oxidase gene. The first and second recombinant DNA constructs may be stacked in a single vector and transformed into a plant as a single event, or they may exist in separate vectors or constructs that can be transformed as separate events. According to these embodiments, the first GA oxidase gene may be a GA20 oxidase_3, GA20 oxidase_5, GA20 oxidase_4, GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3 gene, the first non-coding RNA molecule being complementary to the recognition or target sequence of the mRNA expressed by such GA oxidase gene, and the second GA oxidase gene may be a GA20 oxidase_3, GA20 oxidase_5, GA20 oxidase_4, GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3 gene. According to some embodiments, the first GA oxidase gene and the second GA oxidase gene may be the same or different GA oxidase genes. Alternatively, the second GA oxidase gene may be another GA oxidase gene, such as GA20 oxidase_1, GA20 oxidase_2, GA20 oxidase_6, GA20 oxidase_7, GA20 oxidase_8, or GA20 oxidase_9, and the second non-coding RNA molecule is complementary to the recognition or target sequence of the mRNA expressed by such GA oxidase gene.

[0130] According to embodiments of this disclosure, a modified plant comprising a recombinant DNA construct targeting and repressing a GA oxidase gene is provided. The recombinant DNA construct comprises a transcribed DNA sequence encoding a non-coding RNA molecule. The non-coding RNA molecule comprises two or more target sequences arranged in tandem, including a first target sequence complementary to at least one mRNA recognition or target sequence of a first GA oxidase gene and a second target sequence complementary to one mRNA recognition or target sequence of a second GA oxidase gene. The non-coding RNA molecule may be expressed as a pre-miRNA, which is processed into two or more mature miRNAs, including at least a first mature miRNA and a second miRNA, wherein the first miRNA contains a first target sequence complementary to the mRNA recognition or target site of the first GA oxidase gene, and the second miRNA contains a second target sequence complementary to the mRNA recognition or target site of the second GA oxidase gene. According to these embodiments, the first GA oxidase gene may be a GA20 oxidase_3, GA20 oxidase_5, GA20 oxidase_4, GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3 gene, the first non-coding RNA molecule being complementary to the recognition or target sequence of the mRNA expressed by such GA oxidase gene, and the second GA oxidase gene may be a GA20 oxidase_3, GA20 oxidase_5, GA20 oxidase_4, GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3 gene. According to some embodiments, the first GA oxidase gene and the second GA oxidase gene may be the same or different GA oxidase genes. Alternatively, the second GA oxidase gene may be another GA oxidase gene, such as GA20 oxidase_1, GA20 oxidase_2, GA20 oxidase_6, GA20 oxidase_7, GA20 oxidase_8, or GA20 oxidase_9, and the second non-coding RNA molecule is complementary to the recognition or target sequence of the mRNA expressed by such GA oxidase gene.

[0131] In the above stacking scenarios, and regardless of whether the target sequence is stacked tandemly in a single transcribed DNA sequence (or expression cassette) or stacked in separate transcribed DNA sequences (or expression cassettes), the second GA oxidase gene can be a GA oxidase gene other than GA20 oxidase_3, GA20 oxidase_5, GA20 oxidase_4, GA3 oxidase_1, GA3 oxidase_2, or GA3 oxidase_3, such as GA20 oxidase_1, GA20 oxidase_2, GA20 oxidase_6, GA20 oxidase_7, GA20 oxidase_8, or GA20 oxidase_9 genes. According to these embodiments, the second target sequence of the non-coding RNA molecule may be complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26 or at least 27 consecutive nucleotides of any one or more of SEQ IDNO: 1, 2, 4, 5, 16, 17, 19, 20, 22, 23, 25 and / or 26, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%. According to some implementation schemes, the second target sequence of the non-coding RNA molecule may be complementary to at least 19 but no more than 27 consecutive nucleotides of any one or more of SEQ ID NO: 1, 2, 4, 5, 16, 17, 19, 20, 22, 23, 25 and / or 26, such as to 19, 20, 21, 22, 23, 24, 25, 26 or 27 consecutive nucleotides. According to some implementation schemes, the second target sequence of the non-coding RNA molecule may be complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of any one or more of the same endogenous GA oxidase protein in plants as SEQ ID NO: 3, 6, 18, 21, 24, and / or 27.According to another embodiment, the second targeting sequence of the non-coding RNA molecule may comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to a sequence of ...15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at

[0132] The recombinant DNA molecules or constructs disclosed herein may contain or be contained within a DNA transformation vector for transforming target plant cells, tissues, or explants. Such transformation vectors typically contain sequences or elements essential or beneficial for effective transformation, except for at least one transgenic, expression cassette, and / or transcribed DNA sequence encoding a GA oxidase gene or a non-coding RNA molecule encoding a site-specific nuclease and / or guide RNA for editing an endogenous GA oxidase gene. Agrobacterium Mediated RhizobiumIn bacterial-mediated or other bacterial-mediated transformations, the transformation vector may contain an engineered transfer DNA (or T-DNA) segment or region flanked at at least a transcribed DNA sequence or transgene, having two boundary sequences, namely a left boundary (LB) and a right boundary (RB), such that the insertion of the T-DNA into the plant genome will produce a transformation event involving a transcribed DNA sequence, a transgene, or an expression cassette. Therefore, a transcribed DNA sequence, transgene, or expression cassette encoding a non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, or a site-specific nuclease and / or guide RNA for editing an endogenous GA oxidase gene, may be located between the left and right boundaries of the T-DNA, possibly along with additional transgenes or expression cassettes, such as plant-selective marker transgenes and / or other genes of agronomical interest that can confer agronomically desired traits or phenotypes. According to alternative embodiments, a non-coding RNA molecule encoding a target endogenous GA oxidase gene for repression, or a transcribed DNA sequence, transgene, or expression cassette, and plant-selectable marker transgene (or other genes of agronomic interest) for editing the endogenous GA oxidase gene may be present in separate T-DNA segments on the same or different recombinant DNA molecules, such as for co-transformation. According to some embodiments, the transcribed DNA sequence, transgene, or expression cassette of the recombinant DNA molecule or construct or DNA transformation vector for genome editing may encode one or more guide RNAs and / or site-specific nucleases. The transformation vector or construct may also contain a prokaryotic maintenance element located outside the T-DNA region within the vector.

[0133] The plant selectable marker transgenes in the transformation vectors or constructs disclosed herein can be used to assist in the selection of transformed cells or tissues by means of a selector such as an antibiotic or herbicide, wherein the plant selectable marker transgene provides tolerance or resistance to the selector. Thus, the selector can favor or benefit the survival, development, growth, proliferation, etc., of transformed cells expressing the plant selectable marker gene, such as increasing the proportion of transformed cells or tissues in an R0 plant. Commonly used plant selectable marker genes include, for example, those conferring resistance to antibiotics such as kanamycin and paromomycin. nptII Hygromycin B aph IV ), streptomycin or spectinomycin ( aadA ) and gentamicin (gentamycin) aac3 and aacC4 Those that exhibit tolerance or resistance, or confer resistance to herbicides such as glufosinate (… bar or pat ), dicamba ( DMO ) and glyphosate ( aroA or EPSPS Those that exhibit tolerance or resistance. Plant-selectable marker genes, such as luciferase or green fluorescent protein (GFP), or genes expressing their various chromogenic substrates, are known to be β-glucuronidase, can also be used to provide the ability to visually screen transformants. uidA Gene (GUS). In some embodiments, the vector or polynucleotide provided herein contains at least one selectable marker gene selected from the group consisting of: nptII , aph IV , aadA , aac3, aacC4, bar, pat, DMO, EPSPS, aroA, GFP and GUS. Plant transformation can also occur in the absence of selection during one or more steps or stages of culturing transformed explants, tissues, plants and / or plant parts to allow them to develop or regenerate.

[0134] According to embodiments of the present invention, methods for transforming plant cells, tissues, or explants with recombinant DNA molecules or constructs may further include site-directed or targeted integration. According to these methods, a portion of a recombinant DNA donor template molecule (i.e., the insert sequence) may be inserted or integrated into a desired site or locus within the plant genome. The insert sequence of the donor template may contain a transgene or construct, such as a transgene encoding a non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, or a transcribed DNA sequence. The donor template may also have one or two homologous arms flanking the insert sequence to facilitate targeted insertion events through homologous recombination and / or homologous directed repair. Each homologous arm may be identical or complementary to at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 200%, at least 250%, at least 500%, at least 1000, at least 2500, or at least 5000 consecutive nucleotides of a target DNA sequence within the genome of a monocotyledonous or cereal plant. Therefore, the recombinant DNA molecule of this disclosure may contain a donor template for the site-directed or targeted integration of a transgene or construct (such as a transgene or transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses an endogenous GA oxidase gene) into the plant genome.

[0135] Any site or locus within the plant genome can potentially be selected for site-directed integration of the transgenic, construct, or transcribed DNA sequence provided herein. For site-directed integration, a double-strand break (DSB) or nick can first be generated at the selected genomic locus using a site-specific nuclease such as a zinc finger nuclease, an engineered or naturally occurring wide-ranging nuclease, a TALE endonuclease, or an RNA-guided endonuclease (e.g., Cas9 or Cpf1). Any method known in the art for site-directed integration can be used. In the presence of a donor template molecule with the insert sequence, the DSB or nick can then be repaired by homologous recombination between one or more homologous arms of the donor template and the plant genome, or by non-homologous end joining (NHEJ), resulting in the site-directed integration of the insert sequence into the plant genome to create a targeted insertion event at the site of the DSB or nick. Thus, site-specific insertion or integration of transgenic, construct, or sequence can be achieved.

[0136] The introduction of DSBs or notches can also be used to introduce targeted mutations in the plant genome. According to this method, mutations such as deletions, insertions, inversions, and / or substitutions can be introduced at the target site through incomplete repair of the DSB or notch to produce a knockout or knockdown of the GA oxidase gene. Such mutations can be generated even without the use of a donor template molecule through incomplete repair of the target locus. A “knockout” of the GA oxidase gene can be achieved by inducing a DSB or notch at or near an endogenous locus of the GA oxidase gene, resulting in the non-expression or expression of a non-functional protein of the GA oxidase; similarly, a “knockdown” of the GA oxidase gene can be achieved by inducing a DSB or notch at or near an endogenous locus of the GA oxidase gene, which is incompletely repaired at a site that does not affect the coding sequence of the GA oxidase gene in a manner that would eliminate the function of the edited GA oxidase protein. For example, the DSB or nick site within an endogenous locus may be upstream of or in the 5' region of the GA oxidase gene (e.g., promoter and / or enhancer sequences) to affect or reduce its expression level. Similarly, such targeted knockout or knockdown mutations of the GA oxidase gene can be generated using a donor template molecule to guide a specific or desired mutation at or near the target site via DSB or nick repair. The donor template molecule may contain homologous sequences, with or without insert sequences, and contain one or more mutations relative to the target genomic sequence at or near the DSB or nick site, such as one or more deletions, insertions, inversions, and / or substitutions. For example, a targeted knockout mutation of the GA oxidase gene can be achieved by deleting or inverting at least a portion of the gene or by introducing a frameshift or early stop codon into the coding sequence of the gene. Deletion of a portion of the GA oxidase gene can also be introduced by generating DSBs or nicks at two target sites and causing deletion of an intercalary target region flanked by the target site.

[0137] The site-specific nucleases provided in this article can be selected from the group consisting of zinc finger nucleases (ZFNs), broad-spectrum nucleases, RNA-guided endonucleases, TALE-endonucleases (TALENs), recombinases, transposases, or any combination thereof. See, for example, Khandagale, K. et al., “Genome editing for targeted improvement in plants,” Plant Biotechnol Rep 10: 327-343 (2016); and Gaj, T. et al., “ZFN, TALEN and CRISPR / Cas-based methods for genome engineering,” Trends Biotechnol. 31(7):397-405 (2013), the contents and publication of which are incorporated herein by reference. The recombinase may be a serine recombinase linked to a DNA recognition motif, a tyrosine recombinase linked to a DNA recognition motif, or other recombinases known in the art. The recombinase or transposase may be a DNA transposase or recombinase linked to a DNA-binding domain. The tyrosine recombinase linked to a DNA recognition motif may be selected from the group consisting of Cre recombinase, Flp recombinase, and Tnp1 recombinase. According to some embodiments, the Cre recombinase or Gin recombinase provided herein is tethered to a zinc finger DNA-binding domain. In another embodiment, the serine recombinase linked to a DNA recognition motif provided herein is selected from the group consisting of PhiC31 integrase, R4 integrase, and TP-901 integrase. In another embodiment, the DNA transposase linked to a DNA-binding domain provided herein is selected from the group consisting of TALE-piggyBac and TALE- mutants.

[0138] According to some embodiments of this disclosure, the RNA-directed endonuclease can be selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, CasX, CasY and their homologs or modified forms, Argonaute (non-limiting examples of Argonaute proteins include thermophilic bacteria) Thermus thermophilus Argonaute (TtAgo), Thermococcus fibrillosa ( Pyrococcus furiosus Argonaute (PfAgo), Halophilic bacillus griseus ( Natronobacterium gregoryi Argonaute (NgAgo) and its homologs or modified forms). According to some implementation schemes, the RNA-guided endonuclease can be a Cas9 or Cpf1 enzyme.

[0139] On the one hand, the site-specific nucleases provided in this article are selected from the group consisting of: zinc finger nucleases, broad-spectrum nucleases, RNA-guided nucleases, TALE-nucleases, recombinases, transposases, or any combination thereof. On the other hand, the site-specific nucleases provided in this article are selected from the group consisting of Cas9 or Cpf1. On the other hand, the site-specific nucleases provided in this paper are selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, CasX, CasY, their homologs, or their modified forms. On the other hand, the RNA-guided nucleases provided in this article are selected from the group consisting of Cas9 or Cpf1. On the other hand, the RNA-guided nucleases provided in this article are selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, CasX, CasY, their homologs, or their modified forms. In another aspect, the methods and / or compositions provided herein comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten site-specific nucleases. In yet another aspect, the methods and / or compositions provided herein comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten polynucleotides encoding at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten site-specific nucleases.

[0140] For RNA-guided endonucleases, guide RNA (gRNA) molecules are also provided to direct the endonuclease to a target site in the plant genome via base pairing or hybridization to cause a DSB or nick at or near the target site. The gRNA can be in gRNA molecule form or in the form of a recombinant DNA molecule, construct, or vector containing a transcribed DNA sequence encoding a guide RNA operably linked to a plant-expressible promoter, transformed or introduced into plant cells or tissues (perhaps together with the nuclease or nuclease-encoding DNA molecule, construct, or vector). As understood in the art, “guide RNA” can include, for example, CRISPR RNA (crRNA), single-stranded guide RNA (sgRNA), or any other RNA molecule that can guide or direct an endonuclease to a specific target site in the genome. A “single-stranded guide RNA” (or “sgRNA”) is an RNA molecule containing crRNA covalently linked to tracrRNA by an adapter sequence, which can be expressed as a single RNA transcript or molecule. The guide RNA contains the same or complementary guide or target sequence as a target site within the plant genome, such as at or near the GA oxidase gene. The protospacer adjacent motif (PAM) can be located in the genome, immediately adjacent to the 5' end of a genomic target sequence complementary to the target sequence of the guide RNA and upstream thereupon—that is, immediately downstream (3') of the sense (+) strand of the genomic target site (relative to the target sequence of the guide RNA), as is known in the art. See, for example, Wu, X. et al., “Target specificity of the CRISPR-Cas9 system,” Quant Biol.2(2): 59-70 (2014), the contents and publication details of which are incorporated herein by reference. The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the target sequence of the guide RNA) may contain 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the target sequence of the guide RNA) may generally not be complementary to the genomic PAM sequence. The guide RNA may generally be a non-coding RNA molecule that does not encode a protein. The guide sequence of the guide RNA may be at least 10 nucleotides in length, such as 12-40 nucleotides, 12-30 nucleotides, 12-20 nucleotides, 12-35 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, or 17-25 nucleotides, or about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides in length. The guide sequence may be identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides at the genomic target site, which are at least 95%, at least 96%, at least 97%, at least 99% or 100%.

[0141] For gene editing at or near the GA20 oxidase_3 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used, wherein the guide sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides) of SEQ ID NO: 34 or its complementary sequence. For gene editing at or near the GA20 oxidase_5 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used, wherein the guide sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides) of SEQ ID NO: 35 or its complementary sequence. As used in this article, the term "continuous" in relation to polynucleotide or protein sequences means that there are no deletions or gaps in the sequence.

