Bacillus velezensis strain Bac2 and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly discloses a bacillus velezensis strain Bac2 and application thereof.The strain Bac2 is separated from soil and preserved in the China Center for Type Culture Collection on May 15, 2025, and the preservation number is CCTCC NO. M 20251062. The bacillus velezensis strain Bac2 is named as Bacillus velezensis. The Bac2 strain grows rapidly, has an obvious inhibition effect on fungi and bacteria and is sensitive to various antibiotics, pot experiments on cucumber fusarium wilt and tomato bacterial wilt show that the Bac2 strain has a good effect on prevention and control of the two soil-borne diseases, and wide prospects are provided for application of the Bac2 strain in various fields.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to the research on isolates of bacterial strains, particularly to a strain of Bacillus belyssus Bac2 and its application. Background Technology

[0002] In agriculture, biological stress factors such as pathogens and pests cause global crop yield losses of approximately 20-30%, and the application of chemical pesticides is currently the primary means of controlling pathogens and pests. However, many compounds used in chemical control lead to soil and water pollution and pesticide residues in agricultural products, posing significant negative impacts on human health and the environment. In this context, biological control methods based on antibacterial activity show great potential for application in ecological agriculture.

[0003] Bacillus spp. are widely distributed in nature and are beneficial microorganisms with significant control effects on plant diseases, especially soil-borne diseases. In recent years, Bacillus velezensis has been widely reported by many scholars and is a hot research topic in biocontrol bacteria. It has many advantages such as broad antibacterial spectrum, strong stability, and high adaptability, and has great potential for the development of biological control agents. Current research shows that the metabolites of Bacillus velezensis play a key role in inhibiting the growth of various plant pathogens and promoting plant growth. It can also induce resistance in plants to various diseases, making it an effective alternative to chemical pesticides in application.

[0004] However, the reported antibacterial agricultural properties of Bacillus belyi are not comprehensive and still have room for improvement. Therefore, there is a need in this field to develop more new strains of Bacillus belyi that possess both broad-spectrum antibacterial properties and excellent agricultural properties such as controlling plant diseases and promoting plant development. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a Bacillus vesiculosus strain, Bac2, which was isolated from soil. This strain is sensitive to multiple antibiotics and has shown good control effects against cucumber wilt and tomato bacterial wilt in pot experiments, thus providing broad prospects for its application in multiple fields.

[0006] This invention is achieved through the following technical solution: A strain of Bacillus velezensis, Bac2, was deposited at the China Center for Type Culture Collection on May 15, 2025, with accession number CCTCC NO. M 20251062.

[0007] Furthermore, the present invention claims protection for an agricultural microbial agent comprising the aforementioned strain Bac2.

[0008] Furthermore, the present invention claims protection for an antibacterial agent comprising the above-mentioned strain Bac2.

[0009] Furthermore, the present invention claims protection for a plant growth promoter comprising the aforementioned strain Bac2.

[0010] Furthermore, the present invention claims protection for the fermentation products of the above-mentioned strain Bac2.

[0011] A further improvement to the present invention is as follows: The application of the above-mentioned strain Bac2, or agricultural inoculants or fermentation products in the control of plant diseases.

[0012] Furthermore, the plant disease mentioned is bacterial wilt of tomato or wilt of cucumber.

[0013] A further improvement of the present invention is as follows: The application of the above-mentioned strain Bac2, or antibacterial agents or fermentation products in inhibiting plant pathogens.

[0014] Furthermore, the plant pathogens are Ralstonia solanacearum, Staphylococcus aureus, Enterobacter flexneri, Rhodococcus equi, Caulis luteus, Bacillus cereus, Bacillus mycosis fungoides, Staphylococcus aureus, Escherichia coli, Salmonella, or Proteus.

