Beta-lyase mutant and application thereof
By mutating the β-lyase to Y348A, a β-lyase mutant Y348A was constructed and applied to the recombinant Yersinia lipolytica strain, solving the problem of low yield of ergothioneine produced by microbial fermentation and realizing efficient and low-cost ergothioneine synthesis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN UNIV OF SCI & TECH
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies for producing ergothioneine through microbial fermentation have low yields and conversion rates, making it difficult to meet market demand and resulting in low production efficiency and high costs.
By mutating the β-lyase to Y348A, a β-lyase mutant Y348A was constructed and applied to recombinant Yersinia lipolytica strain to increase the synthesis of ergothionein.
It significantly increased the yield of ergothionein to 63% compared with the non-mutated β-lyase strain, reduced production costs, improved biosynthetic efficiency, and is suitable for industrial applications.
Smart Images

Figure CN121915019A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of mutation or genetic engineering technology, specifically relating to β-lyase mutants and their applications. Background Technology
[0002] Ergothioneine is a white crystalline solid with the molecular formula C9H. 15 N3O2S, possessing good water solubility, is characterized by its tautomerism, consisting of both thiophene and thiol forms. These two isomers can interconvert under physiological conditions, with thiophene being the predominant form at physiological pH. This structural characteristic gives ergothionein high oxidative stability, making it resistant to oxidation and thus enabling it to exert a long-lasting antioxidant effect in vivo. Ergothionein is widely distributed in various organisms in nature, including mammals, fungi, bacteria, and certain plants. As a natural, safe, and highly effective antioxidant, ergothionein has broad application prospects in medicine, food, health products, cosmetics, and biotechnology, currently primarily used in cosmetics. Due to its natural and safe properties, ergothionein is added to cosmetics for antioxidant, anti-aging, and skin-whitening purposes.
[0003] Ergothioneine is mainly derived from three sources: natural extraction, chemical synthesis, and microbial synthesis. Ergothioneine content in natural sources (such as mushrooms) is extremely low, while chemical synthesis is cumbersome, costly, and difficult to guarantee stereochemical purity. However, using microorganisms as "cell factories" for fermentation production offers absolute advantages in terms of high efficiency, low cost, and a green and sustainable process, making it the cornerstone for meeting global market demand. Furthermore, microbial synthesis technology provides crucial support for the scientific research and clinical application of ergothioneine. In the eukaryotic ergothioneine biosynthesis pathway, only two key genes, Egt1 and Egt2, are required. Histidine is catalyzed by Egt1 to produce a histidine trimethylammonium cysteine sulfoxide intermediate, which is then catalyzed by the PLP-binding CS lyase Egt2 to obtain ergothioneine.
[0004] The production of ergothioneine through microbial fermentation suffers from low yield and conversion rate. To increase the ergothioneine synthesis capacity of the strains, it is necessary to modify the strains' characteristics.
[0005] The domestic and international market demand for ergothioneine is increasing year by year, which poses new challenges to its industrial production. Therefore, modifying the producing bacteria at the molecular level through genetic engineering and continuously developing high-yield strains can not only improve production efficiency but also significantly reduce production costs, giving enterprises a competitive advantage and providing strong support for the sustainable development of the ergothioneine industry. Summary of the Invention
[0006] The technical problem to be solved by this invention is how to increase the yield of microbial ergothionein through genetic modification. The technical problem to be solved is not limited to the technical subject described herein. Other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.
[0007] To solve the above-mentioned technical problems, the technical approach adopted by the present invention is as follows: One of the technical solutions provided by the present invention is a β-lyase mutant, which is obtained by Y348A mutation on the basis of the wild-type β-lyase shown in SEQ ID NO:1; Furthermore, the mutant is the Y348A mutant, and its amino acid sequence is shown in SEQ ID NO: 3.
[0008] The second technical solution provided by this invention is a biomaterial, which includes any one of the following: A1) The nucleic acid molecule of the β-lyase mutant as described in one of the encoding technology schemes; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) Recombinant microorganisms containing the nucleic acid molecules described in A1); Furthermore, all of the biological materials can express the nucleic acid molecules described in A1).