[0142] For knockdown (and possibly knockout) mutations performed through genome editing, RNA-guided endonucleases can target upstream or downstream sequences of the GA20 oxidase_3 or GA20 oxidase_5 gene, such as promoter and / or enhancer sequences, or introns, 5'UTR, and / or 3'UTR sequences, to mutate one or more promoter and / or regulatory sequences of the gene and affect or reduce its expression level. For knockdown (and possible knockout) of the GA20 oxidase_3 gene in maize, a guide RNA containing a guide sequence may be used, which comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence ranges 1-3096, 3666-3775, 4098-5314, 5585-5800, or 5801-8800 of SEQ ID NO: 34 or their complements (e.g., SEQ ID NO: 34). The nucleotide sequence of 34 (range 1-3096, 3666-3775, 4098-5314, 5585-5800, 5801-8800 or 5585-8800, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides) within its complementary sequence are at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0143] For knockdown (and possible knockout) of the GA20 oxidase_5 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 35) within the nucleotide sequence ranges 1-3000, 3792-3906, 4476-5197, or 5860-8859 of SEQ ID NO: 35, or their complementary sequences. The nucleotide sequence of 35 (ranging from 1-3000, 3792-3906, 4476-5197 or 5860-8859, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0144] For knockout (and potentially knockdown) mutations achieved through genome editing, RNA-guided endonucleases can target the coding and / or intron sequences of the GA20 oxidase_3 or GA20 oxidase_5 genes to potentially eliminate the expression and / or activity of the functional GA oxidase protein of that gene. However, in some cases, knockout of GA oxidase gene expression can also be achieved by targeting upstream and / or 5' UTR sequences of the gene, or other sequences at or near the gene's genomic locus. Therefore, knockout of GA oxidase gene expression can be achieved by targeting genomic sequences at or near the targeted GA20 oxidase_3 or GA20 oxidase_5 gene locus, or upstream or downstream sequences of the GA20 oxidase_3 or GA20 oxidase_5 gene (such as promoter and / or enhancer sequences, or introns, 5' UTR, and / or 3' UTR sequences), as described above for knockdown of the GA20 oxidase_3 or GA20 oxidase_5 gene.

[0145] For knockout (and possibly knockdown) of the GA20 oxidase_3 gene in maize, a guide RNA containing a guide sequence may be used, which is at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence range 3097-5584, 3097-3665, 3776-4097, or 5315-5584 of SEQ ID NO: 34, or their complementary sequence (e.g., SEQ ID NO: 34). The nucleotide sequence of 34 (3097-5584, 3097-3665, 3097-3775, 3665-4097, 3776-4097, 3776-5314, 4098-5584 or 5315-5584, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0146] For knockout (and possibly knockdown) of the GA20 oxidase_5 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 35) within the nucleotide sequence ranges 3001-5473, 3001-3791, 3907-4475, or 5198-5473 of SEQ ID NO: 35, or their complementary sequences. The nucleotide sequence of 35 (range 3001-5473, 3001-3791, 3001-3906, 3792-4475, 3907-4475, 3907-5197, 4476-5473 or 5198-5473, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0147] According to some embodiments, guide RNAs for targeting endogenous GA20 oxidase_3 and / or GA20 oxidase_5 genes are provided, comprising a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleotides of any one or more of SEQ ID NO: 138-167.

[0148] For gene editing at or near the GA20 oxidase_4 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used, wherein the guide sequence is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides) of SEQ ID NO: 38 or its complementary sequence.

[0149] For knockout (and possibly knockdown) mutations performed through genome editing, RNA-guided endonucleases can target the coding and / or intron sequences of the GA20 oxidase_4 gene to potentially eliminate the expression and / or activity of the functional GA20 oxidase_4 protein. For the GA20 oxidase_4 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: ) within the nucleotide sequence range 1544-2852, SEQ ID NO: 38, the nucleotide sequence range 1544-1995, the nucleotide sequence range 2084-2411, or the nucleotide sequence range 2517-2852 of SEQ ID NO: 38, or their complementary sequences. The nucleotide sequence of 38 (range 1544-2852, 1544-1995, 1544-2083, 1996-2411, 2084-2411, 2084-2516, 2412-2852 or 2517-2852, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0150] For knockdown (and possibly knockout) mutations performed through genome editing, RNA-guided endonucleases can target upstream or downstream sequences of the GA20 oxidase_4 gene, such as promoter and / or enhancer sequences, or introns, 5'UTR, and / or 3' UTR sequences, to mutate one or more promoter and / or regulatory sequences of the gene and affect or reduce its expression level. For knockdown of the GA20 oxidase_4 gene in maize, a guide RNA containing a guide sequence can be used. This guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence ranges 1-1416, 1417-1543, 1996-2083, 2412-2516, 2853-3066, or 3067-4465 of SEQ ID NO: 38 or their complementary sequences (e.g., SEQ ID NO: 38). The nucleotide sequence of 38 (1-1416, 1417-1543, 1-1543, 1996-2083, 2412-2516, 2853-3066, 3067-4465 or 2853-4465, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0151] For genome editing at or near the GA3 oxidase_1 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides of SEQ ID NO: 168 or its complementary sequence). For genome editing at or near the GA3 oxidase_2 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides of SEQ ID NO: 169 or its complementary sequence). For genome editing at or near the GA3 oxidase_3 gene using RNA-guided endonucleases, a guide RNA containing a guide sequence may be used that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more consecutive nucleotides (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more consecutive nucleotides of SEQ ID NO: 170 or its complementary sequence).

[0152] For knockout (and possibly knockdown) mutations performed through genome editing, RNA-guided endonucleases can target the coding and / or intron sequences of the GA3 oxidase-1 gene to potentially eliminate the expression and / or activity of the functional GA3 oxidase-1 protein. For the GA3 oxidase_1 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 168) within the nucleotide sequence ranges 3162-4795, 3162-3646, 4012-4170, or 4291-4795 of SEQ ID NO: 168, or their complementary sequences. The nucleotide sequence of 168 (range 3001-3646, 3162-3646, 3162-4011, 3647-4170, 4012-4170, 4012-4290, 4171-4795, 4291-4795, 4291-5406 or 3162-4795, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.For the GA3 oxidase_1 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 36) within the nucleotide sequence range 30-1663, SEQ ID NO: 36 ... The nucleotide sequence of 36 (1-514, 30-514, 30-879, 515-1038, 880-1038, 880-1158, 1039-1663, 1159-1663, 1159-1788 or 30-1663, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.For the GA3 oxidase_1 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 174) within the nucleotide sequence ranges 8030-9671, 8030-8514, 8888-9046, or 9167-9671 of SEQ ID NO: 174, or their complementary sequences. The nucleotide sequence of 174 (7621-8514, 8030-9671, 8030-8887, 8515-9046, 8888-9046, 8888-9166, 9047-9671, 9167-9671, 9167-10276 or 8030-9671, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0153] For knockdown (and possibly knockout) mutations performed through genome editing, RNA-guided endonucleases can target upstream, downstream, or non-coding sequences of the GA3 oxidase-1 gene, such as promoter and / or enhancer sequences, or introns, 5' UTR, and / or 3' UTR sequences, to mutate one or more promoter and / or regulatory sequences of the gene and affect or reduce its expression level. For knockdown of the GA3 oxidase_1 gene in maize, a guide RNA containing a guide sequence can be used. This guide sequence consists of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence ranges 1-3161, 3001-3161, 3647-4011, 4171-4290, 4796-5406, or 4796-8406 of SEQ ID NO: 168, or their complementary sequences (e.g., SEQ ID NO: 168). ID NO: 168 has a nucleotide sequence range of 1-3000, 3001-3161, 1-3161, 3647-4011, 4171-4290, 4796-5406, 5407-8406 or 4796-8406, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence, which are at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0154] For knockout (and possibly knockdown) mutations performed through genome editing, RNA-guided endonucleases can target the coding and / or intron sequences of the GA3 oxidase_2 gene to potentially eliminate the expression and / or activity of the functional GA3 oxidase_2 protein. For the GA3 oxidase_2 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: ) within the nucleotide sequence range 3057-4463, SEQ ID NO: 169, SEQ ID NO: 3057-3550, SEQ ID NO: 169, SEQ ID NO: 3711-3869, or SEQ ID NO: 169, SEQ ID NO: 3992-4463 or their complementary sequence. The nucleotide sequence of 169 (range 3057-4463, 3057-3550, 3057-3710, 3551-3869, 3711-3869, 3711-3991, 3870-4463 or 3992-4463, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.For the GA3 oxidase_2 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 37) within the nucleotide sequence ranges 39-1445, 39-532, 693-851, or 983-1445 of SEQ ID NO: 37 or their complementary sequences. The nucleotide sequence of 37 (1-532, 39-532, 39-692, 533-851, 693-851, 693-982, 852-1445, 983-1445, 983-1698 or 39-1445, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.For the GA3 oxidase_2 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 7832-8861, SEQ ID NO: 175, SEQ ID NO: 8087-8245, or SEQ ID NO: 8372-8861 or their complementary sequences) of the range 7832-8861, SEQ ID NO: 175 ... The nucleotide sequence of 175 (7386-7926, 7832-7926, 7832-8086, 7927-8245, 8087-8245, 8087-8371, 8246-8861, 8372-8861, 8372-8967 or 7832-8861, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0155] For knockdown (and possibly knockout) mutations performed through genome editing, RNA-guided endonucleases can target upstream, downstream, or non-coding sequences of the GA3 oxidase_2 gene, such as promoter and / or enhancer sequences, or introns, 5' UTR, and / or 3' UTR sequences, to mutate one or more promoter and / or regulatory sequences of the gene and affect or reduce its expression level. For knockdown of the GA3 oxidase_2 gene in maize, a guide RNA containing a guide sequence can be used. This guide sequence consists of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence ranges 1-3056, 3001-3056, 3551-3710, 3870-3991, 4464-4581, or 4464-7581 of SEQ ID NO: 169, or their complementary sequences (e.g., SEQ ID NO: 169). The nucleotide sequence of ID NO: 169 is 1-3000, 3001-3056, 1-3056, 3551-3710, 3870-3991, 4464-4581, 4464-7581 or 4582-7581, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence, and is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0156] For knockout (and possibly knockdown) mutations performed through genome editing, RNA-guided endonucleases can target the coding and / or intron sequences of the GA3 oxidase_3 gene to potentially eliminate the expression and / or activity of the functional GA3 oxidase_3 protein. For the GA3 oxidase_3 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 3131-4274, SEQ ID NO: 170, SEQ ID NO: 3131-3483, SEQ ID NO: 170, SEQ ID NO: 3583-3907, or SEQ ID NO: 170, SEQ ID NO: 3999-4274, or their complementary sequences) within the range of nucleotides 3131-4274, 3131-3483, 3583-3907, or 3999-4274, or their complementary sequences. The nucleotide sequence of 170 (range 3131-4274, 3131-3483, 3131-3582, 3484-3907, 3583-3907, 3583-3998, 3908-4274 or 3999-4274, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.For the GA3 oxidase_3 gene in maize, a guide RNA containing a guide sequence may be used, wherein the guide sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides (e.g., SEQ ID NO: 7752-8903, SEQ ID NO: 176 ... The nucleotide sequence of 176 (7547-8104, 7752-8104, 7752-8205, 8105-8530, 8206-8530, 8206-8621, 8531-8903, 8622-8903, 8622-9178 or 7752-8903, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence) is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0157] For knockdown (and possibly knockout) mutations performed through genome editing, RNA-guided endonucleases can target upstream, downstream, or non-coding sequences of the GA3 oxidase_3 gene, such as promoter and / or enhancer sequences, or introns, 5' UTR, and / or 3' UTR sequences, to mutate one or more promoter and / or regulatory sequences of the gene and affect or reduce its expression level. For knockdown of the GA3 oxidase_3 gene in maize, a guide RNA containing a guide sequence can be used. This guide sequence consists of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides within the nucleotide sequence ranges 1-3130, 3001-3130, 3484-3582, 3908-3998, 4275-4332, or 4275-7332 of SEQ ID NO: 170, or their complementary sequences (e.g., SEQ ID NO: 170). ID NO: 170 has a nucleotide sequence range of 1-3000, 3001-3130, 1-3130, 3484-3582, 3908-3998, 4275-4332, 4275-7332 or 4333-7332, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more consecutive nucleotides within its complementary sequence, which are at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary.

[0158] In addition to the guide sequence, the guide RNA may also contain one or more other structural or scaffold sequences that can bind to or interact with RNA-guided endonucleases. Such scaffold or structural sequences may further interact with other RNA molecules (e.g., tracrRNA). Methods and techniques for designing targeting constructs and guide RNAs for genome editing and site-specific integration using RNA-guided endonucleases at target sites within the plant genome are known in the art.

[0159] According to some implementation schemes, mutant alleles of the endogenous GA3 oxidase gene in maize plants with reduced mRNA and / or protein expression can be created via targeted genome editing or mutagenesis techniques as provided herein to produce one or more edits or mutations in the upstream and / or promoter regions of the endogenous GA3 oxidase gene. Such edits or mutations may include various deletions, insertions, inversions, and / or substitutions, or combinations thereof, in the upstream and / or promoter regions of the endogenous GA3 oxidase gene to reduce or eliminate the expression and / or activity levels of the endogenous GA3 oxidase gene. In some implementations, mutations or editing in the upstream and / or promoter regions of the endogenous GA3 oxidase gene, compared to the wild-type allele of the endogenous GA3 oxidase gene, can reduce but not eliminate the expression and / or activity levels of the endogenous GA3 oxidase gene, thus producing a sub-effective or partial loss-of-function mutant allele of the endogenous GA3 oxidase gene. Compared to null or complete loss-of-function mutant alleles of the endogenous GA3 oxidase gene, the sub-effective or partial loss-of-function mutant allele can also provide a more intermediate phenotype or trait in modified maize plants where the sub-effective mutant allele is homozygous, and the null or complete loss-of-function mutant allele can produce a stronger or more severe phenotype or trait in modified maize plants where the null mutant allele is homozygous.

[0160] According to some embodiments, a mutant allele of the endogenous GA3 oxidase gene in maize plants with reduced mRNA and / or protein expression can be created via targeted genome editing or mutagenesis techniques as provided herein to introduce a reverse DNA segment into a non-coding sequence (e.g., an untranslated region (UTR) or intron sequence) of the transcribed DNA sequence of the endogenous GA3 oxidase gene. This reverse DNA segment encodes an antisense RNA sequence complementary to the transcribed DNA region of the wild-type allele of the endogenous GA3 oxidase gene and / or to the mRNA molecule encoded by the wild-type allele of the endogenous GA3 oxidase gene, and the mutant allele of the endogenous GA3 oxidase gene encodes an mRNA transcript containing this antisense RNA sequence. By having a reverse DNA segment in the transcribed DNA region of the mutant allele of the endogenous GA3 oxidase gene, the antisense RNA sequence encoded by the reverse DNA segment can hybridize with a sense RNA sequence complementary to the mRNA encoded by the wild-type allele of the endogenous GA3 oxidase gene. Therefore, in modified maize plants where the mutant allele of the endogenous GA3 oxidase gene containing the inverted DNA segment is heterozygous, the antisense RNA sequence of the mRNA encoded by the mutant allele of the endogenous GA3 oxidase gene can hybridize with the sense RNA sequence of the mRNA encoded by the wild-type allele of the endogenous GA3 oxidase gene, triggering RNA repression of the endogenous GA3 oxidase gene to reduce its expression level and / or activity in the modified maize plants. However, modified maize plants where the mutant allele of the endogenous GA3 oxidase gene containing the inverted DNA segment is homozygous will not possess the wild-type allele of the endogenous GA3 oxidase gene, and therefore, the mRNA transcripts expressed by the endogenous GA3 oxidase gene in modified maize plants will not contain a sense RNA sequence that can hybridize with the antisense RNA sequence expressed by the mutant allele of the endogenous GA3 oxidase gene and trigger repression. Therefore, RNA repression is not expected to occur in modified maize plants that are homozygous for the mutant allele with the inversion, but only in heterozygotes. Because the mutant allele of the endogenous GA3 oxidase gene has an inverted DNA segment in the non-coding portion of the transcribed DNA region, the amino acid coding (exon) sequence of the endogenous GA3 oxidase gene will not be disrupted, and the mutant allele of the endogenous GA3 oxidase gene may still be able to express the functional protein without repressing the gene in homozygotes.

[0161] For example, Figure 14 This illustrates the different conjugations of inversion editing in the 3' UTR of the Zm.GA3ox_1 gene, where hybridization between complementary UTR sequences of wild-type and inversion-edited alleles leads to RNA repression or silencing of the Zm.GA3ox_1 gene only in heterozygous plants. Figure 14C), this can, for example, result from a hybridization between a modified parent plant carrying edited alleles and another wild-type plant. However, when the plant is resistant to the wild-type alleles ( Figure 14 A) or inversion editing alleles ( Figure 14 When B) is homozygous, there will be no hybridization of complementary sequences and no RNA repression or silencing of the Zm.GA3ox_1 gene. Inversion editing can also be performed in the 5' UTR of the Zm.GA3ox_1 gene to produce a similar effect on Zm.GA3ox_1 gene expression (not shown).

[0162] This type of gene modification (i.e., inversions or reversed DNA segments in the non-coding sequence or portion of a gene's transcribed DNA sequence) may be particularly useful for certain genes known to produce too strong or too severe phenotypes or traits in plants with homozygous loss-of-function mutant alleles, regardless of whether the desired or wild-type phenotype or trait is observed in heterozygous mutant alleles. Conversely, for heterozygous mutant alleles containing antisense inversions, gene expression levels and / or activity can be attenuated or reduced to provide less severe, milder, and more desirable phenotypes or traits in heterozygous plants, and for homozygous mutant alleles, the wild-type phenotype will be expressed in the absence of RNA repression of the gene.