[0015] A further improvement to the present invention is as follows: The application of the above-mentioned strain Bac2, or plant growth promoters or fermentation products in promoting plant growth and development.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention successfully isolated and identified a highly resistant strain, Bac2, from soil samples. Biological and molecular biological analyses confirmed it to be *Bacillus velezensis*. The proposed Bac2 strain grows rapidly, exhibits tolerance to acidity, alkalinity, high temperatures, and bile salts, and demonstrates significant inhibitory effects against selected fungi and bacteria. Furthermore, it is sensitive to multiple antibiotics. Pot experiments on cucumber wilt and tomato bacterial wilt showed good control effects against these two soil-borne diseases, providing broad prospects for its application in various fields. Attached Figure Description

[0017] Figure 1 The image shows the colony morphology and Gram staining results of strain Bac2. Among them, a represents the colony morphology after 10 hours of culture, b represents the colony morphology after 18 hours of culture, and c represents Gram staining. Figure 2 A phylogenetic tree diagram constructed based on 16S rDNA (a), gyr A-ba (b), and rpoB (c); Figure 3 This is a diagram showing the biofilm formation state of strain Bac2. Figure 4 This is a schematic diagram showing the results of the in-plate confrontation of strain Bac2 fungal resistance; The top row shows the fungal control; the bottom row shows the co-culture of strain Bac2 with fungi in a dish. Figure 5 A schematic diagram showing the disease index of different treatment groups of tomatoes and the control group; Figure 6 A schematic diagram showing the comparison of cucumber leaves in different treatment groups; Figure 7 A comparative graph showing the plant height, stem diameter, and flowering status of tomato groups under different treatments; Figure 8 Comparison of growth status of cucumbers aged 40-45 days under different treatments; Figure 9 Results of soil urease and catalase activity in three samples from the tomato group; Figure 10 The results of soil urease, catalase, and sucrase activity were obtained from three samplings of the cucumber group. Detailed Implementation

[0018] The present invention will now be described in detail with reference to specific embodiments.

[0019] Example 1: Acquisition and Identification of Strains Bac2 Acquisition: Bacillus velezensis strain Bac2 was isolated and purified from soil within the campus of Huaiyin Normal University in Jiangsu Province.

[0020] Identification: Bac2 strain preserved in glycerol was streaked onto LB solid medium and incubated at 37°C for 24 h. Colony shape, color, luster, and edge morphology were observed. Bac2 cells were picked for Gram staining, and their structural characteristics were observed under a microscope.

[0021] After 10 hours of culture on LB medium, strain Bac2 was found to be a translucent, semi-moist, round shape with neat edges and no obvious serrations. Figure 1 a) After 18 hours of incubation, the colonies are milky white, round or oval, opaque, and smooth. After 18 hours of incubation, they become wrinkled with neat edges. Figure 1 b). Gram-positive bacilli as observed under a microscope (after staining). Figure 1 c).

[0022] Genomic DNA was extracted from the strain using a thermal lysis method. The 16S rDNA, gyr A, and rpo B genes were amplified by PCR. Primer information is shown in Table 1. The amplified products were detected by 1% agarose gel electrophoresis. Positive PCR products were selected for sequencing, and the results were analyzed for homology comparison on the NCBI website. A phylogenetic tree was constructed using MEGA11.

[0023] Table 1 Primer Sequences

[0024] A search on NCBI Blastn and a homology comparison analysis with the Gen Bank database revealed that strain Bac2 is Bacillus velezensis. The data was uploaded to the National Microbiology Science Data Center, with the accession number NMDCNO006GF2.