[0009] In the above-mentioned biological materials, the nucleic acid molecule described in A1) includes a DNA molecule with a coding sequence as shown in SEQ ID NO:4; Furthermore, the nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID NO: 4; The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as mRNA or hnRNA.
[0010] In the aforementioned biological materials, the recombinant vector described in A3) can be constructed using an expression vector. The structure of expression vectors is well known to those skilled in the art. Expression vectors typically contain elements required for target gene expression, such as promoters, multiple cloning sites, terminators, and ribosome binding sites, and may also contain selection marker genes (such as kanamycin resistance gene kanr, neomycin resistance gene neo, hygromycin resistance gene hyg, chloramphenicol resistance gene cat, streptomycin resistance gene str, bleomycin resistance gene ble, etc.). Expression vectors can be constructed using any method known in the art (such as recombination technology, synthetic technology, etc.) or can be commercially purchased. For example, in one or more embodiments of the present invention, the expression vector used for the recombinant vector is pYLEX1.
[0011] The recombinant vector can be a recombinant expression vector obtained by cloning a nucleic acid molecule encoding the β-lyase mutant (Y348A) into an expression vector (such as a prokaryotic expression vector or a eukaryotic expression vector). Although the expression vector used in the embodiments provided in this invention is the pYLEX1 vector, this invention is not limited to this specific vector. Those skilled in the art can use other suitable vectors (such as yeast expression vectors pYES2, pPICZaA, pUG6, etc.), as long as the vector can express the β-lyase mutant.
[0012] Among the above-mentioned biological materials, the recombinant microorganisms mentioned in A4) include: recombinant Yersinia lipolytica, recombinant Saccharomyces cerevisiae, recombinant Kluyveromyces lactis, or recombinant Escherichia coli; Preferably, in the above-mentioned biological materials, the recombinant microorganism described in A4) can be a recombinant *Yersinia lipolytica*; the recombinant *Yersinia lipolytica* is obtained by mutating the gene encoding the protein with the amino acid sequence shown in SEQ ID NO:1 in *Yersinia lipolytica*; the protein expressed after mutation includes one of the following mutations relative to SEQ ID NO:1: Y348A; preferably, the *Yersinia lipolytica* is *Yersinia lipolytica* Po1gΔKU70.
[0013] The third technical solution provided by this invention is the application of the β-lyase mutant described in the first technical solution, or the nucleic acid molecule, expression cassette, recombinant vector, or recombinant microorganism described in the second technical solution, in any of the following: B1) Application in increasing the yield of microbial ergothioneine; B2) Use in the preparation of ergothioneine or products containing ergothioneine; B3) Application in the construction of genetically engineered bacteria that produce ergothionein.
[0014] The products include, but are not limited to, food, cosmetics, pharmaceuticals, animal feed, and daily chemical products.
[0015] The fourth technical solution provided by the present invention is a method for increasing the yield of ergothioneine in a target microorganism or for preparing ergothioneine. The method includes mutating a protein in the target microorganism with the amino acid sequence SEQ ID NO:1 to obtain a recombinant microorganism with a higher yield of ergothioneine than the target microorganism. The mutation includes one of the following mutations relative to SEQ ID NO:1: Y348A.
[0016] Furthermore, the method may also include: culturing the recombinant microorganism in a culture medium and collecting the ergothioneine from the culture.
[0017] The culture can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH of the culture medium can be appropriately adjusted according to the actual situation.
[0018] The mutation methods are well known to those skilled in the art, such as PCR-mediated site-directed mutagenesis, oligonucleotide primer-mediated site-directed mutagenesis, cassette mutagenesis, gene editing technology, or homologous recombination technology.
[0019] Furthermore, the method for preparing ergothioneine can be a fermentation method.
[0020] In the above applications or methods, the microorganisms include Yersinia lipophila.
