NK cell with IL-27R alpha gene knocked out and application of NK cell
By knocking out the IL-27Rα gene in NK cells, the problem of tumor microenvironment inhibiting NK cells was solved, and the killing ability of NK cells against tumors was enhanced.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGDONG VITALIFE BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-12-01
- Publication Date
- 2026-04-24
AI Technical Summary
In the treatment of solid tumors, the tumor microenvironment weakens the infiltration and persistence of NK cells, and IL-35 inhibits the proliferation and cytotoxic function of NK cells, thus affecting the ability of NK cells to kill tumors.
By knocking out the IL-27Rα gene in NK cells, the negative effects of IL-35 can be avoided, thereby enhancing the killing function of NK cells.
It enhances the tumor-killing ability of NK cells, improves the effect of NK cells in the tumor microenvironment, and strengthens the tumor-killing function.
Smart Images

Figure CN121914973A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of gene editing, specifically relating to an NK cell with the IL-27Rα gene knocked out and its application. Background Technology
[0002] Natural killer (NK) cells play a crucial role in immune defense, immune surveillance, and immune regulation, eliminating invading, infected, and tumor cells using their own functions. Furthermore, because NK cells are not MHC-restricted, they are an important factor in allogeneic therapy. The two most common subsets of NK cells are CD56 and CD66. bright CD16 - and CD56 dim CD16 + CD56 in peripheral blood bright The number is relatively small (90% of NK cells in peripheral blood circulation are CD56). dim CD56 can produce large amounts of cytokines, but its cytotoxicity is relatively weak. dim CD16 + NK cells can ultimately induce apoptosis in target cells through granzyme B and perforin exocytosis. However, in NK cell therapy for solid tumors, the tumor microenvironment severely weakens NK cell infiltration and persistence, thereby reducing NK cell-mediated cytotoxicity. Therefore, whether NK cells can benefit from the treatment of solid tumors depends not only on their ability to migrate within the tumor microenvironment but also on their resistance to its negative influences. The tumor microenvironment, composed of the extracellular matrix and non-malignant stromal cells, contains cells and cytokines that significantly affect the infiltration and proliferation of immune cells.
[0003] Interleukin-35 (IL-35) is an IL-12 family cytokine. Other members of this family are heterodimers composed of α (p40 and EBI3) and β (p19, p28, and p35) chain subunits. Unlike other IL-12 family members, IL-35 has been shown to possess immunosuppressive activity. It plays a crucial role in the development of various solid tumors, including hepatocellular carcinoma, advanced breast cancer, and pancreatic ductal adenocarcinoma. Tumor-derived Tregs have been shown to secrete IL-35, which induces CD4+ T and CD8+ T cell exhaustion, reducing antitumor activity. Recent studies have shown that IL-35 inhibits NK cell proliferation and cytotoxicity while promoting the secretion of TGF-β and in vitro angiogenesis factors. Long-term exposure leads to the transformation of NK cells into innate lymphocytes, resulting in the loss of antitumor activity. The IL-35 receptor is a heterodimer or homodimer composed of GP130, IL-12Rβ2, or IL-27Rα, which are activated via the STAT protein signaling pathway. The specific subunit of the IL-27 receptor, IL-27Rα, is highly expressed on T cells and macrophages and is involved in a variety of inflammatory diseases. Recent studies have shown that NK cells cultured in vitro highly express IL-27Rα.
[0004] Therefore, there is a need for an NK cell that can effectively avoid the negative effects of IL-35 and enhance the killing function of NK cells in solid tumors. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides NK cells with the IL-27Rα gene knocked out and their applications, thereby resolving the issues in the background section.
[0006] On the one hand, the invention provides the following technical solution: an NK cell with the IL-27Rα gene knocked out, wherein the cell is obtained by knocking out the IL-27Rα gene of NK cells, and the sequence of the IL-27Rα gene is shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3.