[0163] According to some embodiments, recombinant DNA constructs and vectors are provided that contain a polynucleotide sequence encoding a site-specific nuclease, such as a zinc finger nuclease (ZFN), a broad-spectrum nuclease, an RNA-guided endonuclease, a TALE endonuclease (TALEN), a recombinase, or a transposase, wherein the coding sequence is operatively ligated to a plant-expressible promoter. For RNA-guided endonucleases, recombinant DNA constructs and vectors are also provided that contain a polynucleotide sequence encoding a guide RNA, wherein the guide RNA contains a guide sequence of sufficient length to have a percentage of identity or complementarity with a target site within the plant genome (such as at or near a GA oxidase gene). According to some embodiments, the polynucleotide sequence of the recombinant DNA construct and vector encoding a site-specific nuclease or guide RNA can be operatively ligated to a plant-expressible promoter, such as an inducible promoter, a constitutive promoter, or a tissue-specific promoter.

[0164] According to some embodiments, the recombinant DNA construct or vector may comprise a first polynucleotide sequence encoding a site-specific nuclease and a second polynucleotide sequence encoding a guide RNA, which can be introduced into plant cells together with plant transformation technology. Alternatively, two recombinant DNA constructs or vectors may be provided, which can be introduced into plant cells together or sequentially with plant transformation technology, including a first recombinant DNA construct or vector and a second DNA construct or vector, wherein the first recombinant DNA construct or vector comprises a polynucleotide sequence encoding a site-specific nuclease, and the second recombinant DNA construct or vector comprises a polynucleotide sequence encoding a guide RNA. According to some embodiments, the recombinant DNA construct or vector comprising the polynucleotide sequence encoding a site-specific nuclease can be introduced into plant cells that already contain a recombinant DNA construct or vector containing a polynucleotide sequence encoding a guide RNA (or transformed with a recombinant DNA construct or vector containing a polynucleotide sequence encoding a guide RNA) via plant transformation technology. Alternatively, a recombinant DNA construct or vector containing a polynucleotide sequence encoding a guide RNA can be introduced into plant cells containing a recombinant DNA construct or vector with a polynucleotide sequence encoding a site-specific nuclease (or transformed with a recombinant DNA construct or vector containing a polynucleotide sequence encoding a site-specific nuclease) via plant transformation technology. According to another embodiment, a first plant containing a recombinant DNA construct or vector with a polynucleotide sequence encoding a site-specific nuclease (or transformed with such a recombinant DNA construct or vector) can be hybridized with a second plant containing a recombinant DNA construct or vector with a polynucleotide sequence encoding a guide RNA (or transformed with such a recombinant DNA construct or vector). Such recombinant DNA constructs or vectors can be transiently transformed into plant cells or stably transformed or integrated into the genome of plant cells.

[0165] On the one hand, through transformation methods known in the art (e.g., but not limited to, particle bombardment, PEG-mediated protoplast transfection, or... Agrobacterium (Mediated transformation) provides plant cells with a vector containing a site-specific nuclease and optionally one, two or more, three or more, or four or more gRNAs. In one aspect, this is achieved through transformation methods known in the art (e.g., not limited to particle bombardment, PEG-mediated protoplast transfection, or... earth Rhizobium PEG-mediated transformation provides plant cells with a vector containing a polynucleotide encoding the Cas9 nuclease and optionally one, two, three, or four or more gRNAs. Alternatively, transformation can be performed using methods known in the art (e.g., not limited to viral transfection, particle bombardment, PEG-mediated protoplast transfection, or...). Agrobacterium(Mediated transformation) provides cells with a vector containing a polynucleotide encoding Cpf1 and optionally one, two or more, three or more, or four or more crRNAs.

[0166] Several site-specific nucleases, such as recombinases, zinc finger nucleases (ZFNs), broad-spectrum nucleases, and TALENs, are not RNA-guided but rely on their protein structure to determine their target sites to induce DSBs or nicks, or they are fused, tethered, or linked to DNA-binding protein domains or motifs. The protein structure of the site-specific nuclease (or the fused / linked / tethered DNA-binding domain) allows the site-specific nuclease to target the target site. According to many embodiments of these implementations, non-RNA-guided site-specific nucleases, such as recombinases, zinc finger nucleases (ZFNs), broad-spectrum nucleases, and TALENs, can be designed, engineered, and constructed using known methods to target and bind to genomic loci of endogenous GA oxidase genes in maize or cereal plants (such as the GA20 oxidase_3 gene, GA20 oxidase_5 gene, or GA3 oxidase gene in maize) to generate DSBs or nicks at such genomic loci, thereby knocking out or downregulating GA oxidase gene expression through DSB or nick repair. For example, engineered site-specific nucleases, such as recombinases, zinc finger nucleases (ZFNs), broad-spectrum nucleases, or TALENs, can be designed to target and bind to (i) target sites within the plant genome corresponding to the sequence in SEQ ID NO: 34 or its complementary sequence, to generate a DSB or nick at the genomic locus of the GA20 oxidase_3 gene; (ii) target sites within the plant genome corresponding to the sequence in SEQ ID NO: 35 or its complementary sequence, to generate a DSB or nick at the genomic locus of the GA20 oxidase_5 gene; (iii) target sites within the plant genome corresponding to the sequence in SEQ ID NO: 38 or its complementary sequence, to generate a DSB or nick at the genomic locus of the GA20 oxidase_4 gene; (iv) target sites within the plant genome corresponding to the sequences in SEQ ID NO: 36, 168, and / or 174 or their complementary sequences, to generate a DSB or nick at the genomic locus of the GA3 oxidase_1 gene; and (v) target sites within the plant genome corresponding to the sequence in SEQ ID NO: 36, 168, and / or 174 or their complementary sequences, to generate a DSB or nick at the genomic locus of the GA3 oxidase_1 gene. (vi) Target sites corresponding to sequences in SEQ ID NO: 170 and / or 176 or their complementary sequences, to generate a DSB or cut at a genomic locus of the GA3 oxidase_2 gene, or (vi) target sites within the plant genome corresponding to sequences in SEQ ID NO: 170 and / or 176 or their complementary sequences, to generate a DSB or cut at a genomic locus of the GA3 oxidase_3 gene, which may then lead to a mutation or insertion of a sequence at the site of the DSB or cut via a cellular repair mechanism that can be guided by a donor molecule or template.

[0167] In one aspect, the targeted genome editing techniques described herein may include the use of recombinases. In some embodiments, the tyrosine recombinase linked to a DNA recognition domain or motif, etc., may be selected from the group consisting of Cre recombinases, Flp recombinases, and Tnp1 recombinases. In one aspect, the Cre recombinase or... Gin Recombinases can tether to zinc finger DNA-binding domains. Flp- FRT Site-specific recombination systems can be derived from baker's yeast and brewer's yeast ( Saccharomyces cerevisiae The 2μ plasmid obtained. In this system, Flp recombinase (reversal enzyme) enables the reversal enzyme to recognize the target ( FRT Sequence recombination between sites. FRT The site contains 34 nucleotides. Flp can bind FRT The site's "arm" (one arm is in opposite orientation) is cleaved at either end of the intercalated nucleic acid sequence. FRT Site. After cleavage, Flp can make two FRT Nucleic acid sequence recombination between sites. Cre-lox is a type of phage derived from P1 and associated with Flp- FRT This recombination system is similar to a site-directed recombination system. Cre-lox can be used to reverse, delete, or transpose nucleic acid sequences. In this system, Cre recombinase enables the recombination of a pair of lox nucleic acid sequences. A lox site contains 34 nucleotides, with the first 13 nucleotides and the last 13 nucleotides (arms) being palindromic. During recombination, the Cre recombinase protein binds to two lox sites on different nucleic acids and cleaves them at those lox sites. The cleaved nucleic acids are spliced ​​together (reciprocal transposition) to complete the recombination. Alternatively, the lox sites provided herein are loxP, lox 2272, loxN, lox 511, lox 5171, lox71, lox66, M2, M3, M7, or M11.

[0168] ZFN is a synthetic protein composed of an engineered zinc finger DNA-binding domain fused to a cleavage domain (or a cleavage half-domain), which may be derived from a restriction endonuclease (e.g., FokI The DNA-binding domain can be typical (C2H2) or atypical (e.g., C3H or C4). Depending on the target site, the DNA-binding domain may contain one or more zinc fingers (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or more zinc fingers). Multiple zinc fingers in the DNA-binding domain may be separated by one or more adapter sequences. By modifying the zinc finger DNA-binding domain, ZFNs can be designed to cleave almost any segment of double-stranded DNA. ZFNs cleave nonspecific DNA cleavage domains fused to the DNA-binding domain (e.g., derived from...) FokIThe monomers of a ZFN (a type of nuclease) form a dimer, and the DNA-binding domain comprises an array of zinc fingers engineered to bind to a target site DNA sequence. The DNA-binding domain of a ZFN may typically consist of 3-4 (or more) zinc fingers. Amino acids at positions -1, +2, +3, and +6 relative to the start of the α-helix of the zinc fingers can be modified and customized to promote site-specific binding to a specific target sequence. Other amino acids may form a common backbone to produce ZFNs with different sequence specificities. Methods and rules for designing ZFNs to target and bind specific target sequences are known in the art. See, for example, U.S. Patent Applications 2005 / 0064474, 2009 / 0117617, and 2012 / 0142062, the contents and disclosure of which are incorporated herein by reference. FokI Nuclease domains may require dimerization to cleave DNA, and therefore, two ZFNs with their C-terminal regions are needed to bind to the opposing DNA strands (5-7 bp apart) at the cleavage site. If the two ZF binding sites are palindromic, the ZFN monomer can cleave the target site. As used herein, ZFN is used broadly and includes monomeric ZFNs that can cleave double-stranded DNA without the assistance of another ZFN. The term ZFN can also be used to refer to one or both members of a pair of ZFNs engineered to work together to cleave DNA at the same site.

[0169] Without being limited by any scientific theory, it is theoretically possible to construct custom ZFNs targeting virtually any target sequence (e.g., at or near GA oxidase genes in plant genomes) because the DNA-binding specificity of zinc finger domains can be reengineered using a variety of methods. Publicly available methods for engineering zinc finger domains include case-dependent assembly (CoDA), oligolibrium engineering (OPEN), and modular assembly. In one aspect, the methods and / or compositions provided herein comprise one or more, two or more, three or more, four or more, or five or more ZFNs. In another aspect, the ZFNs provided herein are capable of generating targeted DSBs or nicks. In one aspect, a vector containing polynucleotides encoding one or more, two or more, three or more, four or more, or five or more ZFNs is provided to cells via transformation methods known in the art (e.g., but not limited to viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). ZFN can be introduced in the form of a ZFN protein, in the form of a polynucleotide encoding a ZFN protein, and / or in the form of a combination of a protein and a polynucleotide encoding a protein.

[0170] Widespread nucleases, typically identified in microorganisms, such as the LAGLIDADG family of homing endonucleases, are unique enzymes with high activity and long recognition sequences (>14 bp), resulting in site-specific digestion of target DNA. Engineered forms of naturally occurring widespread nucleases often have extended DNA recognition sequences (e.g., 14 to 40 bp). According to some implementations, widespread nucleases may comprise a backbone or basal enzyme selected from the group consisting of: I-CreI , I-CeuI , I-MsoI , I-SceI , I-AniI and I-DmoI Compared to ZFN and TALEN, the engineering of large-scale nucleases can be more challenging because their DNA recognition and cleavage functions are entangled in a single domain. Specialized mutagenesis and high-throughput screening methods have been used to create novel large-scale nuclease variants that recognize unique sequences and possess improved nuclease activity. Therefore, large-scale nucleases can be selected or engineered to bind to genomic target sequences in plants, such as at or near the genomic locus of the GA oxidase gene. In one aspect, the methods and / or compositions provided herein comprise one or more, two or more, three or more, four or more, or five or more large-scale nucleases. In another aspect, the large-scale nucleases provided herein are capable of generating targeted DSBs. In one aspect, transformation methods known in the art (e.g., not limited to viral transfection, particle bombardment, PEG-mediated protoplast transfection, or...) can be used to... Agrobacterium (Mediated transformation) provides cells with a carrier containing polynucleotides encoding a wide range of nucleases, including one, two or more, three or more, four or more, or five or more.

[0171] TALEN is a transcription activator-like effector (TALE) DNA-binding domain combined with a nuclease domain (e.g., FokI Artificial restriction enzymes are produced through fusion. When each member of a TALEN pair binds to a DNA site at a side-attached target site, FokI Monomerization occurs, leading to double-strand DNA breaks at the target site. (Except for wild-type) FokI Outside the cutting structural domain, structures with mutations have been designed. FokI Variations of the cleavage domain are used to improve cleavage specificity and cleavage activity. FokI The domain functions as a dimer, thus requiring a construct of two unique DNA-binding domains with appropriate orientation and spacing, each targeting a site in the target genome. The TALEN DNA-binding domain and... FokI The number of amino acid residues between cleavage domains and the number of bases between two individual TALEN binding sites are parameters used to achieve high activity levels.

[0172] TALENs are artificial restriction enzymes produced by fusing the transcription activator-like effector (TALE) DNA-binding domain into the nuclease domain. In some respects, nucleases are selected from the following groups: PvuII , MutH , TevI , FokI, AlwI, MlyI, SbfI, SdaI, StsI, CleDORF, Clo051 and Pept071 When each member of a TALEN pair binds to a DNA site at a side-attached target site, FokI Monomerization occurs, leading to the cleavage of double-stranded DNA at the target site. The term TALEN, as used herein, is broad and includes monomeric TALENs capable of cleaving double-stranded DNA without the assistance of another TALEN. The term TALEN also refers to one or both members of a pair of TALENs that together cleave DNA at the same site.

[0173] Transcription activator-like effectors (TALEs) can be engineered to bind to virtually any DNA sequence, such as at or near the genomic locus of the GA oxidase gene in plants. A TALE has a central DNA-binding domain consisting of 13–28 repeating monomers of 33–34 amino acids each. Except for the hypervariable amino acid residues at positions 12 and 13, the amino acids in each monomer are highly conserved. These two variable amino acids are called repeating variable diresidues (RVDs). The amino acids in RVDs preferentially recognize adenine, thymine, cytosine, and guanine / adenine for NI, NG, HD, and NN, respectively, and regulation of RVDs allows for the recognition of consecutive DNA bases. This simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA-binding domains by selecting combinations of repeating segments containing appropriate RVDs.

[0174] Except for wild type FokI Outside the cutting structural domain, structures with mutations have been designed. FokI Variations of the cleavage domain are used to improve cleavage specificity and cleavage activity. FokI The domain functions as a dimer, thus requiring a construct of two unique DNA-binding domains with appropriate orientation and spacing, each targeting a site in the target genome. The TALEN DNA-binding domain and... FokI The number of amino acid residues between cleavage domains and the number of bases between two individual TALEN binding sites are parameters used to achieve high activity levels. PvuII, MutH and TevI The cut structure domain is intended for use with TALE. FokI and FokI Useful alternatives to the variant. When coupled with TALE, PvuIIIt functions as a highly specific cleavage domain (see Yank et al. 2013). PLoS One . 8: e82539). MutH It can introduce strand-specific nicks into DNA (see Gabsalilow et al., 2013). Nucleic Acids Research . 41: e83). TevI Introducing double-strand breaks in DNA at the target site (see Beurdeley et al., 2013). Nature Communications . 4: 1762).

[0175] The relationship between amino acid sequences and DNA recognition of TALE-binding domains allows for the designation of proteins. Software programs such as DNAWorks can be used to design TALE constructs. Other methods for designing TALE constructs are known to those skilled in the art. See Doyle et al., Nucleic Acids Research (2012) 40: W117-122.; Cermak et al., Nucleic Acids Research (2011) . 39:e82; and tale-nt.cac.cornell.edu / about. In one aspect, the methods and / or compositions provided herein comprise one or more, two or more, three or more, four or more, or five or more TALENs. In another aspect, the TALENs provided herein are capable of generating targeted DSBs. In one aspect, a vector containing a polynucleotide encoding one or more, two or more, three or more, four or more, or five or more TALENs is provided to cells by transformation methods known in the art (e.g., but not limited to viral transfection, particle bombardment, PEG-mediated protoplast transfection, or Agrobacterium-mediated transformation). See, for example, U.S. Patent Applications Nos. 2011 / 0145940, 2011 / 0301073, and 2013 / 0117869, the contents and disclosures of which are incorporated herein by reference.

[0176] As used herein, “targeted genome editing technology” refers to any method, protocol or technique that allows for precise and / or targeted editing of a specific location in the plant genome using site-specific nucleases (i.e., editing that is primarily or entirely non-random), such as broad-spectrum nucleases, zinc finger nucleases (ZFNs), RNA-guided endonucleases (e.g., the CRISPR / Cas9 system), TALE endonucleases (TALENs), recombinases or transposases. As used herein, “editing” or “genome editing” refers to a targeted mutation, deletion, inversion, or substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000, at least 10,000, or at least 25,000 nucleotides that produce an endogenous plant genome nucleic acid sequence. As used herein, “editing” or “genome editing” also encompasses the targeted insertion or site-specific integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, at least 10,000, or at least 25,000 nucleotides into the endogenous genome of a plant. The singular form of “editing” or “genome editing” refers to one such targeted mutation, deletion, inversion, substitution, or insertion, while “editing” or “genome editing” refers to two or more targeted mutations, deletions, inversions, substitutions, and / or insertions, each “edit” being introduced via targeted genome editing technology.