[0025] The 16S rDNA sequence of strain Bac2 is as follows: The gyrA sequence of strain Bac2 is The rpoB sequence of strain Bac2 is GGAACTCTGCAATCATTCCGTATCGGTTTAAGCCGGATGGAACGTGTCGTACGTGAAAGAATGTCTATTCAAGACACGAATACAATTACGCCGCAGCAGCTGATTAACATCAGACCTGTTATTGCGTCTATTAAAGAGTTCTTCGGAAGCTCACAGCTTTCTCAATTCATGGATCAGACGAACCCGCTTGCTGAATTGACGCACAAACGCCGTCTGTCAGCTCTCGGACCGGGCGGTTTGACACGTGAGCGCGCAGGGATGGAAGTACGTGACGTTCACTACTCTCACTACGGCCGTATGTGTCCGATTGAAACGCCTGAGGGCCCGAACATCGGTTTGATCAACTCATTGTCATCATTTGCGAAAGTAAACCGCTTTGGTTTCATTGAGACGCCATACCGCCGCGTTGATCCTGAAACAGGAAAAGTAACGCCTAGAATCGATTACCTGACTGCTGATGAAGAGGATAACTATGTCGTAGCCCAAGCGAATGCTAAGCTGAGCGATGACGGTTCTTTCTTGGATGACAGCATCGTAGCGCGTTTCAGAGGGGAAAACACCGTTGTAGCCCGCAACCGAGTGGATTACATGGACGTATCTCCTAAACAGGTTGTATCTGCTGCGACAGCATGTATTCCGTTCTTGGAAAACGATGACTCGAACCGCGCCCTCATGGGAGCGAACATGCAGCGTCAGGCTGTGCCTTTGATGCAGCCGGAAGCTCCGATCGTCGGAACGGGTATGGAATACGTATCCGGTAAAGACTCCGGTGCAGCCGTTATTTGTAAACACCCTGGTATCGTAGAACGGGTGGAAGCGAAAAACGTATGGGTGCGCCGCTATGAAGAAATTGACGGCCAAAAAGTAAAAGGCAACCTGGATAAGTACAGCTTGCTGAAATTTGTCCGCTCCAACCAGGGACGTGCTACACCAGCGTCAATCGTCAGTGCCGGGATGAAG Example 2: Biofilm formation ability

[0026] Take 1 ml of Bac2 in the logarithmic phase and place it in a 24-well plate. Use sterile LB medium as a blank control and incubate it statically in an incubator at 37 °C for 24 h; aspirate the culture medium, wash it 3 times with sterile PBS, add methanol in a fume hood to fix it for 15 min; aspirate the methanol and let it air dry naturally; add 1 ml of crystal violet solution to each well and stain it at room temperature for 10 min, aspirate the excess crystal violet staining solution and wash it with sterile PBS multiple times until there is no excess dye residue, and place it in an oven at 55 °C to dry the moisture; add 1 ml of pre-prepared 33% acetic acid solution to each well, pipette it evenly, and place it in an incubator at 37 °C to react for 20 min to dissolve the residual substances. Measure the OD590 value of the solution in the culture wells using an enzyme-linked immunosorbent assay (ELISA) reader. The criteria for judging the biofilm formation ability of the strain are as follows: if OD < 2ODc, the strain has no biofilm formation ability; if ODc < OD ≤ 2ODc, the strain is a weak biofilm-forming strain; if 2ODc < OD ≤ 4ODc, the strain is a medium biofilm-forming strain; if 4ODc < OD, the strain is a strong biofilm-forming strain; where ODc is the OD590 value of the control well.

[0027] The formation of biofilms by strains can maintain the stability of the strains and tolerate extreme environments, which is beneficial to the survival of the strains. Strain Bac2 can form visible biofilms ( Figure 3 ). In this experiment, the crystal violet staining method was used to further measure the biofilm production ability of Bac2. The results showed that the average OD

[0030] , Figure 4 , Figure 4 value of the Bac2 group was 4.72, and the average ODc value of the control group was only 0.131, far exceeding 4 times the ODc value, indicating that it is a strong biofilm-forming strain.

[0028] Example 3: Resistance of strain Bac2 to fungi and bacteria

[0029] Pick a single colony and inoculate it into 80 mL of LB liquid medium. Incubate it at 37 °C and 180 r / min for 8 h to prepare a seed solution. Take 100 mL of the seed solution and inoculate it into 80 mL of LB liquid medium. Incubate it at 37 °C and 180 r / min for 24 h, centrifuge it at 4 °C and 6000 r / min for 10 min to obtain the supernatant, and filter and sterilize it with a 0.22 μm bacterial filter to obtain the sterile fermentation broth of the strain. The Oxford cup method was used to measure the antibacterial ability of the fermentation broth against 98 test bacteria. The plate confrontation method was used to confront the antagonistic strain with plant fungi in a constant temperature incubator at 28 °C. Use the addition of an equal volume of blank culture medium in the wells as a control, and repeat each treatment 3 times.