[0007] The beneficial effects of the NK cells with IL-27Rα gene knockout proposed in this invention are as follows: by knocking out the IL-35 receptor, i.e. IL-27Rα, in NK cells, the negative effects of IL-35 can be effectively avoided, thereby improving the killing function of NK cells in solid tumors. At the same time, experiments have shown that it can effectively enhance the killing ability against tumors.
[0008] On the other hand, the invention provides the following technical solutions, such as the application of NK cells with the IL-27Rα gene knocked out as described above in the preparation of tumor-killing drugs. Attached Figure Description
[0009] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0010] Figure 1 This is a flow cytometry image of mononuclear cells derived from umbilical cord blood before magnetic bead sorting, provided in an embodiment of the present invention. Figure 2 Flow cytometry image of high-purity CD56+ (NK) cells obtained by two-step magnetic bead sorting according to an embodiment of the present invention; Figure 3 This is a diagram showing the exon positions of the three sgRNA target sequences in the IL-27Rα gene provided in this embodiment of the invention. Figures 4-6 The NK provided in the embodiments of the present invention IL27RKO 1. NK IL27RKO 2. NK IL27RKO 3. Observation under an inverted microscope; Figure 7 The images show the results of T7EI enzyme digestion detection of three types of NK IL-27RA knockouts provided in this embodiment of the invention. Figure 8 Flow cytometry results for three types of NK knockout of IL-27RA provided in embodiments of the present invention; Figures 9-12 The figures shown are experimental results of LDH method detection of NK cells in various groups against multiple tumors provided in the embodiments of the present invention.
[0011] The present invention will be further described below with reference to the accompanying drawings and description. Detailed Implementation
[0012] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain embodiments of the present invention, and should not be construed as limiting the present invention.
[0013] This invention provides NK cells with the IL-27Rα gene knocked out and their applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0014] For the NK cells with the knockout of the IL-27Rα gene of the present invention, the cells are obtained by knocking out the IL-27Rα gene of NK cells, and the sequence of the IL-27Rα gene is shown in SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3.
[0015] The sequence shown in SEQ ID NO.1 is: CCGAGGGACGCCATGCGGGG; The sequence shown in SEQ ID NO.2 is: GGGCGACTTGAACTGCTCGT; The sequence shown in SEQ ID NO.3 is: GAGCAGTTCAAGTCGCCCAA; For applications in this invention, such as the use of NK cells with the IL-27Rα gene knocked out as described above in the preparation of tumor-killing drugs.
[0016] The reagents and consumables used in this invention are all commercially available products. The invention is further illustrated below with reference to the embodiments: Example 1: Identification of NK cells with IL-27Rα gene knockout 1. Isolation of mononuclear cells from umbilical cord blood Take one bag (50ml) of collected human umbilical cord blood and transfer it to a centrifuge tube. Centrifuge at 300g for 10min (acceleration: 9, deceleration: 5). After centrifugation, separate and recover the upper yellow plasma layer.
[0017] The cell pellet at the bottom was resuspended in physiological saline to a volume greater than the original volume or up to 120 ml. After uniform dilution, it was dispensed into 50 ml centrifuge tubes.
[0018] Slowly add the diluted cell suspension along the centrifuge tube wall to the upper layer of the lymphocyte separation medium, avoiding vigorous shaking and maintaining a clear interface between the two liquid layers. The corresponding volume ratio is lymphocyte separation medium: cell suspension = 15:25, ensuring the proportion of cell suspension is less than the above parameters. Centrifuge at 20℃, 2000 rpm horizontal gradient centrifugation for 20 min, acceleration: 1, deceleration: 0.