[0021] Beneficial effects: This invention obtains a mutant Y348A, a key enzyme in ergothioneine synthesis, the β-lyase, through gene mutation. Genetically engineered strains constructed using this mutant exhibit significantly enhanced ergothioneine synthesis capabilities, showing a 63% increase in yield compared to strains expressing the unmutated β-lyase. This demonstrates superior performance and can significantly improve the biosynthetic yield of ergothioneine. It is more suitable for industrial applications, significantly reducing production costs and increasing production efficiency. Attached Figure Description
[0022] Figure 1 This is a schematic diagram illustrating the binding of Egt2 and PLP (blue) and histidine trimethylammonium cysteine sulfoxide (yellow) in Example 1. Key amino acid residues to be mutated are marked in green.
[0023] Figure 2 This is a gel electrophoresis verification image of the β-lyase mutant plasmid in Example 2. M, marker; 1-2 are pYLEgt1-Egt2 and pYLEgt1-Egt2-348A, respectively.
[0024] Figure 3This is a nucleic acid gel electrophoresis verification image of the positive transformants of Po1gΔKU70 containing β-lyase before and after mutation in Example 2. M, marker; 1-2 are Po1gΔKU70-Egt1Egt2 and Po1gΔKU70-Egt1Egt2-348A, respectively. Detailed Implementation
[0025] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0026] In this document, when referring to β-lyase mutants, their amino acid sequences are determined by referring to the amino acid sequence of wild-type β-lyase Egt2 (SEQ ID NO:1). When referring to mutations, the mutations are described as follows: "pre-mutation amino acid abbreviation, mutation position, post-mutation amino acid abbreviation". For example, "Y348A" indicates that at position 348 of the amino acid sequence shown in SEQ ID NO:1, the amino acid is mutated from tyrosine to alanine. The first methionine (Met) in the amino acid sequence shown in SEQ ID NO:1 is position 1.
[0027] In this paper, the amino acid sequence of the wild-type β-lyase Egt2 is shown in SEQ ID NO:1; In this paper, the nucleotide sequence of the gene encoding the wild-type β-lyase Egt2 is shown in SEQ ID NO:2; In this paper, the amino acid sequence of the β-lyase mutant Y348A is shown in SEQ ID NO:3; In this paper, the nucleotide sequence of the gene encoding the β-lyase mutant Y348A is shown in SEQ ID NO:4.
[0028] This invention obtained a three-dimensional structural model of Egt2, a key enzyme in ergothioneine synthesis, through structural prediction. A structural model of the complex of Egt2 with its substrate histidine trimethylinnerylcysteine sulfoxide and PLP was obtained using molecular docking. Further, based on the complex model, a key amino acid residue (Y348) potentially affecting the catalytic activity of Egt2 was identified, and site-directed mutagenesis was used to modify this amino acid residue to improve the catalytic performance of Egt2. Wild-type Egt2 and a mutant of Egt2 were expressed in engineered bacteria, and the ability of the mutant to catalyze the conversion of histidine to ergothioneine in *Yarrowia lipolytica* was compared. The results showed that the β-lyase mutant Y348A designed in this invention significantly increased the yield of ergothioneine in *Yarrowia lipolytica*, with a 63% increase compared to strains expressing the unmutated β-lyase, demonstrating superior performance and significantly improving the biosynthetic yield of ergothioneine.
[0029] Microbial strains are the core of the fermentation industry, and there has long been an urgent need for high-yield strains. Currently, the industrial production of ergothioneine by *Yarrowia lipolytica* faces bottlenecks such as weak synthetic metabolism that urgently need to be overcome. This invention utilizes 3D modeling to perform site-directed mutagenesis on *Egt2* to improve its catalytic efficiency, achieving highly efficient ergothioneine synthesis. The result is a β-lyase mutant, Y348A. Genetically engineered strains constructed using this mutant exhibit significantly enhanced ergothioneine synthesis capabilities, making them more suitable for industrial applications, and can significantly reduce production costs and improve production efficiency.
[0030] Terminology Definition In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.
[0031] The term "expression cassette" generally refers to a nucleic acid construct containing sufficient nucleic acid elements to express a target gene. A typical expression cassette includes a promoter, a multiple cloning site (MCS), and a terminator. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences. Elements within an expression cassette can be directly linked or indirectly linked through adapters.