[0177] Given that repression of the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, and / or GA3 oxidase_1 genes in maize produces plants with shorter plant height and internode length, in addition to other beneficial traits, it is proposed that the expression of one or more of the GA20 oxidase and / or GA3 oxidase genes can be reduced or eliminated through genome editing of one or more of these genes to provide similar beneficial traits to maize plants. Furthermore, given that constitutive expression of repressor constructs targeting these GA20 oxidase or GA3 oxidase genes produces maize plants with the beneficial trait of shorter height and no reproductive heterosis in the ear, and that direct expression in the reproductive ear tissue does not produce reproductive heterosis, it is proposed that one or more of these loci can be edited to knock down or eliminate their expression to produce similar effects in maize plants. Targeted gene editing methods can be used to modify the promoter and / or regulatory regions of one or more of the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes to knock down or eliminate the expression of these one or more genes, such as through targeted deletions, insertions, mutations, or other sequence alterations. In practice, the promoter and / or regulatory regions or sequences, or the 5'-UTR, 3'UTR, and / or intron sequences of one or more of the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes, can be extensively deleted or mutated. Alternatively, all or part of the coding (exon), 5-UTR, 3'UTR, and / or intron sequences of one or more of the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 genes may be edited, deleted, mutated, or otherwise modified to knock down or eliminate the expression or activity of these genes. Such targeted modifications to the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA3 oxidase_1, GA3 oxidase_2, and / or GA3 oxidase_3 loci can be achieved using any suitable genome editing technique known in the art, such as repair of double-strand breaks (DSBs) or nicks introduced by site-specific nucleases, such as zinc finger nucleases, engineered or naturally occurring broad-spectrum nucleases, TALE endonucleases, or RNA-guided endonucleases (e.g., Cas9 or Cpf1). Such repairs to DSBs or nicks may introduce spontaneous or random deletions, additions, mutations, etc., at the target site where the DSB or nick was introduced, or the repair of the site may involve using donor template molecules to guide or induce preferred or specific deletions, additions, mutations, etc. at the target site.

[0178] As provided herein, plants transformed with recombinant DNA molecules or transformation vectors containing transgenic or transcribed DNA sequences may include a variety of monocotyledonous or cereal plants, such as maize, as well as other monocotyledonous or cereal plants with separate male and female flowers (similar to maize) and thus potentially prone to producing heteromorphic female reproductive organs, structures, or tissues with GA pathway mutations, wherein the transgenic or transcribed DNA sequence encodes a noncoding RNA molecule that targets and represses the endogenous GA oxidase gene or encodes a guide RNA and / or site-specific nuclease for editing the endogenous GA oxidase gene.

[0179] Further provided are methods for introducing or transforming any of the aforementioned constructs, vectors, or constructs constructed in any suitable manner described herein (including different stackings or combined targeting arrangements) into cereals, plant parts, or plant cells, and methods for preparing and / or modifying cereals, plant parts, plant tissues, and plant cells containing any such recombinant DNA molecules, vectors, or constructs. Since the non-coding RNA molecules expressed by the aforementioned constructs will be designed to target endogenous GA oxidase genes, cereals transformed with such recombinant DNA molecules, vectors, or constructs should preferably correspond to a species from which the target sequence originates, or a closely related species, strain, germplasm, cultivar, etc.

[0180] Further provided are methods for introducing or transforming any of the aforementioned guide RNAs, or any constructs, vectors, or constructs encoding guide RNAs, into cereal plants, plant parts, or plant cells, possibly in addition to RNA-guided nucleases, according to any of the methods described herein, and for thereby preparing and / or modifying cereal plants, plant parts, plant tissues, and plant cells containing any such recombinant DNA molecules, vectors, or constructs and / or the edited GA oxidase gene. Modified cereal plants having the edited GA oxidase gene and / or repressive elements targeting the GA oxidase gene may have one or more of the beneficial traits provided herein, such as shorter plant height, shorter internode length, increased stem / stem diameter, improved lodging resistance, and / or drought tolerance, compared to wild-type or control plants without any such editing or repressive elements. In addition to genome editing, mutations in the GA oxidase gene can be introduced via other mutagenesis techniques as described herein.

[0181] According to another aspect of this disclosure, transgenic plants, plant cells, seeds, and plant parts are provided that include a transformation event or insertion into the genome of at least one of their plant cells, wherein the transformation event or insertion comprises a recombinant DNA sequence, construct, or expression cassette comprising a transcribed DNA sequence comprising a non-coding RNA molecule encoding a non-coding RNA molecule targeting and repressing an endogenous GA oxidase gene or a guide RNA and / or site-specific nuclease for editing an endogenous GA oxidase gene, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter, such as a constitutive, vascular, and / or leaf promoter. Such transgenic plants can be produced by any suitable transformation method provided above to produce transgenic R0 plants, which can then be self-pollinated or hybridized with other plants to generate R1 seeds and subsequent progeny, as well as seeds produced through additional hybridization. Embodiments of this disclosure also include plant cells, tissues, explants, plant parts, etc., comprising one or more transgenic cells having a transformation event or genomic insertion comprising a transcribed DNA sequence comprising a transcribed DNA sequence encoding a non-coding RNA molecule targeting and repressing an endogenous GA oxidase gene.

[0182] The transgenic plants, plant cells, seeds, and plant parts disclosed herein may be homozygous or hemizygous for transgenic events or insertions into the transcribed DNA sequence for repressing the GA oxidase gene in the genome of at least one plant cell, and the plants, plant cells, seeds, and plant parts of embodiments of the invention may contain any number of copies of such transgenic events, insertions, and / or edits. The dose or amount of expression of the transgenic or transcribed DNA sequence or wild-type or mutant allele of the endogenous gene can be altered by its conjugation and / or copy number, which may affect the extent or limit of phenotypic changes in the transgenic plant. As described above, the transgenic plants provided herein may include a variety of monocotyledonous or cereal plants, such as maize or corn, which have already exhibited increased yield and / or lodging resistance due to prior breeding work and mutations in the GA pathway in these plants. The advantages of using transgenic or transcribed DNA sequences to express repressor elements targeting the biosynthetic GA oxidase gene include not only the ability to restrict expression in a tissue-specific or tissue-biased manner, but also the potential advantage of single or semi-zygotic copies of the transcribed DNA sequence (e.g., dominant-negative effects) to induce beneficial dwarfing or semi-dwarfing traits or phenotypes in crop plants. Therefore, the recombinant DNA molecules or constructs of this disclosure can be used to produce beneficial traits in a variety of monocotyledonous or cereal plants without allergies using only a single copy of the transgenic event, insertion, or construct. Plants transformed with the GA-modified transgenic and repressor constructs of this disclosure can improve traits, yields, and crop breeding efforts by promoting the production of hybrid cereals, as they require only a single or semi-zygotic copy of the transgenic or repressor construct.

[0183] According to some implementation schemes, transgenic or modified cereal or maize plants containing a GA oxidase transgene or a transcribed DNA sequence for repressing endogenous GA oxidase genes or genome-edited GA oxidase genes may be further characterized as having one or more beneficial traits, such as shorter plant height or semi-dwarf plant height relative to wild-type or control plants, reduced internode length, increased culm / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, increased leaf water content and / or higher stomatal conductance under water-limited conditions, reduced anthocyanin content and / or leaf area under normal or nitrogen- or water-limited stress conditions, and improved yield-related traits, including larger female reproductive organs or ears, ear weight, harvest index, yield, number of seeds or kernels, and / or increased seed or kernel weight. Such transgenic cereal or maize plants may also have increased stress tolerance, such as increased drought tolerance, nitrogen use efficiency, and / or tolerance to high-density planting.

[0184] For the purposes of this disclosure, "plant" includes explants, plant parts, seedlings, plantlets, or whole plants at any stage of regeneration or development. As used herein, "transgenic plant" refers to a plant whose genome has been altered through the integration or insertion of recombinant DNA molecules, constructs, or sequences. Transgenic plants include R0 plants that develop or regenerate from initially transformed plant cells, as well as progeny transgenic plants from the offspring or hybrids of R0 transgenic plants. As used herein, "plant part" can refer to any organ or whole tissue of a plant, such as meristem, young shoot organs / structures (e.g., leaves, stems, or nodes), roots, flowers or floral organs / structures (e.g., bracts, calyx, petals, stamens, carpels, anthers, and ovules), seeds (e.g., embryo, endosperm, and seed coat), fruits (e.g., mature ovaries), propagules, or other plant tissues (e.g., vascular tissue, cortical tissue, ground tissue, etc.), or any part thereof. Plant parts of this disclosure can be viable, non-viable, regenerable, and / or non-regenerable. "Propagation body" can include any part of a plant that can grow into a whole plant.

[0185] According to embodiments of the present invention, plant cells transformed with a construct or molecule containing a transcribed DNA sequence for repressing the endogenous GA oxidase gene or a construct for genome editing of the GA oxidase gene may include any plant cell capable of transformation based on a transformation method, as understood in the art, such as meristematic cells, embryonic cells, callus cells, etc. As used herein, "transgenic plant cell" simply refers to any plant cell transformed with a stably integrated recombinant DNA molecule, construct, or sequence. Transgenic plant cells may include the initially transformed plant cell, transgenic plant cells of a regenerated or developing R0 plant, transgenic plant cells cultured from another transgenic plant cell, or transgenic plant cells from any progeny or offspring of a transformed R0 plant, including cells of plant seeds or embryos, or cultured plant cells, callus cells, etc.

[0186] Embodiments of this disclosure also include methods for preparing or producing transgenic or modified plants, such as by transformation, genome editing, hybridization, etc., wherein the method includes introducing a recombinant DNA molecule, construct, or sequence containing a GA oxidase transgene or a transcribed DNA sequence for repressing an endogenous GA oxidase gene into a plant cell, or editing the genomic locus of an endogenous GA oxidase gene, and then regenerating or developing the transgenic or modified plant from the transformed or edited plant cells, which can be carried out under selection pressure favorable to transgenic events. Such methods may include transforming plant cells with a recombinant DNA molecule, construct, or sequence containing a transcribed DNA sequence for repressing endogenous GA oxidase genes, and selecting plants with one or more altered phenotypes or traits at one or more developmental stages, such traits as one or more of the following: shorter or semi-dwarf plant type or plant height compared to wild-type or control plants, shorter internode length in one or more internodes, increased culm / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, increased leaf water content and / or higher stomatal conductance under water-limited conditions, reduced anthocyanin content and / or leaf area under normal or nitrogen- or water-limited stress, improved yield-related traits (including larger female reproductive organs or spikes, spike weight, harvest index, yield, number of seeds or grains and / or increased seed or grain weight), increased stress tolerance (such as increased drought tolerance), increased nitrogen use efficiency, and / or increased tolerance to high-density planting.

[0187] According to another aspect of this disclosure, methods are provided for planting the modified or transgenic plants disclosed herein in the field at normal / standard or high density. According to some embodiments, crop yield per acre (or land area) can be increased by planting the modified or transgenic plants of this disclosure at a higher density in the field. As described herein, modified or transgenic plants expressing a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses an endogenous GA oxidase gene, or having a genome-edited GA oxidase gene, may have reduced plant height, shorter internodes, increased stem / stem diameter, and / or increased lodging resistance. It is proposed that the modified or transgenic plants can tolerate high-density planting conditions because the increased stem diameter resists lodging and the shorter plant height allows for increased light penetration to lower leaves under high-density planting conditions. Therefore, the modified or transgenic plants provided herein can be planted at higher densities to increase yield per acre (or land area) in the field. For row crops, higher densities can be achieved by planting a larger number of seeds / plants per row and / or by reducing row spacing.

[0188] According to some implementation plans, modified or genetically modified crops can be planted at field densities (plants per land / field area) that are at least 5%, 10%, 15%, 20%, 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, 225%, or 250% higher than the normal planting density of crops according to standard agronomic practice. Modified or genetically modified crops can be planted at field densities of at least 38,000 plants per acre, at least 40,000 plants per acre, at least 42,000 plants per acre, at least 44,000 plants per acre, at least 45,000 plants per acre, at least 46,000 plants per acre, at least 48,000 plants per acre, at least 50,000 plants per acre, at least 52,000 plants per acre, at least 54,000 plants per acre, or at least 56,000 plants per acre. For example, unlike standard density ranges such as approximately 18,000 to 38,000 plants per acre, corn plants can be planted at higher densities, such as: approximately 38,000 to 60,000 plants per acre, or approximately 40,000 to 58,000 plants per acre, or approximately 42,000 to 58,000 plants per acre, or approximately 40,000 to 45,000 plants per acre, or... Approximately 45,000 plants to approximately 50,000 plants per acre, or approximately 50,000 plants per acre to approximately 58,000 plants per acre, or approximately 52,000 plants per acre to approximately 56,000 plants per acre, or approximately 38,000 plants per acre, approximately 42,000 plants per acre, approximately 46,000 plants per acre, or approximately 48,000 plants per acre, approximately 50,000 plants per acre, or approximately 52,000 plants per acre, or approximately 54,000 plants per acre.

[0189] According to embodiments of this disclosure, one or more modified maize plants are provided, comprising (i) a plant height of less than 2000 mm, less than 1950 mm, less than 1900 mm, less than 1850 mm, less than 1800 mm, less than 1750 mm, less than 1700 mm, less than 1650 mm, less than 1600 mm, less than 1550 mm, less than 1500 mm, less than 1450 mm, less than 1400 mm, less than 1350 mm, less than 1300 mm, less than 1250 mm, less than 1200 mm, less than 1150 mm, less than 1100 mm, less than 1050 mm, or less than 1000 mm, and / or (ii) an average stem or stalk diameter of at least 18 mm, at least 18.5 mm, at least 19 mm, at least 19.5 mm, at least 20 mm, at least 20.5 mm, at least 21 mm, at least 21.5 mm, or at least 22 mm. Presented in various ways, one or more modified maize plants are provided, comprising a plant height of less than 2000 mm, less than 1950 mm, less than 1900 mm, less than 1850 mm, less than 1800 mm, less than 1750 mm, less than 1700 mm, less than 1650 mm, less than 1600 mm, less than 1550 mm, less than 1500 mm, less than 1450 mm, less than 1400 mm, less than 1350 mm, less than 1300 mm, less than 1250 mm, less than 1200 mm, less than 1150 mm, less than 1100 mm, less than 1050 mm, or less than 1000 mm, and / or an average stem or stalk diameter of greater than 18 mm, greater than 18.5 mm, greater than 19 mm, greater than 19.5 mm, greater than 20 mm, greater than 20.5 mm, greater than 21 mm, greater than 21.5 mm, or greater than 22 mm. Any such plant height trait or range expressed in millimeters (mm) may be converted to different units of measurement based on known conversion relationships (e.g., one inch equals 2.54 cm or 25.4 millimeters, and millimeters (mm), centimeters (cm), and meters (m) differ only by one or more powers of ten). Therefore, any measurements provided herein are further described in any other similar units of measurement based on known and established conversions. However, the precise plant height and / or stem diameter of modified maize plants may depend on environmental and genetic background. Therefore, variations in plant height and / or stem diameter of modified maize plants may alternatively be described with regard to the minimum difference or percentage change relative to control plants. Modified maize plants may also include at least one ear that is substantially devoid of male reproductive tissue or structures or other heteromorphic features.

[0190] According to embodiments of this disclosure, modified maize plants are provided, said modified maize plants comprising the following dimensions during late vegetative and / or reproductive development stages (e.g., at R3 stage): between 1000 mm and 1800 mm, between 1000 mm and 1700 mm, between 1050 mm and 1700 mm, between 1100 mm and 1700 mm, between 1150 mm and 1700 mm, between 1200 mm and 1700 mm, between 1250 mm and 1700 mm, between 1300 mm and 1700 mm, between 1350 mm and 1700 mm, between 1400 mm and 1700 mm, between 1450 mm and 1700 mm, between 1000 mm and 1500 mm, between 1050 mm and 1500 mm, between 1100 mm and 1500 mm, and between 1150 mm and 1500 mm. Between 1500 mm and 1200 mm and 1500 mm, between 1250 mm and 1500 mm, between 1300 mm and 1500 mm, between 1350 mm and 1500 mm, between 1400 mm and 1500 mm, between 1450 mm and 1500 mm, between 1000 mm and 1600 mm, between 1100 mm and 1600 mm, between 1200 mm and 1600 mm, between 1300 mm and 1600 mm, between 1350 mm and 1600 mm, between 1400 mm and 1600 mm, between 1450 mm and 1600 mm, between 1000 mm and 2000 mm, between 1200 mm and 2000 mm, between 1200 mm and 1800 mm, between 1300 mm and 1700 mm Plant heights between 1400 mm and 1700 mm, between 1400 mm and 1600 mm, between 1400 mm and 1700 mm, between 1400 mm and 1800 mm, between 1400 mm and 1900 mm, between 1400 mm and 2000 mm, or between 1200 mm and 2500 mm, and / or between 17.5 mm and 22 mm, between 18 mm and 22 mm, between 18.5 mm and 22 mm, between 19 mm and 22 mm, between 19.5 mm and 22 mm, between 20 mm and 22 mm, between 20.5 mm and 22 mm, between 21 mm and 22 mm, between 21.5 mm and 22 mm, between 17.5 mm and 21 mm, between 17.5 mm and 20 mm, between 17.5 mm and 19 mm, and between 17.The average stem diameter is between 5 mm and 18 mm, between 18 mm and 21 mm, between 18 mm and 20 mm, or between 18 mm and 19 mm. Modified maize plants may be substantially free of heteromorphs, such as male reproductive tissues or structures, in one or more ears of the modified maize plant.

