Method for delaying leaf senescence of non-heading chinese cabbage by editing stay-green gene

Abstract

The application discloses a method for delaying leaf senescence of Brassica chinensis var. rosularis by editing genes SGR1 and SGR2, and belongs to the technical field of crop breeding. The method comprises the following steps: designing specific sgRNA according to the coding region sequence of the stay-green genes SGR1 and SGR2 of the Brassica chinensis var. rosularis, constructing a CRISPR / Cas9 gene editing vector, transforming the Brassica chinensis var. rosularis receptor material by means of Agrobacterium tumefaciens infection of the cotyledon and hypocotyl, obtaining the transformed plant containing the gene editing element through adventitious bud regeneration and screening, and screening the plant with the SGR1 and / or SGR2 gene site-directed mutation through molecular identification and phenotype observation. The application precisely modifies the stay-green genes by the gene editing technology, significantly delays the leaf senescence process of the Brassica chinensis var. rosularis, improves the leaf stay-green property and the preservation period, and keeps excellent agronomic traits, thereby providing a new way for the genetic improvement and preservation technology development of the Brassica chinensis var. rosularis, and having important application value in the fields of vegetable production, preservation and breeding.

Description

Technical Field

[0001] This invention belongs to the field of crop breeding technology, specifically relating to a method for delaying leaf senescence in non-heading Chinese cabbage by editing the green-keeping genes SGR1 and SGR2. Background Technology

[0002] Leaf color is a comprehensive expression of various pigments in the leaf. In normal leaves, chlorophyll is dominant, typically appearing green. Leaf senescence is the final stage of plant leaf development and a crucial link in the recycling of plant nutrients. The most obvious sign of leaf senescence is the fading of green color caused by chlorophyll degradation, followed by the appearance of anthocyanins or flavonoids. Stay-green refers to the characteristic of senescent plant leaves where chlorophyll does not degrade or degrades only slightly, maintaining a green color for a longer period or even remaining completely green without yellowing. Stay-green genes are ideal materials for studying the physiological and metabolic processes of plant senescence, chlorophyll metabolism, photosynthetic electron transport, plant responses to hormones, and stress resistance (drought resistance, salt stress, heat tolerance, etc.). Research on stay-green mutants can not only obtain new materials with anti-senescence, high yield, and resistance properties but also enrich crop stress resistance gene resources, which is of great significance for crop variety improvement.

[0003] Non-heading Chinese cabbage is an important leafy vegetable in my country, playing a crucial role in the year-round supply of vegetables. However, leaf senescence severely affects its yield and quality. During senescence, the photosynthetic capacity of the leaves decreases, the accumulation of photosynthetic products is reduced, the normal growth and development of the plant is inhibited, leading to yellowing and wilting of the leaves, which significantly reduces its commercial value. At the same time, leaf yellowing also causes huge losses during the storage and transportation stage after harvest.

[0004] Currently, traditional agricultural measures such as rational fertilization, irrigation, and pest and disease control can delay leaf senescence in non-heading Chinese cabbage to some extent, but their effects are limited. Genetic engineering technology offers a new approach to solving this problem. Existing research indicates that chlorophyll-holding genes play a crucial role in regulating leaf senescence in plants. However, current research on chlorophyll-holding genes in non-heading Chinese cabbage is insufficient, failing to fully utilize gene editing technology to precisely regulate these genes and effectively delay leaf senescence. In Arabidopsis thaliana, studies have shown that SGR1 is a major regulator of chlorophyll degradation, while SGR2 is considered functionally redundant or has a negative regulatory effect. This perception may lead to technical bias in the field, with some believing that simultaneously knocking out SGR1 and SGR2 genes in Chinese cabbage is unnecessary and may even adversely affect the plant by interfering with the complex regulatory network. Therefore, developing a technology that can overcome such bias and efficiently utilize a dual-gene editing strategy to obtain a super-chlorophyll-holding phenotype has significant innovative value. Summary of the Invention

[0005] One of the objectives of this invention is to provide a set of sgRNAs for gene editing of the green-holding gene in non-heading Chinese cabbage, including sgRNAs for gene editing of the Bra020829 (SGR1) gene in non-heading Chinese cabbage and / or sgRNAs for gene editing of the Bra000755 (SGR2) gene in non-heading Chinese cabbage.