[0032] The term "vector" generally refers to a vector capable of delivering exogenous DNA or a target gene into host cells for amplification and / or expression. This vector can be a cloning vector or an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication origin site.
[0033] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, spirochetes, algae, etc. For example, the bacteria mentioned may originate from the genus *Corynebacterium* (…). Corynebacterium sp. (such as Corynebacterium glutamicum, Corynebacterium pekinensis, Corynebacterium obtusifolium, etc.), bryophytes ( Brevibacterium sp. (such as short bacilli of lactic acid fermentation, short bacilli of yellow, short bacilli of ammonia-eating bacteria, etc.), Escherichia coli spp. ( Escherichia sp. (such as Escherichia coli), Erwinia spp. Erwinia sp. ), Agrobacterium ( Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium spp. ( Flavobacterium sp. Alcaligenes ( ) Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) and Bacillus spp. ( Bacillus sp. (e.g., Bacillus). The viruses may include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus). The fungi may be derived from yeasts (e.g., Bacillus). Saccharomyces sp. (such as Saccharomyces cerevisiae, Candida albicans, Methylospermum oryzae, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. (Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin ( Cephalosporium sp. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., fucus vesiculosus). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus Styracula ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. )wait.
[0034] The term "host cell," also known as recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as microbial cells, plant cells, and animal cells. The term "host cell" can be understood not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, need not be completely identical to the original parent cell but are still included within the scope of host cells. Suitable host cells are those known in the art, such as *Yarrowia lipolytica*, *Saccharomyces cerevisiae*, *Kluyveromyces lactis*, or recombinant *Escherichia coli*.
[0035] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by linking a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.
[0036] The term "recombinant microorganism" generally refers to a recombinant microorganism whose genes have been manipulated and modified to obtain a functionally altered microorganism. This can be achieved by introducing a foreign target gene or recombinant vector into the target microorganism, or by directly editing the endogenous genes of the target microorganism.
[0037] The term "mutation" generally refers to a change in the amino acid sequence or nucleotide sequence. It can include changes in the composition or arrangement of base pairs in the structure of a gene, such as point mutations caused by a single base change, or deletions, duplications, and insertions of multiple bases. It can also include substitutions, deletions, and insertions (additions) of one or more amino acid residues in a protein.
[0038] The term "site-directed mutagenesis" generally refers to altering one or more bases in a gene through site-directed mutagenesis methods, including base addition, deletion, and point mutation, resulting in a change in the amino acid composition of the corresponding protein. Site-directed mutagenesis methods include oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis.
[0039] The term "gene editing" generally refers to the ability to alter specific gene sequences within any cell, causing base deletions, duplications, insertions, frameshift mutations, and replacements or knockouts of target genes. This allows for the substitution, deletion, splicing, and single-base alterations of the genome sequence—essentially, the technology to arbitrarily "edit" the genome or the sequence of a specific gene. Gene editing includes zinc finger ribozyme gene knockout technology, TALEN gene editing technology, and CRISPR gene editing technology, among others.
[0040] The term "homologous recombination" generally refers to a genetic recombination in which nucleotide sequences are exchanged between two similar or identical DNA molecules. Exemplarily, a site-directed mutagenesis strategy based on homologous recombination can be achieved by introducing a nucleic acid molecule encoding the β-lyase described in this invention (e.g., the DNA molecule shown in SEQ ID NO:4) into a recipient bacterium after connecting both ends to homologous arms, thereby achieving the purpose of site-directed mutagenesis.
[0041] The term "culture" generally refers to a liquid or solid product (all substances within the culture container) that has grown a microbial community after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.
[0042] The term "fermentation" generally refers to the biological reaction process through the growth, reproduction, and metabolic activities of an organism to produce and accumulate desired products, including microbial fermentation.
[0043] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "comprising" and "including" are used interchangeably.
[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0045] In this invention, the pYLEX1 plasmid was purchased from Yeeastern Biotech Co., Ltd., and the pYLEX1 plasmid carries a leucine expression cassette for auxotrophic selection, a marker gene Amp, a promoter hp4d, and a terminator XPR2 term.