[0191] According to embodiments of this disclosure, modified maize plants are provided having (i) a height that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% smaller than that of wild-type or control plants, and / or (ii) a stem or stalk diameter that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% larger than that of wild-type or control plants. According to embodiments of this disclosure, the modified maize plants may have a plant height that is up to 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60% shorter than that of wild-type or control plants, and / or a stem or stalk diameter that is greater than (or not greater than) 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of that of wild-type or control plants. For example, a modified plant may have (i) a plant height that is at least 10%, at least 15%, or at least 20% shorter or shorter than the wild-type or control plant (i.e., 10%, 15%, or 20% shorter), but not more than or equal to 50% shorter, and / or (ii) a stem or culm diameter that is at least 5%, at least 10%, or at least 15% larger than the wild-type or control plant, but not more than 30%, 35%, or 40% larger. For clarity, the phrases “at least 20% shorter” and “at least 20% shorter” exclude, for example, a plant that is 10% shorter. Similarly, for clarity, the phrases “not more than 50% shorter,” “at most 50% shorter,” and “not more than 50% shorter” exclude a plant that is 60% shorter; the phrase “at least 5% longer” excludes a plant that is 2% longer; and the phrases “not more than 30% longer” and “at most 30% longer” exclude a plant that is 40% longer.

[0192] According to embodiments of this disclosure, modified maize plants are provided, the modified maize plants comprising, compared to wild-type or control plants, heights that are less than 5% to 75%, 5% to 50%, 10% to 70%, 10% to 65%, 10% to 60%, 10% to 55%, 10% to 50%, 10% to 45%, 10% to 40%, 10% to 35%, 10% to 30%, and less than 10%. Between 10% and 25%, between 10% and 20%, between 10% and 15%, between 10% and 10%, between 10% and 75%, between 25% and 75%, between 10% and 50%, between 20% and 50%, between 25% and 50%, between 30% and 75%, between 30% and 50%, between 25% and 50%, between 15% and 50%, between 20% and 50%, between 25% and 45%, or between 30% and 45%. The height between, and / or the stem or culm diameter compared to the wild type or control plant, is greater than 5% to 100%, between 5% to 95%, between 5% to 90%, between 5% to 85%, between 5% to 80%, between 5% to 75%, between 5% to 70%, between 5% to 65%, between 5% to 60%, between 5% to 55%, between 5% to 50%, between 5% to 45%, between 5% to 40%, between 5% to 35%, and between 5% and 100%. The stem or culm diameter is between 30%, between 5% and 25%, between 5% and 20%, between 5% and 15%, between 5% and 10%, between 10% and 100%, between 10% and 75%, between 10% and 50%, between 10% and 40%, between 10% and 30%, between 10% and 20%, between 25% and 75%, between 25% and 50%, between 50% and 75%, between 8% and 20%, or between 8% and 15%.

[0193] According to embodiments of this disclosure, modified maize plants are provided, said modified maize plants comprising an average internode length (or a negative 2 internode length and / or a negative 4 internode length relative to the ear position) that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% smaller than the same or average internode length of wild-type or control plants. A “negative 2 internode” in maize plants refers to the second internode below the ear of the plant, and a “negative 4 internode” in maize plants refers to the fourth internode below the ear of the plant. According to many embodiments, modified maize plants are provided, said modified maize plants having internode lengths that are 5% to 75% smaller than, between 5% and 50%, between 10% and 70%, between 10% and 65%, between 10% and 60%, between 10% and 55%, between 10% and 50%, between 10% and 45%, between 10% and 40%, between 10% and 35%, between 10% and 30%, between 10% and 25%, between 10% and 25%, etc., compared to the same or average internode length of wild-type or control plants. The average internode length (or the negative 2 internode length and / or negative 4 internode length relative to the position of the ear) between 0%, between 10% and 15%, between 10% and 10%, between 10% and 75%, between 25% and 75%, between 25% and 70%, between 10% and 50%, between 20% and 50%, between 25% and 45%, or between 30% and 45%.

[0194] According to embodiments of this disclosure, modified maize plants are provided, the modified maize plants comprising at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% greater ear weight (individually or on average) compared to wild-type or control plants. The modified maize plants described in this article may contain ear weights that, compared to wild-type or control plants, are between 5% and 100%, between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, and between 5% and 50%. The ear weight is between 45%, between 5% and 40%, between 5% and 35%, between 5% and 30%, between 5% and 25%, between 5% and 20%, between 5% and 15%, between 5% and 10%, between 10% and 100%, between 10% and 75%, between 10% and 50%, between 25% and 75%, between 25% and 50%, or between 50% and 75%.

[0195] According to embodiments of this disclosure, modified maize or cereal plants are provided having a harvest index of at least 0.57, at least 0.58, at least 0.59, at least 0.60, at least 0.61, at least 0.62, at least 0.63, at least 0.64, or at least 0.65 (or greater). The modified maize plants may have a harvest index between 0.57 and 0.65, between 0.57 and 0.64, between 0.57 and 0.63, between 0.57 and 0.62, between 0.57 and 0.61, between 0.57 and 0.60, between 0.57 and 0.59, between 0.57 and 0.58, between 0.58 and 0.65, between 0.59 and 0.65, or between 0.60 and 0.65. Modified maize plants may have a harvest index that is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% greater than that of wild-type or control plants. Modified maize plants may have a harvest index compared to wild-type or control plants that is between 1% and 45%, between 1% and 40%, between 1% and 35%, between 1% and 30%, between 1% and 25%, between 1% and 20%, between 1% and 15%, between 1% and 14%, between 1% and 13%, between 1% and 12%, between 1% and 11%, between 1% and 10%, between 1% and 9%, between 1% and 8%, between 1% and 7%, between 1% and 6%, between 1% and 5%, between 1% and 4%, between 1% and 3%, between 1% and 2%, between 5% and 15%, between 5% and 20%, between 5% and 30%, or between 5% and 40%.

[0196] According to embodiments of this disclosure, modified maize or cereal plants are provided that offer an increase in harvestable yield of at least 1 bushel / acre, at least 2 bushels / acre, at least 3 bushels / acre, at least 4 bushels / acre, at least 5 bushels / acre, at least 6 bushels / acre, at least 7 bushels / acre, at least 8 bushels / acre, at least 9 bushels / acre, or at least 10 bushels / acre relative to wild-type or control plants. The increase in harvestable yield of the modified maize plants may be between 1 bushel / acre and 10 bushels / acre, between 1 bushel / acre and 8 bushels / acre, between 2 bushels / acre and 8 bushels / acre, between 2 bushels / acre and 6 bushels / acre, between 2 bushels / acre and 5 bushels / acre, between 2.5 bushels / acre and 4.5 bushels / acre, or between 3 bushels / acre and 4 bushels / acre. Modified maize plants may have a harvestable yield increase of at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 20%, or at least 25% compared to wild-type or control plants. Modified maize plants may have a harvestable yield that is between 1% and 25%, between 1% and 20%, between 1% and 15%, between 1% and 14%, between 1% and 13%, between 1% and 12%, between 1% and 11%, between 1% and 10%, between 1% and 9%, between 1% and 8%, between 1% and 7%, between 1% and 6%, between 1% and 5%, between 1% and 4%, between 1% and 3%, between 1% and 2%, between 5% and 15%, between 5% and 20%, between 5% and 25%, between 2% and 10%, between 2% and 9%, between 2% and 8%, between 2% and 7%, between 2% and 6%, between 2% and 5%, or between 2% and 4% compared to wild-type or control plants.

[0197] According to embodiments of this disclosure, modified cereal or maize plants are provided that have a lodging frequency that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% lower than that of wild-type or control plants. Modified cereal or maize plants may have lower or less percentages of the following characteristics compared to wild-type or control plants: between 5% and 100%, between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, between 5% and 45%, between 5% and 40%, and between 5%. Lodging frequencies were specified as follows: between 35% and 5%; between 5% and 30%; between 5% and 25%; between 5% and 20%; between 5% and 15%; between 5% and 10%; between 10% and 100%; between 10% and 75%; between 10% and 50%; between 10% and 40%; between 10% and 30%; between 10% and 20%; between 25% and 75%; between 25% and 50%; or between 50% and 75%. Populations of cereal or maize plants with increased lodging resistance and reduced lodging frequency were also provided. A population of modified cereal or maize plants is provided that has a lodging frequency that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% lower than that of wild-type or control plants.The modified maize plant population may contain populations that are smaller or lower than the wild-type or control populations, ranging from 5% to 100%, 5% to 95%, 5% to 90%, 5% to 85%, 5% to 80%, 5% to 75%, 5% to 70%, 5% to 65%, 5% to 60%, 5% to 55%, 5% to 50%, 5% to 45%, 5% to 40%, 5% to 35%, and 5% to 35%. The lodging frequency, which can be expressed as the average of a specific number of plants or the area of ​​crops of equal density, is between 0%, 5% and 25%, 5% and 20%, 5% and 15%, 5% and 10%, 10% and 100%, 10% and 75%, 10% and 50%, 10% and 40%, 10% and 30%, 10% and 20%, 25% and 75%, 25% and 50%, or 50% and 75%.

[0198] According to embodiments of this disclosure, modified maize plants are provided that, relative to wild-type or control plants, have a significantly reduced or decreased plant height (e.g., 2000 mm or less) and a significantly increased stem diameter (e.g., 18 mm or more). According to these embodiments, the reduction or decrease in plant height and the increase in stem diameter can be within any range of height, diameter, or percentage listed herein. Such modified maize plants having a reduced plant height and increased stem diameter relative to wild-type or control plants can be transformed with a transcribed DNA sequence encoding a non-coding RNA molecule that targets and represses at least one GA20 oxidase gene and / or at least one GA3 oxidase gene, and / or may contain one or more mutations or edits in one or more GA20 oxidase and / or GA3 oxidase genes. Modified maize plants having a significantly reduced plant height and / or significantly increased stem diameter relative to wild-type or control plants may also have at least one ear that is substantially devoid of male reproductive tissue or structure and / or other heteromorphic features. Modified maize plants exhibiting significantly reduced plant height and / or increased stem diameter compared to wild-type or control plants may possess reduced activity of one or more GA20 oxidase and / or GA3 oxidase genes in one or more tissues of the plant, such as one or more vascular tissues and / or leaf tissues, compared to the same one or more tissues of wild-type or control plants. According to many embodiments, the modified maize plant may contain at least one polynucleotide or transcribed DNA sequence operatively linked to a promoter encoding a non-coding RNA molecule, said promoter being constitutive, tissue-specific, or tissue-preferred, wherein said non-coding RNA molecule targets at least one GA20 oxidase and / or GA3 oxidase gene to achieve repression as provided herein. The non-coding RNA molecule may be miRNA, siRNA, or a miRNA or siRNA precursor molecule. According to some embodiments, the mutations or edits in one or more GA20 oxidase and / or GA3 oxidase genes in the modified maize plant may be homozygous or heterozygous. According to some implementation schemes, modified maize plants with significantly reduced plant height and / or increased stem diameter compared to wild-type or control plants may further have increased harvest index and / or increased lodging resistance compared to wild-type or control plants.

[0199] Modified maize or cereal plants exhibiting significantly reduced plant height and / or significantly increased stem diameter compared to wild-type or control plants may include mutations (e.g., insertions, deletions, substitutions, etc.) introduced through genome editing or other mutagenesis techniques in the GA oxidase gene, wherein expression of the GA oxidase gene is reduced or eliminated in one or more tissues of the modified plant. Such modified maize plants exhibiting reduced plant height and / or increased stem diameter compared to wild-type or control plants may further exhibit increased harvest index and / or increased lodging resistance compared to wild-type or control plants. Such modified maize plants may be substantially free of allergens, such as male reproductive tissues or structures and / or other allergens, in at least one ear of the modified plant. Plant mutagenesis techniques (excluding genome editing) may include chemical mutagenesis (i.e., treatment with chemical mutagens such as azides, hydroxylamine, nitrite, acridine, nucleotide base analogs, or alkylating agents—e.g., EMS (ethyl methanesulfonate), MNU (N-methyl-N-nitrosourea), etc.), physical mutagenesis (e.g., gamma rays, X-rays, ultraviolet light, ion beams, other forms of radiation, etc.), and insertional mutagenesis (e.g., transposon or T-DNA insertion). Mutagenesis can be induced in plants or various plant parts, plant tissues, or plant cells. Treated plants can regenerate to collect seeds or produce progeny plants, and treated plant parts, plant tissues, or plant cells can develop or regenerate into plants or other plant tissues. Mutagenesis generated by chemical or physical mutagenesis or targeted genome editing techniques may include frameshift, missense, or nonsense mutations that result in loss of function or expression of target genes (such as the GA3 or GA20 oxidase genes).

[0200] One method for gene mutagenesis is called “TILLING” (for targeted induction of localized damage in the genome), in which, for example, a mutagen, such as EMS treatment, is used to induce mutations in plant cells or tissues, preferably in the seeds, reproductive tissues, or lines of a plant. The resulting plants are then grown and self-fertilized, and DNA samples are prepared using the progeny. PCR amplification and sequencing of the nucleic acid sequence of the GA oxidase gene can be used to identify whether the mutated plant has a mutation in the GA oxidase gene. Altered traits, such as reduced plant height, can then be tested in plants with mutations in the GA oxidase gene. Alternatively, altered traits, such as reduced plant height, can be tested in the mutated plant, and PCR amplification and sequencing of the nucleic acid sequence of the GA oxidase gene can then be used to determine whether the plant with the altered trait also has a mutation in the GA oxidase gene. See, for example, Colbert et al., 2001. Plant Physiol126:480-484; and McCallum et al., 2000, Nature Biotechnology 18:455-457. TILLING can be used to identify mutations that alter gene expression or the activity of proteins encoded by genes, and it can be used to introduce and select targeted mutations in GA oxidase genes in maize or cereal plants.

[0201] Maize or cereal plants that have undergone mutagenesis or genome editing can be screened and selected based on observable phenotypes (e.g., any phenotype described herein, such as shorter plant height, increased stem / stem diameter, etc.) or using selectable agents with selectable markers (e.g., herbicides, etc.), selectable markers, or molecular techniques (e.g., lower GA levels, lower GA oxidase transcript or protein levels, the presence of transgenic or transcribed sequences, or the presence of mutations, edits, or sequences, etc.). Such screening and / or selection techniques can be used to identify and select plants with mutations in the GA oxidase gene that result in the desired plant phenotype.

[0202] According to embodiments of this disclosure, a population of modified maize or cereal plants is provided, wherein the modified maize or cereal plant population has a significantly smaller average plant height and / or a significantly larger average stem or stalk diameter than a wild-type or control plant population. The modified maize or cereal plant population may share an ancestor with individual modified maize or cereal plants and / or have a common single transgenic GA oxidase repressor construct insertion, event, or edit. Modified maize plants within a modified maize plant population typically include at least one ear that is substantially devoid of male reproductive tissue or structure and / or other heteromorphic structures. Compared to wild-type or control plant populations, the modified maize or cereal plant population may have increased lodging resistance on average or per plant number or field area. Modified maize or cereal populations may have a lodging frequency that is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% lower than that of control maize or cereal populations. Modified maize populations may have a harvest index of at least 0.57 or greater.

[0203] According to embodiments of the invention, modified maize or cereal plants are provided that have reduced gibberellin content (active form) in at least stem and internode tissues (such as stems, internodes, leaves, and / or vascular tissues) compared to the same tissues of wild-type or control plants. According to many embodiments, modified maize or cereal plants are provided that have significantly reduced plant height and / or significantly increased stem diameter relative to wild-type or control plants, wherein the modified maize or cereal plant also has significantly reduced or decreased levels of active gibberellin or active GA (e.g., one or more of GA1, GA3, GA4, and / or GA7) in one or more stem, internode, leaf, and / or vascular tissues relative to one or more of the same tissues of wild-type or control plants. For example, the levels of one or more active GAs in the stems, internodes, leaves and / or vascular tissues of modified maize or cereal plants may be at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at...

Claims

1. A modified maize plant comprising a mutant allele of an endogenous GA3 oxidase gene, wherein, relative to a wild-type allele of the endogenous GA3 oxidase gene, the mutant allele contains a mutation or edit in the upstream region of the endogenous GA3 oxidase gene, and wherein, relative to a wild-type control plant, the expression level of the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant.

2. The modified maize plant of claim 1, wherein the modified maize plant has a shorter plant height relative to the wild-type control plant.

3. The modified maize plant as described in claim 1 or 2, wherein the modified maize plant, relative to the wild-type control plant, has one or more of the following beneficial traits: increased stalk / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower ear height, increased leaf water content, improved drought tolerance, improved nitrogen use efficiency, reduced anthocyanin content and area in leaves under normal or nitrogen- or water-limited stress conditions, increased ear weight, increased harvest index, increased yield, increased seed quantity, increased seed weight, and increased productivity.

4. The modified maize plant according to any one of claims 1-3, wherein the height of the modified maize plant is at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% shorter than the wild-type control plant.

5. The modified maize plant according to any one of claims 1-4, wherein the modified maize plant has a stalk or stem diameter at one or more internodes that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% larger than that of the wild-type control plant.

6. The modified maize plant according to any one of claims 1-5, wherein the level of one or more active GAs in at least one internode tissue of the stem or stalk of the modified maize plant is lower than that in the same internode tissue of the wild-type control plant.

7. The modified maize plant according to any one of claims 1-6, wherein the mutant allele comprises a mutation in the upstream region of the endogenous GA3 oxidase gene introduced by mutagenesis.