[0006] The sgRNA used for gene editing of the non-heading Chinese cabbage Bra020829 (SGR1) gene includes sgRNA1 and sgRNA2. The nucleotide sequence of sgRNA1 is: CCAACGCTCCCTAGAACTTA, and the nucleotide sequence of sgRNA2 is: TGATTCGAAGATCGCTGGTC.

[0007] The sgRNAs used for gene editing of the non-heading Chinese cabbage Bra000755 (SGR2) gene include sgRNA1 and sgRNA2. The nucleotide sequence of sgRNA1 is: TCACAGTGACATAACCGCTA, and the nucleotide sequence of sgRNA2 is: TGTTCCGGGACGAAGTAGTG.

[0008] The second objective of this invention is to provide a CRISPR / Cas9 vector for gene editing of the green-keeping gene in non-heading Chinese cabbage, wherein the vector is a pYLCRISPR / Cas9P35S-N vector with the above-mentioned sgRNA nucleotide sequence inserted.

[0009] The third objective of this invention is to provide the application of the above-mentioned CRISPR / Cas9 vector in constructing delayed non-heading Chinese cabbage leaf senescence lines.

[0010] The fourth objective of this invention is to provide a method for delaying leaf senescence in non-heading Chinese cabbage by editing a chlorogenic gene, comprising the following steps:

[0011] (1) Based on the Bra020829 (SGR1) gene and / or Bra000755 (SGR2) gene of non-heading Chinese cabbage, the above sgRNA was designed, and the DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR / Cas9 to construct a gene editing vector.

[0012] (2) After transforming the gene-editing vector from step (1) into Agrobacterium tumefaciens, the explants of the non-heading Chinese cabbage recipient material were infected. The infected explants were then placed in a solution containing 6 mg / L of... Adventitious shoots were induced and screened on the screening regeneration medium to obtain transformed plants containing gene editing elements;

[0013] (3) Molecular identification was performed on the transformed plants from step (2) to screen for positive plants with site-directed mutations in the SGR1 and / or SGR2 genes.

[0014] (4) Observe the leaf senescence phenotype and determine the shelf life of the positive plants to obtain non-heading Chinese cabbage plants with delayed leaf senescence and strong green retention.

[0015] Furthermore, in step (1), the gene editing vector backbone is pYLCRISPR / Cas9P35S-N.

[0016] Beneficial effects

[0017] This invention designs sgRNAs targeting the conserved functional regions of the SGR1 and SGR2 genes in non-heading Chinese cabbage, and uses CRISPR / Cas9 technology to achieve site-directed mutagenesis with high editing efficiency, inducing a green-holding phenotype. The onset of leaf senescence in gene-edited plants is delayed by 15-20 days compared to wild type, and the shelf life after harvest is extended to 7-10 days, which is significantly improved compared to wild type (3-5 days), while there is no significant difference in agronomic traits (plant height, leaf area, yield). The green-holding and shelf-life effects produced by double gene knockout are not a simple sum of the effects of two single gene knockouts, but rather produce a significant synergistic enhancement effect.

[0018] The method of this invention is simple to operate and low in cost. It can be directly applied to the breeding practice of non-heading Chinese cabbage to cultivate new germplasm with strong green retention. At the same time, it provides technical reference for the senescence regulation of other cruciferous vegetables, and has both theoretical value and economic significance. Attached Figure Description

[0019] Figure 1 This is a sequencing alignment diagram of the SGR1 gene sgRNA1 target site. The upper sequence is the wild-type (WT) SGR1 gene target site sequence, which fully contains the sgRNA1 sequence (CCAACGCTCCCTAGAACTTA) and the downstream PAM sequence. The lower sequence is the SGR1 gene target site sequence of the gene-edited plant (YB1). The alignment with the wild-type sequence shows a 1bp insertion mutation downstream of the sgRNA1 target site. This mutation type accounts for 37.10% of the sequencing results, while the wild-type sequence accounts for 62.90%, indicating that the SGR1 gene has achieved site-specific editing.