[0046] In this invention, the Yeastern lipophilic yeast Po1g strain was purchased from Yeastern Biotech Co., Ltd. in Taiwan, China.
[0047] In this invention, *Yersinia lipolytica* Po1gΔKU70 is constructed by knocking out the KU70 gene responsible for non-homologous recombination in *Yersinia lipolytica* Po1g. The knockout method is known to those skilled in the art and can be found in the following literature: YuAQ, Pratomo N, Ng TK, Ling H, Cho HS, Leong SS, Chang MW. Genetic engineering of an unconventional yeast for renewable biofuel and biochemical production. Journal of Visualized Experiments, 2016, 115, e54371.
[0048] The KU70 gene knockout sequence is: GGCGGTTCATGTCGAAAAACACGTCCATCAGGTGAGGCTCTTCCTGCACCTTGAACCTCTCACCCAGATCAGGGTCCTCTGCCAGTCGTTTGAGTCGTTTGATCTGAGCAGCGGTAGGAAGGCCCAGCTTGAGAATGAAATGTGTATCTGACTCATCATCGAACTCGTCACCGTCGTCCTCAGACTGCATGGAGGCACCGAACAGCATAACGCCGGTGTAATCT The following examples used Graphpad Pism 9.5 statistical software to process the data. Experimental results are expressed as mean ± standard deviation. One-way ANOVA was used for testing; P < 0.05 (*) indicates statistical significance, P < 0.01 (**) indicates statistically significant difference, and P < 0.001 (***) indicates extremely significant difference. Unless otherwise specified, all quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0049] The present invention will be further explained and illustrated below through specific embodiments.
[0050] Example 1, Ergot ( Claviceps purpurea (Source: Structural simulation of β-lyase Egt2 and molecular simulation of histidine trimethylinnerylcysteine sulfoxide binding) Random mutation screening lacks precise design. In this embodiment, a three-dimensional structural model of β-lyase Egt2 was obtained through structural prediction. The structural model of the complex of Egt2 with its substrate histidine trimethylintramethyl cysteine sulfoxide and PLP was obtained by molecular docking. Figure 1 The details are as follows: Using the β-lyase Egt2 (GenBank accession number: CCE33140.1, SEQ ID NO:1) as a template, the predicted Egt2 protein model was imported into Autodock Tools software and converted into a .pdbqt file. Histidine trimethylammonium cysteine sulfoxide (HS-C) and PLP were also imported and converted into .pdbqt files respectively. Possible binding pockets were analyzed, and based on this model, site-directed mutagenesis was performed on amino acids near the selected binding pocket.
[0051] The results showed that the key amino acid residue (Y348) may affect the ability of Egt2 protein to bind small substrate molecules, thereby affecting its catalytic activity. Based on the properties of its amino acid, a site-directed mutant of alanine, Y348A, was designed.
[0052] Example 2: Obtaining β-lysin strains and site-directed mutant strains This example constructs a strain containing the encoding gene of the following β-lyase mutant: β-lyase mutant Y348A: Its amino acid sequence is obtained by mutating Tyr at position 348 of SEQ ID NO:1 to Ala, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO:4.
[0053] The specific construction steps are as follows: (1) Based on the known β-lyase Egt2 gene (SEQ ID NO:2) and the key gene Egt1 in the ergothioneine synthesis pathway (Genbank accession: XP_956324.3, SEQ ID NO:5), they were respectively introduced into the Kpn1 restriction enzyme site of the pYLEX1 plasmid to obtain the pYLEX1-Egt1 plasmid and the pYLEX1-Egt2 plasmid. The Egt2 gene expression cassette was amplified from the pYLEX1-Egt2 plasmid. The restriction enzyme site SalI was selected on the pYLEX1-Egt1 plasmid for digestion. The Egt2 gene expression cassette was introduced into the SalI site through homologous recombination to construct the recombinant plasmid pYLEgt1-Egt2 containing the β-lyase Egt2 gene and the Egt1 gene. The β-lyase Egt2 gene and the Egt1 gene were obtained by polymerase chain reaction (PCR). The construction of the recombinant plasmid can be carried out using common methods in this field.