8. The modified maize plant according to any one of claims 1-6, wherein the mutant allele comprises an edit in the upstream region of the endogenous GA3 oxidase gene introduced by targeted genome editing technology.

9. The modified maize plant according to any one of claims 1-8, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_1 gene, and wherein (i) the upstream region of the wild-type allele of the GA3 oxidase_1 gene without the mutation or editing contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the sequence identical to nucleotides 1-3000 of SEQ ID NO: 168 or nucleotides 1-7620 of SEQ ID NO: 174, and / or (ii) the upstream region of the mutant allele of the GA3 oxidase_1 gene contains nucleotides 1-3000 of SEQ ID NO: 168, nucleotides 1-7620 of SEQ ID NO: 174, or nucleotides 1-7620 of SEQ ID NO:

168. 208 consists of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 3000, at least 4000, or at least 5000 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical sequences.

10. The modified maize plant according to any one of claims 1-9, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the upstream region of the mutant allele of the GA3 oxidase_1 gene contains or contains a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to one or more of SEQ ID NO: 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230 and / or 231.

11. The modified maize plant according to any one of claims 1-8, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_2 gene, and wherein the upstream region of the wild-type allele of the GA3 oxidase_2 gene without the mutation or editing comprises at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical sequences to nucleotides 1-3000 of SEQ ID NO: 169 or nucleotides 1-7385 of SEQ ID NO: 175, and / or (ii) the upstream region of the mutant allele of the GA3 oxidase_2 gene comprises nucleotides 1-3000 of SEQ ID NO: 169 or SEQ ID NO:

175. 175 nucleotides 1-7385 of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 3000, at least 4000 or at least 5000 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical sequence.

12. The modified maize plant according to any one of claims 1-8, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_3 gene, and wherein (i) the upstream region of the wild-type allele of the GA3 oxidase_3 gene without the mutation or editing contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the sequence identical to nucleotides 1-3000 of SEQ ID NO: 170 or nucleotides 1-7546 of SEQ ID NO: 176, and / or (ii) the upstream region of the mutant allele of the GA3 oxidase_3 gene contains nucleotides 1-3000 of SEQ ID NO: 170 or SEQ ID NO:

176. The sequence of nucleotides 1-7546 is at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 3000, at least 4000 or at least 5000 consecutive nucleotides, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical.

13. The modified maize plant according to any one of claims 1-7 and 9-12, wherein the mutant allele comprises a mutation in the promoter region of the endogenous GA3 oxidase gene introduced by mutagenesis.

14. The modified maize plant according to any one of claims 1-6 and 8-12, wherein the edited allele comprises an edit in the promoter region of the endogenous GA3 oxidase gene introduced by targeted genome editing technology.

15. The modified maize plant according to any one of claims 1-10, 13, or 14, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein (i) the promoter region of the wild-type allele of the GA3 oxidase_1 gene without the mutation or editing contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical sequence to nucleotides 5621-7620 of SEQ ID NO: 174, and / or (ii) the promoter region of the mutant allele of the GA3 oxidase_1 gene contains nucleotides 5621-7620 of SEQ ID NO: 174 or SEQ ID NO: The sequence of 208 consists of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, or at least 1500 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical nucleotides.

16. The modified maize plant according to any one of claims 1-8, 11, 13 or 14, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_2 gene, and wherein (i) the promoter region of the wild-type allele of the GA3 oxidase_2 gene without the mutation or editing contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the sequence identical to nucleotides 5386-7385 of SEQ ID NO: 175, and / or (ii) the promoter region of the mutant allele of the GA3 oxidase_2 gene .... 175 nucleotides 5386-7385 of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000 or at least 1500 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical sequence.

17. The modified maize plant according to any one of claims 1-8, 12, 13 or 14, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene, and wherein the promoter region of the wild-type allele of the GA3 oxidase_3 gene without the mutation or editing contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to nucleotides 5547-7546 of SEQ ID NO: 176, and / or (ii) the promoter region of the mutant allele of the GA3 oxidase_2 gene contains at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

176. The sequence of nucleotides 5547-7546 is at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000 or at least 1500 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical.

18. The modified maize plant according to any one of claims 1-17, wherein the modified maize plant is heterozygous for the mutant allele.

19. The modified maize plant according to any one of claims 1-17, wherein the modified maize plant is homozygous for the mutant allele.

20. The modified maize plant according to any one of claims 1-19, wherein the mutant allele of the modified maize plant comprises two or more edits and / or mutations, three or more edits and / or mutations, four or more edits and / or mutations, five or more edits and / or mutations, six or more edits and / or mutations, seven or more edits and / or mutations, eight or more edits and / or mutations, nine or more edits and / or mutations, or ten or more edits and / or mutations in the upstream region and / or promoter region of the endogenous GA3 oxidase gene.

21. A modified maize plant portion of a modified maize plant as described in any one of claims 1-20.

22. A modified maize plant comprising a mutant allele of an endogenous GA3 oxidase gene, wherein the mutant allele comprises a reverse DNA segment in the transcribed DNA region of the endogenous GA3 oxidase gene, wherein the reverse DNA segment encodes at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more of the transcribed DNA region of the wild-type allele of the endogenous GA3 oxidase gene and / or the mRNA molecule encoded by the wild-type allele of the endogenous GA3 oxidase gene. At least 60, 70, 80, 90, 100, 150, 200, 250, 500, 1000, 1500, 2000, or 2500 consecutive nucleotides of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary antisense RNA sequences, wherein the mutated allele of the endogenous GA3 oxidase gene encodes an mRNA transcript containing the antisense RNA sequence.

23. The modified maize plant of claim 22, wherein the reverse DNA segment of the mutant allele of the endogenous GA3 oxidase gene is introduced into the endogenous GA3 oxidase gene by targeted genome editing technology.

24. The modified maize plant of claim 22 or 23, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 200, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) one or more of SEQ ID NO: 28, 29, and / or 36; (ii) SEQ ID NO: (iii) nucleotides 3001-5406 of SEQ ID NO: 174; and / or (iv) SEQ ID NO: 206 or a sequence complementary to it.

25. The modified maize plant of claim 22, 23 or 24, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the mutant allele of the endogenous GA3 oxidase_1 gene comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

207.

26. The modified maize plant of claim 22 or 23, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_2 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) one or more of SEQ ID NO: 31, 32, and / or 37; (ii) SEQ ID NO: Nucleotides 3001-4581 of SEQ ID NO: 169; and / or (iii) nucleotides 7386-8967 of SEQ ID NO:

175.

27. The modified maize plant of claim 22 or 23, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_3 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) one or more of SEQ ID NO: 171 and / or 172; (ii) SEQ ID NO: Nucleotides 3001-4332 of SEQ ID NO: 170; and / or (iii) nucleotides 7547-9178 of SEQ ID NO:

176.

28. A modified maize plant comprising a mutant allele of an endogenous GA3 oxidase gene, wherein the mutant allele comprises a reverse DNA segment in the untranslated region (UTR) or intron of the endogenous GA3 oxidase gene, wherein the reverse DNA segment encodes at least 20, at least 25, at least 30, at least 35, at least 40, or at least 45% of the mRNA molecule encoded by the wild-type allele of the endogenous GA3 oxidase gene. At least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary antisense RNA sequences, wherein the mutated allele of the endogenous GA3 oxidase gene encodes an mRNA transcript containing the antisense RNA sequence.

29. The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, wherein the reverse DNA segment is present in the intron of the mutant allele of the endogenous GA3 oxidase_1 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_1 gene.

30. The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, wherein the reverse DNA segment is present in the untranslated region (UTR) of the mutant allele of the endogenous GA3 oxidase_1 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_1 gene.

31. The modified maize plant of claim 28, 29 or 30, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase-1 gene is complementary to the 5' untranslated region (5' UTR) of the wild-type allele of the endogenous GA3 oxidase-1 gene.

32. The modified maize plant according to any one of claims 28-31, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 1-29 of SEQ ID NO: 36; (ii) nucleotides 3001-3161 of SEQ ID NO: 168; and / or (iii) SEQ ID NO: Nucleotides 7621-8029 of 174.

33. The modified maize plant of claim 28, 29 or 30, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase-1 gene is complementary to the 3' untranslated region (3' UTR) of the wild-type allele of the endogenous GA3 oxidase-1 gene.

34. The modified maize plant of claim 28, 30, or 33, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 1664-1788 of SEQ ID NO: 36; (ii) nucleotides 4796-5406 of SEQ ID NO: 168; (iii) SEQ ID NO:

36. Nucleotides 9672-10276 of NO:174; and / or (iv) SEQ ID NO:

206.

35. The modified maize plant of claim 28, 29 or 30, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase-1 gene is complementary to the intron of the wild-type allele of the endogenous GA3 oxidase-1 gene.

36. The modified maize plant according to any one of claims 28-30 or 35, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_1 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 515-879 of SEQ ID NO: 36; (ii) nucleotides 1039-1158 of SEQ ID NO: 36; (iii) SEQ ID NO:

36. Nucleotides 3647-4011 of SEQ ID NO: 168; (iv) Nucleotides 4171-4290 of SEQ ID NO: 168; (v) Nucleotides 8515-8887 of SEQ ID NO: 174; and / or (vi) Nucleotides 9047-9166 of SEQ ID NO:

174.

37. The modified maize plant as described in claims 28-30, 35 or 36, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the mutant allele of the endogenous GA3 oxidase_1 gene comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

207.

38. The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_2 gene, wherein the reverse DNA segment is present in the intron of the mutant allele of the endogenous GA3 oxidase_2 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_2 gene.

39. The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_2 gene, wherein the reverse DNA segment is present in the untranslated region (UTR) of the mutant allele of the endogenous GA3 oxidase_2 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_2 gene.

40. The modified maize plant of claim 28, 38 or 39, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to the 5' untranslated region (5' UTR) of the wild-type allele of the endogenous GA3 oxidase_2 gene.

41. The modified maize plant of claim 28 or 38-40, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 1-38 of SEQ ID NO: 37; (ii) nucleotides 3001-3056 of SEQ ID NO: 169; and / or (iii) SEQ ID NO:

38. Nucleotides 7386-7831 of NO:

175.

42. The modified maize plant of claim 28, 38 or 39, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to the 3' untranslated region (3' UTR) of the wild-type allele of the endogenous GA3 oxidase_2 gene.

43. The modified maize plant as claimed in claim 28, 3, 39 or 42, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 1446-1698 of SEQ ID NO: 37; (ii) nucleotides 4464-4581 of SEQ ID NO: 169; and / or (iii) SEQ ID NO: Nucleotides 8862-8967 of 175.

44. The modified maize plant of claim 28, 38 or 39, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to the intron of the wild-type allele of the endogenous GA3 oxidase_2 gene.

45. The modified maize plant according to any one of claims 28, 38, 39, or 44, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_2 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 533-692 of SEQ ID NO: 37; (ii) nucleotides 852-982 of SEQ ID NO: 37; (iii) SEQ ID NO: Nucleotides 3551-3710 of SEQ ID NO: 169; (iv) Nucleotides 3870-3991 of SEQ ID NO: 169; (v) Nucleotides 7927-8086 of SEQ ID NO: 175; and / or (vi) Nucleotides 8246-8371 of SEQ ID NO:

175.

46. ​​The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_3 gene, wherein the reverse DNA segment is present in the intron of the mutant allele of the endogenous GA3 oxidase_3 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_3 gene.

47. The modified maize plant of claim 28, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_3 gene, wherein the reverse DNA segment is present in the untranslated region (UTR) of the mutant allele of the endogenous GA3 oxidase_3 gene, and wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to the intron or untranslated region (UTR) of the wild-type allele of the endogenous GA3 oxidase_3 gene.

48. The modified maize plant of claim 28, 46 or 47, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to the 5' untranslated region (5' UTR) of the wild-type allele of the endogenous GA3 oxidase_3 gene.

49. The modified maize plant of any one of claims 28, 46, 47 or 48, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 2500, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 3001-3130 of SEQ ID NO: 170; and / or (ii) nucleotides 7547-7751 of SEQ ID NO:

176.

50. The modified maize plant of claim 26, 46 or 47, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to the 3' untranslated region (3' UTR) of the wild-type allele of the endogenous GA3 oxidase_3 gene.

51. The modified maize plant of any one of claims 26, 46, 47 or 50, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 2500, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 4275-4332 of SEQ ID NO: 170; and / or (ii) nucleotides 8904-9178 of SEQ ID NO:

176.

52. The modified maize plant of claim 26, 46 or 47, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to the intron of the wild-type allele of the endogenous GA3 oxidase_3 gene.

53. The modified maize plant according to any one of claims 26, 46, 47, or 52, wherein the antisense RNA sequence encoded by the mutant allele of the endogenous GA3 oxidase_3 gene is complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) nucleotides 3484-3582 of SEQ ID NO: 170; (ii) nucleotides 3908-3998 of SEQ ID NO: 170; (iii) SEQ ID NO: Nucleotides 8105-8205 of SEQ ID NO: 176; and / or (iv) SEQ ID NO: Nucleotides 8531-8621 of SEQ ID NO:

176.

54. The modified maize plant according to any one of claims 22-53, wherein the mutant allele of the endogenous GA3 oxidase gene does not contain a DNA segment encoding a sense RNA sequence in the transcribed DNA region of the endogenous GA3 oxidase gene, and the sense RNA sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to an antisense RNA sequence encoded by the reverse DNA segment of the mutant allele of the endogenous GA3 oxidase gene.

55. The modified maize plant according to any one of claims 22-54, wherein the modified maize plant is homozygous for the mutant allele.

56. The modified maize plant of claim 55, wherein the expression level of the endogenous GA3 oxidase gene is the same as or similar to that of the wild-type control maize plant.

57. The modified maize plant as described in claim 55 or 56, wherein the modified maize plant has the same or similar plant height relative to the wild-type control plant.

58. The modified maize plant according to any one of claims 22-57, wherein the modified maize plant is heterozygous for the mutant allele.

59. The modified maize plant of claim 58, wherein the expression level of the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant relative to the wild-type control plant.

60. The modified maize plant of claim 58 or 59, wherein the modified maize plant has a shorter plant height relative to the wild-type control plant.

61. The modified maize plant according to any one of claims 58-60, wherein the modified plant has one or more of the following beneficial traits relative to the wild-type control plant: increased stalk / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower ear height, increased leaf water content, improved drought tolerance, improved nitrogen use efficiency, reduced anthocyanin content and area in leaves under normal or nitrogen- or water-limited stress conditions, increased ear weight, increased harvest index, increased yield, increased seed number, increased seed weight, and increased productivity.

62. The modified maize plant according to any one of claims 58-61, wherein the height of the modified maize plant is at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% shorter than that of the wild-type control plant.

63. The modified maize plant according to any one of claims 58-62, wherein the modified maize plant has a stalk or stem diameter at one or more internodes that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% larger than that of the wild-type control plant.

64. The modified maize plant according to any one of claims 58-63, wherein the level of one or more active GAs in at least one internode tissue of the stem or stalk of the modified maize plant is lower than that in the same internode tissue of the wild-type control plant.

65. The modified maize plant according to any one of claims 58-64, wherein the level of one or more active GA in at least one internode tissue of the stem or stalk of the modified maize plant is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% lower than that in the same internode tissue of the wild-type control plant.

66. The modified maize plant according to any one of claims 22-65, wherein the modified maize plant does not have any significant heteromorphism in at least one female organ or ear.

67. A modified corn plant portion of a modified corn plant as described in any one of claims 22-66.

68. A modified maize plant comprising a mutant allele of an endogenous GA3 oxidase gene, wherein, relative to the wild-type allele of the endogenous GA3 oxidase gene, the mutant allele comprises an edit in the transcribed DNA region of the endogenous GA3 oxidase gene or a deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase gene, and wherein, relative to the wild-type allele of the endogenous GA3 oxidase gene in the modified maize plant or a wild-type control plant, the expression level or activity of mRNA and / or protein encoded by the mutant allele of the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant.

69. The modified maize plant of claim 68, wherein the mutant allele of the endogenous GA3 oxidase gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene.

70. The modified maize plant of claim 68 or 69, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the mutant allele of the endogenous GA3 oxidase_1 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase_1 gene relative to the wild-type allele of the endogenous GA3 oxidase_1 gene.

71. The modified maize plant of claim 70, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_1 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the wild-type allele of the endogenous GA3 oxidase_1 gene, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_1 gene of the wild-type allele comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) one or more of SEQ ID NO: 28, 29, and / or 36; (ii) nucleotides 3001-5406 of SEQ ID NO: 168; and / or (iii) SEQ ID NO: Nucleotides 7621-10276 of SEQ ID NO: 174; and / or (b) identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of each of the following: (i) one or more of SEQ ID NO: 28, 29, and / or 36; (ii) nucleotides 3001-5406 of SEQ ID NO: 168; (iii) nucleotides 7621-10276 of SEQ ID NO: 174; and / or (iv) SEQ ID NO:

206.