[0030] The test results of the antibacterial activity of the bacterial cells are shown in Figure 4 and are from Figure 4It can be seen that strain Bac2 has a significant inhibitory effect on Fusarium graminearum, wheat caking, rice caking, Fusarium moniliforme, Fusarium oxysporum cucumber-specific type, and wheat root rot fungus.

[0031] As shown in Table 3, strain Bac2 has inhibitory effects on Ralstonia solanacearum, Staphylococcus aureus, Enterobacter flexneri, and Rhodococcus equi. It also has excellent antibacterial effects against Strychnos lutea, Bacillus cereus, Bacillus mycosis fungoides, and Staphylococcus aureus. In addition, it has a broad-spectrum antibacterial ability against Escherichia coli, Salmonella, and Proteus, but it has no effect on Pseudomonas aeruginosa and Putrefactive bacteria.

[0032] Table 3 Antibacterial activity of strain Bac2

[0033] *a: 27 out of 56 Escherichia coli strains showed positive inhibition results, with the average inhibition zone value being [missing information]. *b: 19 out of 30 Salmonella strains showed positive inhibition results; the average value of the inhibition zone... *c: 5 strains of Proteus showed positive inhibition results, with an average inhibition zone value of [missing information]. Example 4: Drug resistance of strain Bac2

[0034] In accordance with the drug susceptibility testing requirements and standards issued by the US NCCLS, the susceptibility characteristics of the antagonistic strain Bac2 to 20 antimicrobial agents were detected using the disk agar diffusion method (KB method). A single colony of strain Bac2 was streaked onto a full-plate, and drug susceptibility test disks were evenly applied to the surface of the culture medium using sterile forceps. After incubation at 37°C for 12 h, the diameter of the inhibition zone (mm) was measured.

[0035] The "Guidelines for the Evaluation of Probiotics in Food" recommends that the determination of antibiotic resistance is necessary when assessing the safety of probiotic strains. Antibiotic resistance was tested using antibiotic susceptibility testing tablets. The results showed that strain Bac2, except for its lack of sensitivity to aztreonam, exhibited significant sensitivity to 17 antibiotics, including cefotaxime and sulfamethoxazole / trimethoprim (see Table 4).

[0036] Table 4. Results of drug susceptibility testing for strain Bac2

[0037] Example 5: Pot Experiment on the Control of Bacterial Wilt in Tomato and Fusarium Wilt in Cucumber

[0038] Tomato seedlings with five true leaves were removed from the trays and planted in round pots containing a 3:1 volume ratio of soil and sand, with 500 g of substrate per pot. One week after transplanting, the seedlings were treated with Ralstonia solanacearum and Bac2 inoculant. The treatments were divided into three groups: a blank control (CK), a positive stress treatment with Ralstonia solanacearum (RB), and a Bac2 + Ralstonia solanacearum treatment (KRB). Each treatment was further divided into three subgroups (repeated three times), with six pots in each subgroup. Specifically: The root drenching inoculation method was used, with 20 mL of a 2×10⁻⁶ solution. 9 cfu·mL -1 Bac2 bacterial solution was slowly poured into the KRB-treated soil along the stem above the tomato roots. The other two treatments were treated with an equal volume of sterile water. The antagonistic bacteria were allowed to adapt and multiply at the tomato roots for 3 days, and the biocontrol bacteria were allowed to grow and multiply for 3 days. Then, 20 mL of a solution with a concentration of 2.5 × 10⁻⁶ was poured into the soil. 9 cfu·mL -1 Bacterial wilt pathogen solution was slowly poured into the RB and KRB treatments along the stem above the tomato roots, while the CK treatment was poured with an equal volume of sterile water. Growth was recorded for each treatment over a 15-day observation period. Disease incidence was assessed and the disease index and control effect were calculated every 5 days. Simultaneously, 12 plants from each treatment were selected (measured on days 5, 10, and 13) to measure plant height and stem diameter, and their average values ​​were recorded. Flowering and fruiting were observed and recorded for each treatment.