[0054] (2) Primer design: The mutation site was introduced by reverse PCR to construct the β-lyase mutant expression plasmid. Using pYLEgt1-Egt2 plasmid as a template, primers were designed using Primer Premier 5.0. The primer sequences are shown in Table 1: Table 1. Primers used to construct mutants
[0055] (3) Reverse PCR: The reaction system and reaction procedure for reverse PCR are shown in Table 2 and Table 3, respectively.
[0056] Table 2. Reaction system for reverse PCR
[0057] Table 3. Reverse PCR reaction procedure
[0058] The PCR product was digested with 0.25 μL of DpnI to remove methylation, and then transformed. E.coli DH5α strain was cultured for 12 to 14 hours, and single colonies were picked. After overnight culture, plasmids were extracted and DNA sequencing was performed to verify whether the tyrosine at position 348 of the β-lyase Egt2 (SEQ ID NO:1) was successfully replaced with alanine. PCR and sequencing confirmed the successful acquisition of the mutant plasmid pYLEgt1-Egt2-348A (verification figure shown). Figure 2 ).
[0059] Among them, the mutant plasmid pYLEgt1-Egt2-348A contains the gene encoding the Y348A mutant (SEQ ID NO:4).
[0060] (4) Transform the original plasmid pYLEgt1-Egt2 and the correctly sequenced mutant plasmid pYLEgt1-Egt2-348A into competent cells of Yersinia lipolytica Po1gΔKU70 strain. After visible colonies grow on leucine-deficient plates, randomly select single colonies, incubate overnight, and extract the genome for PCR verification. Verification showed that... Figure 3 As shown, the Po1gΔKU70-Egt1Egt2 strain containing the original plasmid pYLEgt1-Egt2 and the mutant strain Po1gΔKU70-Egt1Egt2-348A containing the mutant plasmid pYLEgt1-Egt2-348A were successfully obtained.
[0061] Example 3: Effect of β-lyase mutant on ergothionein yield 1) The strains constructed in Example 2: Po1gΔKU70-Egt1Egt2, the mutant strain Po1gΔKU70-Egt1Egt2-348A and the original strain Po1gΔKU70 were activated twice and then inoculated into the fermentation medium at an inoculation amount of 1%. The mixture was fermented in shake flasks at 30°C and 220 r / min for 7 days.
[0062] 2) The activation steps of the genetically engineered bacteria are as follows: pick a single colony from the YPD solid plate, inoculate it into a test tube containing 5 mL of seed culture medium, and culture it at 30℃ and 220 r / min for 24 h with shaking (to complete the first activation). Then, inoculate it with 1% of the seed culture medium into 25 mL of seed culture medium and culture it at 30℃ and 220 r / min for 16 h with shaking (to complete the second activation).
[0063] The seed culture medium was YPD medium, with the following composition: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, sterilized at 115℃ for 20 min.
[0064] The fermentation medium consisted of: peptone (20 g / L), yeast extract (10 g / L), and glucose (20 g / L). KH2PO4 (2.5 g / L), MgSO4·7H2O (0.5 g / L), biotin (50 mg / L), metal solution (2 mL / L, (CaCl2·2H2O (4.5 g / L), ZnSO4·7H2O (4.5 g / L), FeSO4·7H2O (3 g / L), CuSO4·5H2O (2.5 g / L))), sterilized at 115℃ for 20 min.
[0065] 3) After fermentation, the fermentation broth was placed in a 94℃ water bath for 10 minutes, vortexed for 30 minutes, centrifuged at 7000rpm for 10 minutes, and the supernatant was collected. The sample was diluted 15 times with ultrapure water and filtered through a 0.22 μm microporous membrane into a brown vial. The ergothioneine content in the sample was determined by HPLC.