[0020] Figure 2 This is a schematic diagram of the sgRNA1 target sequence of the SGR1 gene; the target is located in a conserved region of the SGR1 gene coding region.

[0021] Figure 3Comparison of leaf senescence phenotypes between gene-edited plants and wild-type plants: Top left image shows the phenotype of wild-type (WT) plant leaves after 15 days in a dark, sealed environment; top right image shows the phenotype of SGR1 gene-edited plant (YB1) leaves after 15 days in a dark, sealed environment; bottom left image shows wild-type (WT) plants; bottom right image shows SGR1 gene-edited plant (YB1).

[0022] Figure 4 This is a summary diagram of sequencing results for multiple mutation types in the target region of SGR2 gene-edited plants. It shows 14 target mutation types, and labels the mutation type (4bp deletion, 8bp deletion, base substitution, etc.), corresponding read count and proportion for each plant, intuitively presenting the diversity and efficiency of SGR2 gene editing. Some plants showed two-site mutations (such as 2D+4D, 1D+8D), further verifying the reliability of the editing system.

[0023] Figure 5 This is a sequencing alignment diagram of the SGR2 gene sgRNA1 target region; where: the upper sequence is the wild-type (WT) SGR2 gene target region sequence, including the sgRNA1 sequence (TCACAGTGACATAACCGCTA) and the PAM sequence (AGC, marked with a box); the lower sequence is the SGR2 gene target region sequence of the gene-edited plant (YB2).

[0024] Figure 6 In the figure, a is a bar chart of chlorophyll content determination for four types of plants, and b is a bar chart of chlorophyll content determination for four types of plants.

[0025] Figure 7 The changes in weight loss rate of different types of plants 10 days after harvest. Detailed Implementation

[0026] The embodiments provide a detailed description of preferred embodiments of the present invention. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0028] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0029] The present invention will be further described in detail below with reference to specific embodiments, but the scope of protection of the present invention is not limited to the content described.

[0030] Example 1

[0031] 1. sgRNA design and single-gene editing vector construction

[0032] (1) Design, screening and optimization of sgRNA

[0033] ① Initial screening: Using the CRISPR-P2.0 online tool, eight candidate sgRNAs with high scores were designed for the coding regions of the Bra020829 (SGR1) and Bra000755 (SGR2) genes of non-heading Chinese cabbage, especially the conserved functional regions. The Cas-OFFinder tool was used to scan the candidate sgRNAs for off-target sites across the entire genome, setting an allowable number of mismatches ≤ 3, and candidate sgRNAs that did not meet the requirements were removed.

[0034] ② In vitro cleavage efficiency verification: Using SGR1 and SGR2 genomic DNA as templates, approximately 500 bp fragments containing the target sites of each sgRNA were amplified by PCR. Cas9 mRNA and four sgRNAs (two each for SGR1 and SGR2 genes) were synthesized using a commercially available in vitro transcription kit. The purified Cas9 protein was incubated with each sgRNA and its corresponding PCR substrate at 37°C for 1 hour. The products were then subjected to agarose gel electrophoresis, and the intensity of the cleaved bands was compared with that of the uncleaved bands.

[0035] ③ Comprehensive Selection: Based on the criteria of in vitro cleavage efficiency >85% and the fewest predicted potential off-target sites (≤2, located in intergenic regions), the following four sgRNAs were selected for subsequent vector construction (Table 1). After determining the sgRNA sequences, a biotechnology company was commissioned to synthesize sgRNA expression cassettes, with complementary AscI restriction sites added to both ends of the cassettes. Screening and validation ensured the high efficiency and high specificity of the sgRNAs used in this invention.