[0019] To observe cell layering, aspirate the white, cloudy mononuclear cell layer from the center of a centrifuge tube using a pipette. Add sufficient volume (at least twice the volume of the aspirated mononuclear cell suspension) of physiological saline, mix well, and wash. Centrifuge at 300g for 10 min (acceleration 9, deceleration 9), and discard the supernatant. Rehydrate the cell pellet with 45ml of PBS, and take a 1000ul sample to count cell density and viability. The results of flow cytometry analysis of mononuclear cells derived from umbilical cord blood before magnetic bead sorting are as follows: Figure 1 As shown, from Figure 1 The data shows the cell subpopulations and proportions of the sample. The horizontal axis (CD3) represents the CD3 expression level, used to identify T cells; the vertical axis (CD56) represents the CD56 expression level, used to identify natural killer (NK) cells. + CD56 - : accounting for 78.80%, mainly T cells. CD3 - CD56 + : Accounting for 12.23%, mainly NK cells. CD3 + CD56 + : accounting for 4.49%, representing a cell subset with the NKT cell phenotype. CD3 - CD56 - It accounted for 4.48%, which was other cell subpopulations that were not CD3 and CD56.
[0020] 2. Obtaining CD56+ (NK) cells using a two-step method involving GenScript magnetic bead sorting. Prepare and pre-cool the sorting buffer according to the CD3 or CD56 magnetic bead product instructions, and perform two-step magnetic bead sorting on peripheral blood mononuclear cells: CD3-negative cell sorting and CD56-positive cell sorting. After sorting, count the cells at 1800 rpm for 10 min, and discard the excess supernatant. Flow cytometry analysis was performed on high-purity CD56+ (NK) cells obtained by two-step magnetic bead sorting, and the results are as follows: Figure 2 As shown, from Figure 2 It can be seen from this that the target cell population CD3 - CD56 + The proportion of [unclear] was as high as 96.52%, while the heterogeneous cell population CD3 + CD56 + Only 0.19%, CD3 - CD56 - 3.01%, CD3 + CD56 - The percentage was 0.28%, which fully demonstrates that this sorting method can efficiently obtain high-purity CD56+ (NK) cells and effectively remove CD3+ cells.+ T cells and other non-target cells showed significantly better sorting specificity and purity than before sorting (e.g., Figure 1 CD3 - CD56 + (12.23%).
[0021] 3. Initial NK cell seeding culture and expansion culture Remove the NK amplification kit A1 (Shouning, containing 1×10^7 cells) from liquid nitrogen and incubate at 37°C until no solids remain. Transfer the cell suspension, add 10 ml of rewarmed serum-free culture medium, mix gently, and centrifuge at 300 g for 5 min (acceleration 9, deceleration 9). Discard the supernatant and resuspend the cell pellet at the bottom in 3 ml of culture medium.
[0022] Take 2×10^7 cells after sorting and mix them with the above NK amplification kit. Add 20ml of lymphocyte culture medium (containing 100IU / ml IL-2 and 5% SuperGrow). After inoculation, place the cells in a carbon dioxide incubator for 3 days to activate them.
[0023] On Day 3, cells were removed and observed under a microscope to assess cell stimulation. After centrifugation at 300g for 5 minutes, the supernatant was discarded, and 20ml of lymphocyte culture medium (containing IL-2 100IU / ml, IL-35 100ng / ml, and 5% SuperGrow) was added for further culture.
[0024] Observe cell expansion every two days from Day 4 to 7. After changing the culture medium (containing IL-2 100 IU / ml, IL-35 100 ng / ml, and 5% SuperGrow), the cell density should be 1×10^7. After expanding the total number of cells to 3×10^8, perform CRISPER / Cas9 knockout of the IL-27Rα gene.
[0025] 4. sgRNA prediction The human IL-27Rα gene sequence (Gene ID: 9466) was retrieved from the NCBI database. Potential sgRNA sequences were obtained using the sgRNA target prediction tool https: / / portals.broadinstitute.org / gppx / crispick / public. These potential sequences were then preliminarily screened based on the following principles: 1. Excluding sgRNAs with a GC content of ≤40%, prioritizing sgRNA sequences with a GC content of approximately 60-80%; 2. Excluding sgRNA sequences with high TTT content; 3. Fewer potential off-target sites. The final screening yielded three predicted target sequences: sgRNA-1: CCGAGGGACGCCATGCGGGG (SEQ ID NO.1); sgRNA-2:GGGCGACTTGAACTGCTCGT (SEQ ID NO.2); sgRNA-3:GAGCAGTTCAAGTCGCCCAA (SEQ ID NO.3); The positions of the three target sequences in the IL-27Rα gene sequence are as follows: Figure 3 As shown, from Figure 3 As can be seen, sgRNA1 was designed on EXON1, while the other two, sgRNA2 and sgRNA3, were designed on EXON2.