[0066] The HPLC detection conditions mentioned above are as follows: Chromatographic column: Hypersil BDS C18 5μm, 4.6mm×250mm, mobile phase: 3% acetonitrile, flow rate: 0.6 mL / min, column temperature: 30℃, detection wavelength: 254nm, injection volume: 10 μL.
[0067] 1) The yield changes of ergothionein synthesized by the three recombinant strains were detected by HPLC, as shown in Table 4.
[0068] Table 4. Yield of ergothioneine synthesized by recombinant bacteria
[0069] Measurements showed that the mutated β-lyase catalyzed an increased yield of ergothioneine, indicating a certain degree of improvement in enzyme activity and substrate binding ability after mutation. Using Po1gΔKU70 as the starting strain, the Po1gΔKU70-Egt1Egt2-348A strain containing the mutant plasmid pYLEgt1-Egt2-348A showed a more significant increase in ergothioneine yield, with a 63% increase compared to Po1gΔKU70-Egt1Egt2. The modified genetically engineered strain is more suitable for industrial applications, reducing production costs and improving production efficiency.
[0070] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A β-lyase mutant, characterized in that, The β-lyase mutant was obtained by mutating Y348A on the wild-type β-lyase shown in SEQ ID NO:1; The mutant is the Y348A mutant, and its amino acid sequence is shown in SEQ ID NO:
3.
2. A biomaterial, characterized in that, The biomaterial includes any of the following: A1) Encoding the nucleic acid molecule of the β-lyase mutant of claim 1; A2) An expression cassette containing the nucleic acid molecules described in A1); A3) A recombinant vector containing the nucleic acid molecules described in A1); A4) Recombinant microorganisms containing the nucleic acid molecules described in A1).
3. A biomaterial as described in claim 2, characterized in that, A1) The nucleic acid molecules include DNA molecules with coding sequences as shown in SEQ ID NO:
4.
4. A biomaterial as described in claim 3, characterized in that, The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ IDNO:
4.
5. A biomaterial as described in claim 2, characterized in that, A3) The recombinant vector is constructed using an expression vector, by cloning a nucleic acid molecule encoding the β-lyase mutant of claim 1 into the expression vector to obtain the recombinant expression vector; A4) The recombinant microorganisms include: recombinant Yersinia lipolytica, recombinant Saccharomyces cerevisiae, recombinant Kluyveromyces lactis or recombinant Escherichia coli; the recombinant microorganisms are obtained by mutating the coding gene of the protein in the host that expresses the amino acid sequence shown in SEQ ID NO:1; the protein expressed after mutation includes the following mutation relative to SEQ ID NO:1: Y348A.
6. A biomaterial as described in claim 5, characterized in that, A3) The recombinant vector used is pYLEX1.
7. A biomaterial as described in claim 5, characterized in that, A4) The recombinant microorganism is a recombinant *Yersinia lipolytica*, which is obtained by mutating the gene encoding the protein with the amino acid sequence shown in SEQ ID NO:1 in *Yersinia lipolytica*; the protein expressed after mutation includes one of the following mutations relative to SEQ ID NO:1: Y348A; the *Yersinia lipolytica* is *Yersinia lipolytica* Po1gΔKU70.
8. The use of the β-lyase mutant of claim 1, or the nucleic acid molecule, expression cassette, recombinant vector, or recombinant microorganism of claim 2, in any of the following: B1) Application in increasing the yield of microbial ergothioneine; B2) Use in the preparation of ergothioneine or products containing ergothioneine; B3) Application in the construction of genetically engineered bacteria that produce ergothionein; The products include, but are not limited to, food, cosmetics, pharmaceuticals, animal feed, and daily chemical products.
9. A method for increasing the yield of ergothioneine from a target microorganism or for preparing ergothioneine, characterized in that, The method includes mutating a protein in the target microorganism with the amino acid sequence SEQ ID NO:1 to obtain a recombinant microorganism with a higher ergothioneine yield than the target microorganism, wherein the mutation includes one of the following mutations relative to SEQ ID NO:1: Y348A.
10. The method as described in claim 9, characterized in that, The method may further include: culturing the recombinant microorganism in a culture medium and collecting the ergothioneine from the culture.