72. The modified maize plant of claim 70 or 71, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_1 gene comprises at least a portion of the deletion of an exon or intron sequence or a combination of exon and intron sequences of the wild-type allele of the endogenous GA3 oxidase_1 gene, wherein at least a portion of the deletion in the mutant allele of the endogenous GA3 oxidase_1 gene of the wild-type allele of the endogenous GA3 oxidase_1 gene comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) nucleotides 30-514 of SEQ ID NO: 36; (ii) nucleotides 515-879 of SEQ ID NO: 36; (iii) SEQ ID NO: SEQ ID NO: 36 nucleotides 880-1038; (iv) SEQ ID NO: 36 nucleotides 1039-1158; (v) SEQ ID NO: 36 nucleotides 1159-1663; (vi) SEQ ID NO: 168 nucleotides 3162-3646; (vii) SEQ ID NO: 168 nucleotides 3647-4011; (viii) SEQ ID NO: 168 nucleotides 4012-4170; (ix) SEQ ID NO: 168 nucleotides 4171-4290; (x) SEQ ID NO: 168 nucleotides 4291-4795; (xi) SEQ ID NO: 174 nucleotides 8030-8514; (xii) SEQ ID NO: 174 nucleotides 8515-8887; (xiii) SEQ ID NO: Nucleotides 8888-9046 of SEQ ID NO: 174; (xiv) Nucleotides 9047-9166 of SEQ ID NO: 174; and / or (xv) Nucleotides 9167-9671 of SEQ ID NO: 174; and / or (b) at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides that are identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the following: (i) Nucleotides 30-514 of SEQ ID NO: 36;(ii) SEQ ID NO: 36 nucleotides 515-879; (iii) SEQ ID NO: 36 nucleotides 880-1038; (iv) SEQ ID NO: 36 nucleotides 1039-1158; (v) SEQ ID NO: 36 nucleotides 1159-1663; (vi) SEQ ID NO: 168 nucleotides 3162-3646; (vii) SEQ ID NO: 168 nucleotides 3647-4011; (viii) SEQ ID NO: 168 nucleotides 4012-4170; (ix) SEQ ID NO: 168 nucleotides 4171-4290; (x) SEQ ID NO: 168 nucleotides 4291-4795; (xi) SEQ ID NO: 174 nucleotides 8030-8514; (xii) SEQ ID NO: Nucleotides 8515-8887 of SEQ ID NO: 8888-9046 of SEQ ID NO: 9047-9166 of SEQ ID NO: 174; and / or (xv) SEQ ID NO: 9167-9671 of SEQ ID NO:

174.

73. The modified maize plant of claim 68 or 69, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_2 gene, and wherein the mutant allele of the endogenous GA3 oxidase_2 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase_2 gene relative to the wild-type allele of the endogenous GA3 oxidase_2 gene.

74. The modified maize plant of claim 73, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_2 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the wild-type allele of the endogenous GA3 oxidase_2 gene, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_2 gene of the wild-type allele of the endogenous GA3 oxidase_2 gene comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) one or more of SEQ ID NO: 31, 32, and / or 37; (ii) nucleotides 3001-4581 of SEQ ID NO: 169; and / or (iii) SEQ ID NO: Nucleotides 7386-8967 of SEQ ID NO: 175; and / or (b) being identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides of the following: (i) one or more of SEQ ID NO: 31, 32, and / or 37; (ii) nucleotides 3001-4581 of SEQ ID NO: 169; and / or (iii) nucleotides 7386-8967 of SEQ ID NO:

175.

75. The modified maize plant of claim 73 or 74, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_2 gene comprises at least a portion of the exon or intron sequence or a combination of exon and intron sequences of the wild-type allele of the endogenous GA3 oxidase_2 gene, wherein at least a portion of the exon or intron sequence or the combination of exon and intron sequences of the wild-type allele of the endogenous GA3 oxidase_2 gene deleted in the mutant allele of the endogenous GA3 oxidase_2 gene comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) nucleotides 39-532 of SEQ ID NO: 37; (ii) nucleotides 533-692 of SEQ ID NO: 37; (iii) SEQ ID NO: SEQ ID NO: 37 nucleotides 693-851; (iv) SEQ ID NO: 37 nucleotides 852-982; (v) SEQ ID NO: 37 nucleotides 983-1445; (vi) SEQ ID NO: 169 nucleotides 3057-3550; (vii) SEQ ID NO: 169 nucleotides 3551-3710; (viii) SEQ ID NO: 169 nucleotides 3711-3869; (ix) SEQ ID NO: 169 nucleotides 3870-3991; (x) SEQ ID NO: 169 nucleotides 3992-4463; (xi) SEQ ID NO: 175 nucleotides 7832-7926; (xii) SEQ ID NO: 175 nucleotides 7927-8086; (xiii) SEQ ID NO: Nucleotides 8087-8245 of SEQ ID NO: 8246-8371 of SEQ ID NO: 175; and / or (xv) SEQ ID NO: 8372-8861 of SEQ ID NO: 175; and / or (b) at least 80%, at least 85%, at least 90%, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides of at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical or complementary to at least 20, at least 2500 of the following: (i) Nucleotides 39-532 of SEQ ID NO: 37;(ii) SEQ ID NO: 37 nucleotides 533-692; (iii) SEQ ID NO: 37 nucleotides 693-851; (iv) SEQ ID NO: 37 nucleotides 852-982; (v) SEQ ID NO: 37 nucleotides 983-1445; (vi) SEQ ID NO: 169 nucleotides 3057-3550; (vii) SEQ ID NO: 169 nucleotides 3551-3710; (viii) SEQ ID NO: 169 nucleotides 3711-3869; (ix) SEQ ID NO: 169 nucleotides 3870-3991; (x) SEQ ID NO: 169 nucleotides 3992-4463; (xi) SEQ ID NO: 175 nucleotides 7832-7926; (xii) SEQ ID NO: Nucleotides 7927-8086 of SEQ ID NO: 175; (xiii) SEQ ID NO: 8087-8245 of SEQ ID NO: 175; (xiv) SEQ ID NO: 8246-8371 of SEQ ID NO: 175; and / or (xv) SEQ ID NO: 8372-8861 of SEQ ID NO:

175.

76. The modified maize plant of claim 68 or 69, wherein the endogenous GA3 oxidase gene is an endogenous GA3 oxidase_3 gene, and wherein the mutant allele of the endogenous GA3 oxidase_3 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase_3 gene relative to the wild-type allele of the endogenous GA3 oxidase_3 gene.

77. The modified maize plant of claim 79, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_3 gene comprises a deletion of at least a portion of the transcribed DNA region or coding sequence of the wild-type allele of the endogenous GA3 oxidase_3 gene, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_3 gene of the wild-type allele comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) one or more of SEQ ID NO: 171 and / or 172; (ii) nucleotides 3001-4332 of SEQ ID NO: 170; and / or (iii) SEQ ID NO: Nucleotides 7547-9178 of SEQ ID NO: 176; and / or (b) being identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000 or at least 2500 consecutive nucleotides of the following: (i) one or more of SEQ ID NO: 171 and / or 172; (ii) nucleotides 3001-4332 of SEQ ID NO: 170; and / or (iii) nucleotides 7547-9178 of SEQ ID NO:

176.

78. The modified maize plant of claim 76 or 77, wherein the deletion in the mutant allele of the endogenous GA3 oxidase_3 gene comprises at least a portion of the exon or intron sequence or a combination of exon and intron sequences of the wild-type allele of the endogenous GA3 oxidase_3 gene, wherein at least a portion of the exon or intron sequence or the combination of exon and intron sequences of the wild-type allele of the endogenous GA3 oxidase_3 gene deleted in the mutant allele of the endogenous GA3 oxidase_3 gene comprises a sequence that: (a) is identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the following: (i) nucleotides 3131-3483 of SEQ ID NO: 170; (ii) nucleotides 3484-3582 of SEQ ID NO: 170; (iii) SEQ ID NO:

170. SEQ ID NO: 170 nucleotides 3583-3907; (iv) SEQ ID NO: 170 nucleotides 3908-3998; (v) SEQ ID NO: 170 nucleotides 3999-4274; (vi) SEQ ID NO: 176 nucleotides 7752-8104; (vii) SEQ ID NO: 176 nucleotides 8105-8205; (viii) SEQ ID NO: 176 nucleotides 8206-8530; (ix) SEQ ID NO: 176 nucleotides 8531-8621; and / or (x) SEQ ID NO: Nucleotides 8622-8903 of 176; and / or (b) being identical or complementary to at least 80%, at least 85%, at least 90%, at least 95%, at least 200, at least 250, at least 1000, at least 1500, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 of the following consecutive nucleotides: (i) SEQ ID NO: nucleotides 3131-3483 of 170; (ii) SEQ ID NO: nucleotides 3484-3582 of 170; (iii) SEQ ID NO: nucleotides 3583-3907 of 170; (iv) SEQ ID NO: Nucleotides 3908-3998 of SEQ ID NO: 170; (v) Nucleotides 3999-4274 of SEQ ID NO: 170; (vi) Nucleotides 7752-8104 of SEQ ID NO: 176;(vii) nucleotides 8105-8205 of SEQ ID NO: 176; (viii) nucleotides 8206-8530 of SEQ ID NO: 176; (ix) nucleotides 8531-8621 of SEQ ID NO: 176; and / or (x) nucleotides 8622-8903 of SEQ ID NO:

176.

79. The modified maize plant according to any one of claims 68-78, wherein the deletion in the mutant allele of the endogenous GA3 oxidase gene comprises: (i) Deletion of at least one exon of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene. (ii) the deletion of at least one intron of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene; (iii) the deletion of at least one exon and at least one intron of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene; or (iv) the deletion of the entire coding sequence of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene.

80. The modified maize plant according to any one of claims 68-79, wherein the expression level or activity of the mRNA and / or protein encoded by the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant relative to the wild-type control plant.

81. The modified maize plant as described in any one of claims 68-80, wherein the modified maize plant has a shorter plant height relative to the wild-type control plant.

82. The modified maize plant according to any one of claims 68-81, wherein the expression level of the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant relative to the wild-type control plant.

83. The modified maize plant according to any one of claims 68-82, wherein the modified maize plant has one or more of the following beneficial traits relative to the wild-type control plant: increased stalk / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower ear height, increased leaf water content, improved drought tolerance, improved nitrogen use efficiency, reduced anthocyanin content and area in leaves under normal or nitrogen- or water-limited stress conditions, increased ear weight, increased harvest index, increased yield, increased seed number, increased seed weight, and increased productivity.

84. The modified maize plant as claimed in any one of claims 68-83, wherein the height of the modified maize plant is at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% shorter than that of the wild-type control plant.

85. The modified maize plant according to any one of claims 68-84, wherein the modified maize plant has a stalk or stem diameter at one or more internodes that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40% larger than that of the wild-type control plant.

86. The modified maize plant according to any one of claims 68-85, wherein the level of one or more active GAs in at least one internode tissue of the stem or stalk of the modified maize plant is lower than that in the same internode tissue of the wild-type control plant.

87. The modified maize plant according to any one of claims 68-86, wherein the deletion of the mutant allele is introduced by targeted genome editing technology.

88. The modified maize plant according to any one of claims 68-87, wherein the modified maize plant is heterozygous for the mutant allele.

89. The modified maize plant according to any one of claims 68-87, wherein the modified maize plant is homozygous for the mutant allele.

90. A modified corn plant portion of a modified corn plant as described in any one of claims 68-89.

91. The modified maize plant according to any one of claims 8, 14, 23 and 83, wherein the editing is introduced using a wide range of nucleases, zinc finger nucleases (ZFNs), RNA-guided endonucleases, TALE endonucleases (TALENs), recombinases or transposases.

92. A composition comprising guide RNA, wherein the guide RNA comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 or at least 25 consecutive nucleotides that are at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary to a guide sequence in the upstream region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR) and / or downstream region of an endogenous GA3 oxidase gene of a maize plant.

93. The composition of claim 92, wherein the target DNA sequence is in the upstream region and / or promoter region of the endogenous GA3 oxidase gene.

94. The composition of claim 92 or 93, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-1 gene, and wherein the guide RNA comprises a guide sequence that is the same as or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 1-3000 of SEQ ID NO: 168; (ii) nucleotides 1-7620 of SEQ ID NO: 174; (iii) nucleotides 5621-7620 of SEQ ID NO: 174; and / or (iv) a sequence of SEQ ID NO: 208 or a sequence complementary thereto.

95. The composition of claim 92 or 93, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene, and wherein the guide RNA comprises a guide sequence that is the same as or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 1-3000 of SEQ ID NO: 169; (ii) nucleotides 1-7385 of SEQ ID NO: 175; and / or (iii) nucleotides 5386-7385 of SEQ ID NO: 175, or a sequence complementary to thereto.

96. The composition of claim 92 or 93, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene, and wherein the guide RNA comprises a guide sequence that is the same as or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 1-3000 of SEQ ID NO: 170; (ii) nucleotides 1-7546 of SEQ ID NO: 176; and / or (iii) nucleotides 5547-7546 of SEQ ID NO: 176, or a sequence complementary to thereto.

97. The composition of claim 92, wherein the target DNA sequence is located in the transcribed DNA region of the endogenous GA3 oxidase gene in maize plants.

98. The composition of claim 92 or 97, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-1 gene, and wherein the guide RNA comprises a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) one or more of SEQ ID NO: 28, 29, and / or 36; (ii) nucleotides 3001-5406 of SEQ ID NO: 168; (iii) nucleotides 7621-10276 of SEQ ID NO: 174; and / or (iv) SEQ ID NO: 206 or its complementary sequence.

99. The composition of claim 92 or 97, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene, and wherein the guide RNA comprises a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) one or more of SEQ ID NO: 31, 32, and / or 37; (ii) nucleotides 3001-4581 of SEQ ID NO: 169; and / or (iii) nucleotides 7386-8967 of SEQ ID NO:

175.

100. The composition of claim 92 or 97, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene, and wherein the guide RNA comprises a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) one or more of SEQ ID NO: 171 and / or 172; (ii) nucleotides 3001-4332 of SEQ ID NO: 170; and / or (iii) nucleotides 7547-9178 of SEQ ID NO:

176.

101. The composition of claim 92, wherein the target DNA sequence is in the 5' untranslated region (5' UTR) or the 3' untranslated region (3' UTR) of the endogenous GA3 oxidase gene of maize plants.

102. The composition of claim 92 or 101, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-1 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1-29 of SEQ ID NO: 36; (ii) nucleotides 1664-1788 of SEQ ID NO: 36; (iii) nucleotides 3001-3161 of SEQ ID NO: 168; (iv) SEQ ID NO:

36. Nucleotides 4796-5406 of SEQ ID NO: 168; (v) Nucleotides 7621-8029 of SEQ ID NO: 174; and / or (vi) Nucleotides 9672-10276 of SEQ ID NO:

174.

103. The composition of claim 92 or 101, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1-38 of SEQ ID NO: 37; (ii) nucleotides 1446-1698 of SEQ ID NO: 37; (iii) nucleotides 3001-3056 of SEQ ID NO: 169; (iv) SEQ ID NO:

38. Nucleotides 4464-4581 of SEQ ID NO: 169; (v) nucleotides 7386-7831 of SEQ ID NO: 175; and / or (vi) nucleotides 8862-8967 of SEQ ID NO:

175.

104. The composition of claim 92 or 101, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 3001-3130 of SEQ ID NO: 170; (ii) nucleotides 4275-4332 of SEQ ID NO: 170; (iii) nucleotides 7547-7751 of SEQ ID NO: 176; and / or (iv) SEQ ID NO: Nucleotides 8904-9178 of 176.

105. The composition of claim 92, wherein the target DNA sequence is located downstream of the endogenous GA3 oxidase gene in maize plants.

106. The composition of claim 92 or 105, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_1 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 5407-8406 of SEQ ID NO: 168; and / or (ii) nucleotides 10277-14227 of SEQ ID NO:

174.

107. The composition of claim 92 or 105, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 4582-7581 of SEQ ID NO: 169; and / or (ii) nucleotides 8968-16597 of SEQ ID NO:

175.

108. The composition of claim 92 or 105, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene, and wherein the guide RNA comprises a guide sequence that is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides: (i) nucleotides 4333-7332 of SEQ ID NO: 170; and / or (ii) nucleotides 9179-15354 of SEQ ID NO:

176.

109. A composition comprising a first guide RNA and a second guide RNA, wherein the first guide RNA and the second guide RNA each comprise a first guide sequence and a second guide sequence, wherein... (i) The first guide sequence is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the upstream region and / or promoter region of the endogenous GA3 oxidase gene of maize plants. (ii) The second guide sequence is identical or complementary to at least 90%, 95%, 96%, 97%, 99%, or 100% of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides of the second target DNA sequence in the upstream region and / or promoter region of the endogenous GA3 oxidase gene of maize plants. The first target DNA sequence and the second target DNA sequence are different.

110. A composition comprising a first guide RNA and a second guide RNA, wherein the first guide RNA and the second guide RNA respectively comprise a first guide sequence and a second guide sequence, wherein... (i) The first guide sequence is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the 5' untranslated region (5' UTR) or 3' untranslated region (3' UTR) of the endogenous GA3 oxidase gene of maize plants. (ii) The second guide sequence is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the 5' untranslated region (5'UTR) or the 3' untranslated region (3'UTR) of the endogenous GA3 oxidase gene of the maize plant.

111. The composition of claim 110, wherein the first target DNA sequence and the second target DNA sequence are different.

112. The composition of claim 110 or 111, wherein the first target DNA sequence and the second target DNA sequence are located in the 5' untranslated region (5' UTR) of the endogenous GA3 oxidase gene of maize plants.