[0026] 5. Knockout of the IL-27Rα gene in NK cells The three sgRNA sequences were synthesized by Nanjing Genscript Biotech Co., Ltd., and the corresponding Cas9 proteins were purchased. The specific implementation is as follows: Dissolve the lyophilized sgRNA powder in RNase-free, nuclease-free, and pyrogen-free water to a final concentration of 100 μM (100 pmol / μL). After dissolution, divide into 5-10 μL portions per tube. For immediate use, store at -20°C; for long-term storage, store at -80°C, avoiding repeated freeze-thaw cycles. Store Cas9 protein at the labeled concentration at -20°C.
[0027] Nucleofector™ Solution and Supplement were mixed in a 4:5:1 ratio to prepare an electroporation buffer. After mixing, the mixture was equilibrated to room temperature. Each reaction required 20 μL of electroporation buffer.
[0028] Start the 4D-Nucleofector™ electrostatic precipitator, set the voltage to 800V and the time to 4ms, and allow it to warm up.
[0029] According to Table 1, add the electroporation reagents sequentially to sterile / RNase-free and nuclease-free centrifuge tubes, mix thoroughly, and incubate at room temperature for 10 minutes to finally form an RNP mixture.
[0030] Table 1
[0031] During incubation, take about 2×10^7 cells, centrifuge at 1800 rpm for 6 minutes, discard the supernatant, collect the cells, resuspend in DPBS, sample and count, take 1.5×10^7 for electroporation experiments, resuspend the cells in 150 μL of electroporation buffer, and ensure that the cell suspension is free of precipitate.
[0032] Carefully take 15 μL of cell suspension (containing 1 × 10^6 cells) and add it to the tube containing the RNP mixture, then mix gently.
[0033] Transfer the mixture into the 16-well Nucleocuvette™ electrospinning strip. Avoid creating air bubbles during pipetting. Gently tap the Nucleocuvette™ electrospinning strip to ensure the sample solution covers the bottom of the wells. Replace the cap of the Nucleocuvette™ electrospinning strip, place the strip in the strip holder of the 4D-Nucleofector™ X Unit, and check to ensure the strip is oriented correctly.
[0034] Click "Start" on the 4D-Nucleofector™ Core Unit screen to begin the electroporation process. Once complete, carefully remove the Nucleocuvette™ electroporation strips from the machine's strip tray and add 80 µl of preheated culture medium to each well. Allow the cells to stand in the electroporation strips in a 37°C / 5% CO2 incubator for 60 minutes.
[0035] After incubation, cells were transferred to preheated culture medium (containing IL-2 100 IU / ml, IL-35 100 ng / ml, and 5% SuperGrow) and placed in a CO2 incubator. Flow cytometry was used to assess knockout efficiency or tumor-killing effect after 3 days of culture. The cells in each group were then observed, and the results are as follows: Figure 4-6 As shown, Figure 4-6 Images of each group after IL-27Rα gene knockout under an inverted microscope (40×). Figure 4-6 As can be seen, there was no difference in cell morphology among the groups; the edges were clearly visible and translucent without any shrinkage or other adverse phenomena, and the cells were irregularly shaped, consistent with a typical lymphocyte-like state. Cell proliferation was generally normal; knockout of IL-27Rα had no effect on NK cell proliferation.
[0036] Example 2: Verification of gene knockout using T7E1 restriction enzyme digestion method Collect 300g of knockout NK cells from each group, discard the supernatant after 10 min, add 200μL Buffer ATL (lysis buffer), and mix thoroughly by pipetting or vortexing to completely disperse the cells (if clumps are present, break them up completely). Add 20μL Proteinase K, vortex for 15 seconds to ensure adequate contact between Proteinase K and the sample. Incubate at 56℃ for 10 minutes, inverting the centrifuge tube 2-3 times during incubation to promote lysis, until the solution is clear. After incubation, remove the sample tubes and allow them to cool to room temperature.