[0039] Tomato rhizosphere soil samples were collected three times. The first sampling began on the 7th day after the seedlings were transplanted into round pots. The second sampling was conducted 3 days after the plants were inoculated with Bac2 (starting on the 8th day). The third sampling was conducted 3 days after the plants were inoculated with pathogens (Ralstonia solanacearum for tomatoes and Fusarium oxysporum cucumber-specific strain for cucumbers) through root irrigation. The activities of urease, catalase, and sucrase in the soil were measured.

[0040] In the pot experiment on the control of cucumber wilt disease, the pathogen used was Fusarium moniliforme cucumber-specific type. Other operations were roughly the same as those described above, and will not be repeated here.

[0041] The results of the tomato pot experiment showed that ( Figure 5 After 15 days of treatment, the disease index of the KRB treatment decreased from 12.01% to 6.66%, which was lower than that of the CK and RB treatments, and the control effect of Bacillus belyssus Bac2 reached 40.12%.

[0042] The results of the cucumber pot experiment are shown in Table 5 and Figure 5 .

[0043] Table 5. Statistics on disease incidence in cucumber seedlings after treatment with pathogenic bacteria.

[0044] Example 6: Effects of strain Bac2 on plant growth and development

[0045] like Figure 7 As shown, the average plant height and stem diameter of the tomatoes in the Bac2 treatment group were significantly better than those in the Ralstonia solanacearum group and the blank control group. At the same time, the tomatoes in the treatment group flowered earlier and in greater numbers, which has a certain effect on promoting the growth and development of the tomatoes.

[0046] like Figure 8 As shown in Table 6, the cucumber plants in the Bac2 treatment group showed the best growth. There were significant differences between the Bac2 treatment group and the blank control group and the Fusarium oxysporum group in terms of cucumber plant height, stem diameter, fruit longitudinal diameter, and fruit transverse diameter, indicating that Bacillus vesiculosus has a significant growth-promoting effect on cucumber plants.

[0047] Table 6. Growth status of cucumber seedlings aged 40-45 days

[0048] Note: The same letter indicates no significant difference between groups under the same enzyme type (p ≥ 0.05), and different letters indicate significant differences (p < 0.05). Figure 9 The results showed that the Bac2 group of tomatoes increased the activities of soil catalase and urease. Figure 10 The results showed that the cucumber group had significantly increased urease, catalase and urease activities under the action of Bac2, indicating that Bac2 has a good effect on improving soil fertility and structure.

[0049] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent transformations or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A strain of Bacillus velezensis, Bac2, characterized in that, It was deposited at the China Center for Type Culture Collection on May 15, 2025, with accession number CCTCC NO. M 20251062.

2. An agricultural microbial agent, characterized in that, It includes the strain Bac2 as described in claim 1.

3. An antibacterial agent, characterized in that, It includes the strain Bac2 as described in claim 1.

4. A plant growth promoter, characterized in that, It includes the strain Bac2 as described in claim 1.

5. The fermentation product of strain Bac2 as described in claim 1.

6. The application of the strain Bac2 as described in claim 1, the agricultural microbial agent as described in claim 2, or the fermentation product as described in claim 5 in the control of plant diseases.

7. The application according to claim 6, characterized in that: The plant disease mentioned is bacterial wilt of tomato or wilt of cucumber.

8. The application of the strain Bac2 as described in claim 1, the antibacterial agent as described in claim 3, or the fermentation product as described in claim 5 in inhibiting plant pathogens.

9. The application according to claim 8, characterized in that: The plant pathogens mentioned are Ralstonia solanacearum, Staphylococcus aureus, Enterobacter flexneri, Rhodococcus equi, Sterculia vesicola, Bacillus cereus, Bacillus mycosis fungoides, Staphylococcus, Escherichia coli, Salmonella, or Proteus.

10. The use of the strain Bac2 as described in claim 1, the plant growth promoter as described in claim 4, or the fermentation product as described in claim 5 in promoting plant growth and development.

Images