113. The composition of claim 110 or 111, wherein the first target DNA sequence and the second target DNA sequence are located in the 3' untranslated region (3' UTR) of the endogenous GA3 oxidase gene of maize plants.

114. The composition of claim 110, 111, or 112, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-1 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of each of the following: (i) nucleotides 1-29 of SEQ ID NO: 36; (ii) nucleotides 3001-3161 of SEQ ID NO: 168; and / or (iii) nucleotides 7621-8029 of SEQ ID NO: 174, or sequences complementary to them. The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1-29 of SEQ ID NO: 36; (ii) nucleotides 3001-3161 of SEQ ID NO: 168; and / or (iii) nucleotides 7621-8029 of SEQ ID NO: 174, or sequences complementary to them.

115. The composition of claim 110, 111, or 113, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-1 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of each of the following: (i) nucleotides 1664-1788 of SEQ ID NO: 36; (ii) nucleotides 4796-5406 of SEQ ID NO: 168; and / or (iii) nucleotides 9672-10276 of SEQ ID NO: 174, or sequences complementary to them. The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1664-1788 of SEQ ID NO: 36; (ii) nucleotides 4796-5406 of SEQ ID NO: 168; and / or (iii) nucleotides 9672-10276 of SEQ ID NO: 174, or sequences complementary to them.

116. The composition of claim 110, 111, or 112, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1-38 of SEQ ID NO: 37; (ii) nucleotides 3001-3056 of SEQ ID NO: 169; and / or (iii) nucleotides 7386-7831 of SEQ ID NO: 175, or sequences complementary to them. The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1-38 of SEQ ID NO: 37; (ii) nucleotides 3001-3056 of SEQ ID NO: 169; and / or (iii) nucleotides 7386-7831 of SEQ ID NO: 175, or sequences complementary to them.

117. The composition of claim 110, 111, or 113, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-2 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of each of the following: (i) nucleotides 1446-1698 of SEQ ID NO: 37; (ii) nucleotides 4464-4581 of SEQ ID NO: 169; and / or (iii) nucleotides 8862-8967 of SEQ ID NO: 175, or sequences complementary to them. The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 1446-1698 of SEQ ID NO: 37; (ii) nucleotides 4464-4581 of SEQ ID NO: 169; and / or (iii) nucleotides 8862-8967 of SEQ ID NO: 175, or sequences complementary to them.

118. The composition of claim 110, 111, or 112, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase_3 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of each of the following: (i) nucleotides 3001-3130 of SEQ ID NO: 170; and / or (ii) nucleotides 7547-7751 of SEQ ID NO: 176, or sequences complementary to them, and The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 3001-3130 of SEQ ID NO: 170; and / or (ii) nucleotides 7547-7751 of SEQ ID NO: 176, or sequences complementary to them.

119. The composition of claim 110, 111, or 113, wherein the endogenous GA3 oxidase gene is the endogenous GA3 oxidase-3 gene. The first guide sequence of the first guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of each of the following: (i) nucleotides 4275-4332 of SEQ ID NO: 170; and / or (ii) nucleotides 8904-9178 of SEQ ID NO: 176, or sequences complementary to them. The second guide sequence of the second guide RNA is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of the following: (i) nucleotides 4275-4332 of SEQ ID NO: 170; and / or (ii) nucleotides 8904-9178 of SEQ ID NO: 176, or sequences complementary to them.

120. A composition comprising a first guide RNA and a second guide RNA, wherein the first guide RNA and the second guide RNA respectively comprise a first guide sequence and a second guide sequence, wherein... (i) The first guide sequence is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the upstream region or transcribed DNA region of the endogenous GA3 oxidase gene of maize plants. (ii) The second guide sequence is identical or complementary to at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the second target DNA sequence in the transcribed DNA region or downstream region.

121. The composition according to any one of claims 92-120, further comprising an RNA-guided endonuclease.

122. The composition of claim 121, wherein, in the presence of the guide RNA or the first guide RNA and / or the second guide RNA, the RNA-guided endonuclease causes a double-strand break or nick at or near the target DNA sequence or the first target DNA sequence and / or the second target DNA sequence in the genome of the maize plant.

123. The composition of claim 121 or 122, further comprising a recombinant DNA donor template, the recombinant DNA donor template comprising at least one homologous sequence or homologous arm, wherein the at least one homologous sequence or homologous arm is complementary to at least 70%, at least 75%, at least 80%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides of a genomic sequence at or near the endogenous GA3 oxidase gene of the maize plant.

124. The composition of claim 123, wherein the genomic sequence at or near the endogenous GA3 oxidase gene of the maize plant is in the upstream region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR), and / or downstream region of the endogenous GA3 oxidase gene.

125. A recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA molecule comprises a guide sequence that is complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a maize plant's endogenous GA3 oxidase gene for at least 95%, at least 96%, at least 97%, at least 99%, or 100%.

126. The recombinant DNA construct of claim 125, wherein the guide RNA comprises a guide sequence that is at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides that are at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to SEQ ID NO: 36, 37, 168, 169, 170, 174, 175, or 176, or their complementary sequences.

127. The recombinant DNA construct of claim 125 or 126, wherein the guide RNA molecule comprises a guide sequence that is at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides.

128. The recombinant DNA construct of claim 125, 126 or 127, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter.

129. The recombinant DNA construct according to any one of claims 125-128, wherein the guide RNA molecule is CRISPR RNA (crRNA) or single-stranded guide RNA (sgRNA).

130. The recombinant DNA construct according to any one of claims 125-129, wherein the guide RNA comprises a sequence complementary to the protospacer neighbor motif (PAM) sequence of the target DNA sequence located at or near the genomic locus of the endogenous GA3 oxidase gene present in the genome of the cereal plant.

131. A recombinant DNA construct comprising a first transcribed DNA sequence encoding a first non-coding guide RNA molecule and a second transcribed DNA sequence encoding a second non-coding guide RNA molecule. The first guide RNA molecule comprises a first guide sequence that is at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a first target DNA sequence in the upstream region, promoter region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR), and / or downstream region of the endogenous GA3 oxidase gene of maize plants. The second guide RNA molecule comprises a second guide sequence that is at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a second target DNA sequence in the upstream region, the promoter region, the transcribed DNA region, the 5' untranslated region (5' UTR), the 3' untranslated region (3' UTR), and / or the downstream region of the endogenous GA3 oxidase gene of maize plants. The first target DNA sequence and the second target DNA sequence are different.

132. The recombinant DNA construct of claim 131, wherein the first transcribed DNA sequence is operatively linked to a first plant-expressible promoter, and the second transcribed DNA sequence is operatively linked to a second plant-expressible promoter.

133. The composition of any one of claims 92-124 or the recombinant DNA construct of any one of claims 125-132, wherein the endogenous GA3 oxidase gene encodes a protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identical to SEQ ID NO: 30, 33, or 173.

134. A DNA molecule or vector comprising a recombinant DNA construct as described in any one of claims 125-132.

135. A bacterium or host cell comprising a recombinant DNA construct as described in any one of claims 125-132.

136. A maize plant, plant part or plant cell comprising a composition as described in any one of claims 92-124 or a recombinant DNA construct as described in any one of claims 125-132.

137. A composition comprising a recombinant DNA construct as described in any one of claims 125-132, wherein the composition further comprises an RNA-guided endonuclease.

138. A composition comprising a recombinant DNA construct as described in any one of claims 125-132, wherein the composition further comprises a second recombinant DNA construct comprising a second transcribed DNA sequence encoding an RNA-guided endonuclease.

139. The composition of claim 138, comprising a DNA molecule or vector containing the recombinant DNA construct and the second recombinant DNA construct.

140. A composition comprising a first DNA molecule or vector and a second DNA molecule or vector, wherein the first DNA molecule or vector comprises a recombinant DNA construct as described in any one of claims 125-132, and the second DNA molecule or vector comprises a second recombinant DNA construct encoding an RNA-guided endonuclease.

141. The composition of claim 138, 139, or 140, further comprising a recombinant DNA donor template, the recombinant DNA donor template comprising at least one homologous sequence or homologous arm, wherein the at least one homologous sequence or homologous arm is complementary to at least 70%, at least 75%, at least 80%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides of a genomic sequence at or near the endogenous GA3 oxidase gene of a maize plant.

142. The composition of claim 141, wherein the genomic sequence at or near the endogenous GA3 oxidase gene of the maize plant is in the upstream region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR), and / or downstream region of the endogenous GA3 oxidase gene.

143. A recombinant DNA donor template comprising at least one homologous sequence, wherein the at least one homologous sequence is complementary to at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 200%, at least 250%, at least 500%, at least 1000%, at least 1500%, at least 2000%, at least 2500%, at least 500%, at least 1000%, at least 1500%, at least 2000, at least 2500, or at least 5000 consecutive nucleotides at or near the endogenous GA3 oxidase gene of a maize plant.

144. The recombinant DNA donor template of claim 143, wherein the at least one homologous sequence is identical or complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, at least 5000, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides of SEQ ID NO: 36, 37, 168, 169, 170, 174, 175, or 176, or their complementary sequences.

145. The recombinant DNA donor template of claim 143 or 144, wherein the at least one homologous sequence is identical or complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides.

146. A recombinant DNA donor template comprising at least one homologous sequence and an insert sequence, wherein the at least one homologous sequence is complementary to at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 200%, at least 250%, at least 500%, at least 1000%, at least 1500%, at least 2000%, at least 2500%, at least 500%, at least 1000%, at least 1500%, at least 2000, at least 2500, or at least 5000 consecutive nucleotides of a genomic sequence at or near an endogenous GA3 oxidase gene in a maize plant.

147. The recombinant DNA donor template of any one of claims 143-146, further comprising a second homologous arm, wherein the second homologous arm comprises a second homologous sequence complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% of a second genomic sequence at or near the genomic locus of the endogenous GA3 oxidase gene of maize plant.

148. The recombinant DNA donor template of claim 147, wherein the second homologous sequence is identical or complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides.

149. The recombinant DNA donor template of claim 147, wherein the second homologous sequence is identical or complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, or at least 5000 consecutive nucleotides.

150. A maize plant, plant part or plant cell comprising a recombinant DNA donor template as described in any one of claims 143-149.

151. An engineered site-specific nuclease that binds to a target site in the upstream region, promoter region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR), or downstream region of the endogenous GA3 oxidase gene of maize plants, and causes a double-strand break or nick at the target site.

152. The engineered site-specific nuclease of claim 151, wherein the site-specific nuclease is a broad-spectrum nuclease or a homing endonuclease, a zinc finger nuclease (ZFN) containing a DNA-binding domain and a cleavage domain, or a transcription activator-like effector nuclease (TALEN) containing a DNA-binding domain and a cleavage domain.

153. A recombinant DNA construct comprising a transcribed DNA sequence encoding a site-specific nuclease, wherein the site-specific nuclease binds to a target site in an upstream region, promoter region, transcribed DNA region, 5' untranslated region (5' UTR), 3' untranslated region (3' UTR), or downstream region of an endogenous GA3 oxidase gene from maize plants, and causes a double-strand break or nick at the target site.

154. The recombinant DNA construct of claim 153, wherein the transcribed DNA sequence is operatively linked to a plant-expressible promoter.

155. The recombinant DNA construct of claim 153 or 154, wherein the site-specific nuclease is a broad-spectrum nuclease or a homing endonuclease, a zinc finger nuclease, or a transcription activator-like effector nuclease (TALEN).

156. A maize plant, plant part or plant cell comprising the recombinant DNA construct as described in claim 153, 154 or 155.

157. A method for producing modified maize plants, comprising: (a) Introducing a site-specific nuclease or a recombinant DNA molecule containing a transgene encoding the site-specific nuclease into at least one cell of an explant of the maize plant, wherein the site-specific nuclease binds to the upstream region or promoter region of an endogenous GA3 oxidase gene and causes a double-strand break or nick at the target site, and (b) Regeneration or development of a modified maize plant from at least one explant cell containing a mutant allele of the endogenous GA3 oxidase gene, wherein, relative to the wild-type allele of the endogenous GA3 oxidase gene, the mutant allele contains genome editing in the upstream region or the promoter region of the endogenous GA3 oxidase gene of the modified maize plant, or deletion of at least a portion of the transcribed DNA region or coding sequence of the endogenous GA3 oxidase gene.

158. The method of claim 157, wherein the introduction step (a) further comprises introducing a non-coding guide RNA molecule or a second recombinant DNA construct comprising a transcribed DNA sequence encoding a non-coding guide RNA molecule, wherein the site-specific nuclease is an RNA-guided endonuclease, and wherein the guide RNA molecule comprises a guide sequence that is complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a target DNA sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100%.

159. A method for producing modified maize plants, comprising: (a) Introducing at least one site-specific nuclease or a recombinant DNA molecule containing at least one transgene encoding a site-specific nuclease into at least one cell of an explant of a maize plant, wherein the site-specific nuclease binds to a target site in the transcribed or untranslated (UTR) region of the endogenous GA3 oxidase gene and causes a double-strand break or nick at the target site, and (b) Regeneration or development of modified maize plants from at least one explant cell containing a mutant allele of the endogenous GA3 oxidase gene, wherein the mutant allele contains a reversed DNA segment in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene of the modified maize plant. The reverse DNA segment encodes an antisense RNA sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to the transcribed DNA region of the wild-type allele of the endogenous GA3 oxidase gene and / or to the mRNA molecule encoded by the wild-type allele of the endogenous GA3 oxidase gene, and at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 2500, at least 500, at least 1000, at least 1500, at least 2000, or at least 2500 consecutive nucleotides. The mutated allele of the endogenous GA3 oxidase gene encodes an mRNA transcript containing the antisense RNA sequence.

160. The method of claim 159, wherein the introduction step (a) further comprises introducing a second site-specific nuclease or a recombinant DNA molecule comprising a second transgene encoding a second site-specific nuclease into the at least one cell, wherein the site-specific nuclease binds to a second target site in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene and causes a double-strand break or nick at the target site.

161. The method of claim 160, wherein the reverse DNA segment in the mutant allele of the endogenous GA3 oxidase gene of the modified maize plant is located between the first target site and the second target site in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene.

162. The method of claim 159, wherein the introduction step (a) further comprises introducing into the at least one cell (i) a first non-coding guide RNA molecule or a first recombinant DNA construct comprising a first transcribed DNA sequence encoding the first non-coding guide RNA molecule, and (ii) a second non-coding guide RNA molecule or a second recombinant DNA construct comprising a second transcribed DNA sequence encoding the second non-coding guide RNA molecule, wherein the site-specific nuclease is an RNA-guided endonuclease. The first guide RNA molecule comprises a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene of maize plants. The second guide RNA molecule contains a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99%, or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene of maize plants.

163. The method of claim 162, wherein the reverse DNA segment in the mutant allele of the endogenous GA3 oxidase gene of the modified maize plant is located between the first target DNA sequence and the second target DNA sequence in the transcribed DNA region or the untranslated region (UTR) of the endogenous GA3 oxidase gene.

164. The method of any one of claims 159-163, further comprising: (c) Select the modified maize plant.

165. The method of claim 164, wherein the selection step (c) comprises using molecular assays to determine whether the endogenous GA3 oxidase gene locus of the modified maize plant contains the mutant allele of the endogenous GA3 oxidase gene.

166. The method of claim 164 or 165, wherein the selection step (c) comprises determining, by observing the plant phenotype, whether the endogenous GA3 oxidase gene locus of the modified maize plant contains the mutant allele of the endogenous GA3 oxidase gene.

167. The method of claim 164, 165 or 166, wherein the selection step (c) includes determining whether the modified maize plant has a shorter plant height relative to the wild-type control plant.

168. The method of any one of claims 159-167, wherein the modified maize plant or its progeny containing the mutant allele of the endogenous GA3 oxidase gene has one or more of the following beneficial traits relative to the wild-type control plant: increased stalk / stem diameter, improved lodging resistance, reduced immature breakage, deeper roots, increased leaf area, earlier canopy closure, higher stomatal conductance, lower ear height, increased leaf water content, improved drought tolerance, improved nitrogen use efficiency, reduced anthocyanin content and area in leaves under normal or nitrogen- or water-limited stress conditions, increased ear weight, increased harvest index, increased yield, increased seed quantity, increased seed weight, and / or increased productivity.

169. The method of any one of claims 159-167, wherein the level of one or more active GAs in at least one internode tissue of the stem or stalk of the modified maize plant or its progeny plant comprising the mutant allele of the endogenous GA3 oxidase gene is lower than that in the same internode tissue of the wild-type control plant.

170. The method of any one of claims 159-169, wherein the site-specific nuclease is a broad-spectrum nuclease, a zinc finger nuclease (ZFN), an RNA-guided endonuclease, a TALE endonuclease (TALEN), a recombinase, or a transposase.

171. The method of any one of claims 159-170, wherein the activity and / or expression level of the mRNA and / or protein encoded by the mutant allele of the endogenous GA3 oxidase gene is reduced or eliminated in the modified maize plant or its progeny containing the mutant allele of the endogenous GA3 oxidase gene relative to the wild-type allele of the endogenous GA3 oxidase gene.

172. The method of any one of claims 159-171, wherein the modified maize plant or its progeny containing the mutant allele of the endogenous GA3 oxidase gene does not have any significant heteromorphism in at least one female organ or ear.

173. A modified maize plant produced by the method of any one of claims 159-172.

Images