[0037] Add 200 μL of anhydrous ethanol and vortex for 15 seconds to mix thoroughly. Transfer the mixture (including all precipitates) to a DNeasy centrifuge column (already placed in a collection tube), being careful not to let any liquid overflow the column. Centrifuge at 10,000 × g for 1 minute at room temperature, discard the waste liquid in the collection tube, and return the centrifuge column to the original collection tube. Add 500 μL of Buffer AW1 (ensuring ethanol has been added) to the centrifuge column, centrifuge at 10,000 × g for 1 minute, discard the waste liquid, and return the centrifuge column to the collection tube. Add 500 μL of Buffer AW2 (ensuring ethanol has been added) to the centrifuge column, centrifuge at 10,000 × g for 3 minutes, discard the waste liquid and the collection tube.
[0038] Place the centrifuge column into a new 1.5 mL centrifuge tube and centrifuge at 10,000 × g for 1 minute to thoroughly remove any residual Buffer AW2 from the column membrane. Carefully remove the centrifuge column, discard the waste tube below, and place the column into a clean 1.5 mL centrifuge tube. Add 50-200 μL of Buffer AE or sterile ultrapure water to the center of the centrifuge column membrane (add slowly, avoiding contact with the column wall), and let it stand at room temperature for 1 minute. Centrifuge at 10,000 × g for 1 minute; the liquid collected in the centrifuge tube is the purified DNA. Measure the DNA concentration using a micro-nucleic acid concentration analyzer. Based on the measured DNA concentration, dilute to an appropriate concentration range and take 200 ng of genomic DNA. Perform PCR amplification using high-fidelity DNA polymerase. After amplification, collect the target band and recover it by gel extraction. Use an annealing program to chain the amplified band; after annealing, cool to room temperature. Add 1 μL of T7E1 restriction endonuclease to each tube, digest at 37°C for 30 min, and analyze by agarose gel electrophoresis after digestion. The results are as follows: Figure 7 As shown, the figure includes molecular weight markers (2000bp, 1000bp, 800bp, 400bp), wild-type (WT) samples, and three NKIL27RKO samples (NK). IL27RKO 1. NK IL27RKO 2. NK IL27RKO 3). This electrophoresis image shows that, compared with WT samples, the three types of NK IL27RKO The samples exhibited different banding patterns after enzyme digestion, which can be used to detect the knockout effect of the IL-27RA gene in NK cells. IL27RKO The absence of cell division in sample 1 indicates that no gene editing occurred in this cell group, while NK cells... IL27RKO 2. NK IL27RKO Three bands were clearly observed in the three samples, proving that gene editing had occurred in all of them.
[0039] Example 3: Flow cytometry detection of IL-27RA knockout efficiency Prepare flow cytometry to detect antibodies CD3-FITC, CD56-PE, and IL-27RA-APC, and isotype controls Isotype-FITC, Isotype-PE, and Isotype-APC; collect NK cells from each group. IL27RKO Cells and control NK cells were centrifuged at 300g for 5 min, and excess supernatant was discarded. 50 μL of PBS (2% FBS) was added, and the cells were gently mixed and resuspended. 0.5 μL of detection antibody was added to each group, and the mixture was incubated on ice for 20 min. Cells were washed with 500 μL of PBS (2% FBS) to remove residual antibody, centrifuged at 300g for 5 min, and excess supernatant was discarded. Cells were resuspended in 200 μL of PBS (2% FBS), filtered through a 100-mesh sieve, and analyzed. The results are as follows: Figure 8 As shown, from Figure 8 The data shows that the proportion of T (CD3+) cells in each group was low, all <0.5%, indicating that non-T cells accounted for the vast majority. Further analysis revealed that the proportion of CD56+ (NK) cells was >95%, therefore, the experimental samples can be considered to be NK cells. The IL-27RA expression ratio shows that in the negative control group, IL-27RA was 87.75%, while NK cells... IL27RKO 1 sample size was 80.98%, NK IL27RKO The sample size was 2.74%, NK IL27RKO The knockout rate was 27.81% for the three samples, so the knockout efficiencies were 7.7%, 96.87%, and 68.35%, respectively.
[0040] Example 4 NK IL27RKO Cell killing experiments on various tumor cell lines Each group of NK IL27RKO The experimental design for killing tumors is shown in Table 2 below: Table 2 NK of each group IL27RKO The experimental design for killing tumors is as follows:
[0041] Note: NK is the negative control group, which consists of cells that have not undergone gene knockout. IL27RKO 1. Cell group with IL-27Rα gene knocked out using sgRNA-1 sequence; NK IL27RKO 2. Cell groups with IL-27Rα gene knocked out using sgRNA-2 sequence; NK IL27RKO 3. Cell groups with IL-27Rα gene knocked out using sgRNA-3 sequence.
[0042] Prepare NK cell suspension, count, and add 1640 (10% FBS) to adjust the cell count to 1×10^7 cells / ml; Prepare a target cell suspension, count the cells, and add 1640 (10% FBS) to adjust the cell count to 1×10^5 cells / ml; The design included four groups: NK cell killing group, target cell spontaneous release group, target cell maximum release group, and effector cell spontaneous release group; each group had three replicates. I: NK cell killing group: effector cells (5:1, 10:1, 20:1) (100ul) + target cells (100ul); II: Target cell spontaneous release group: target cells (100ul) + culture medium (100ul); III: Maximum release of target cells: target cells (100 μL) + 10% Triton (100 μL); IV: Effector cell spontaneous release group: effector cells (100 μL) + culture medium (100 μL) After mixing all cell groups, centrifuge at 1000 rpm for 5 min, incubate in a 5% CO2 incubator for 3 h, add 50 μL of pre-cooled 1640 solution to terminate the effector cell reaction. Collect cells from each group, centrifuge at 1000 rpm for 5 min, collect 100 μL of supernatant from each well, add to a 96-well plate, add 100 μL of LDH substrate solution, incubate in an incubator for 10-30 min, immediately stop the reaction, measure the OD value at 492 nm using a microplate reader, and calculate NK activity using the following formula: NK activity % = ; The result is as follows Figure 9-12 As shown, Figure 9 The diagram shows the killing effect of NK cells incubated with IL-35 on various tumor cell lines. Figure 10 NK cells incubated with IL-35 IL27RKO Figure 1 shows the cell's killing effect on various tumor cell lines. Figure 11 NK cells incubated with IL-35 IL27RKO Experiments on the killing effect of cells from 2 on various tumor cell lines Figure 12 NK cells incubated with IL-35 IL27RKO Figure 3 shows an experiment demonstrating the killing effect of NK cells on various tumor cell lines. The figure shows that NK cells in each group were co-cultured with K562 (human chronic myeloid leukemia cell line), MKN-45 (human gastric cancer cells), Hep G2 (human liver cancer cells), and A549 (human lung cancer cells), respectively. Compared with the negative control group, NK cells cultured with IL-35 showed significantly higher killing power. IL-27RKO Group 2 has the best lethality, and some groups have a significant enhancement effect, and NK IL27RKO 1. NK IL27RKO Compared to the NK group, its lethality has also improved, but the improvement is not as significant as that of the NK group. IL-27RKOGroup 2 is good; it's speculated that this is due to the low efficiency of the knockout process.
[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. An NK cell with the IL-27Rα gene knocked out, characterized in that, The cells were obtained by knocking out the IL-27Rα gene of NK cells, and the sequence of the IL-27Rα gene is shown in SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.
3.
2. The application of NK cells with IL-27Rα gene knocked out as described in claim 1 in the preparation of tumor-killing drugs.