[0036] Table 1. Selected sgRNA sequence information in this invention

[0037]

[0038] (2) Vector digestion and ligation: Take the pYLCRISPR / Cas9P35S-N vector, digest it with AscI restriction endonuclease at 37℃ for 3h, and recover the linearized vector fragment by agarose gel electrophoresis; mix the sgRNA expression cassette and the linearized vector at a molar ratio of 3:1, add T4 DNA ligase, and ligate overnight at 16℃.

[0039] (3) Transformation and verification: The ligation product was transformed into Escherichia coli DH5α competent cells, plated on LB medium containing 50 mg / L kanamycin, and cultured at 37°C for 12 h; single colonies were picked to extract plasmids, and the sgRNA was correctly inserted by enzyme digestion and sequencing verification to obtain vectors pYLCRISPR / Cas9-SGR1 and pYLCRISPR / Cas9-SGR2.

[0040] 2. Construction of dual gene editing vector

[0041] (1) Design of specific sgRNA coding sequences: Based on the four target sequences provided in Sequence Listing 1, oligonucleotide pairs for cloning were designed. Each oligonucleotide contained a normalized terminal sequence compatible with the selected cloning system and a target-specific sequence.

[0042] (2) Vector assembly: The vector was constructed using the Golden Gate assembly method based on the BsaI restriction enzyme. The brief steps are as follows:

[0043] The synthesized oligonucleotide pairs containing the target sequence were cloned into the corresponding pYL-U6 series vectors to obtain four independent sgRNA expression modules.

[0044] Subsequently, using the backbone vector pYLCRISPR / Cas9P35S-N, which contains the CaMV 35S promoter to drive Cas9 gene expression, as the recipient, the four sgRNA expression modules were placed in the same reaction system with the backbone vector. Through a single enzyme digestion-ligation reaction, the four sgRNA expression cassettes were orderly and directionally assembled into the specific multiple cloning site of the backbone vector.

[0045] (3) Transformation and verification: The ligation product was transformed into Escherichia coli DH5α competent cells, plated on LB medium containing 50 mg / L kanamycin, and cultured at 37°C for 12 h; single colonies were picked to extract plasmids, and the sgRNA was correctly inserted by enzyme digestion and sequencing verification to obtain the target vector, named pYL-Cas9-S1S2.

[0046] Example 2

[0047] Agrobacterium-mediated genetic transformation of non-heading Chinese cabbage

[0048] (1) Sterile seedling culture: Select plump seeds of the non-heading Chinese cabbage variety "Suzhou Green", disinfect them and inoculate them into 1 / 2 MS medium. Culture them for 8 days at 25℃ and 16h light to obtain sterile seedlings; (2) Explant pre-culture: Cut off the cotyledons and hypocotyls of the sterile seedlings and inoculate them into MS medium. Culture them at 25℃ and light for 2 days to adapt the explants to the in vitro environment; (3) Agrobacterium tumefaciens bacterial culture preparation: Transform Agrobacterium tumefaciens GV3101 with three gene editing vectors pYLCRISPR / Cas9-SGR1, pYLCRISPR / Cas9-SGR2, and pYL-Cas9-S1S2 respectively. Select positive clones and inoculate them into LB medium (containing 50mg / L kanamycin + 50mg / L rifampin). Culture them at 28℃ with shaking until OD. 600 =0.5, centrifuged, and resuspended in MS liquid medium containing 100 μM AS to OD. 600 =0.3; (4) Infection and co-culture: The pre-cultured explants were immersed in Agrobacterium tumefaciens solution, shaken for 10 min to infect, and after the bacterial solution was dried, they were inoculated into co-culture medium (MS + 30 g·L). -1 sucrose + 7g·L -1 (5) Screening and regeneration: The explants were transferred to differentiation medium (MS + 30 g·L⁻¹) and cultured in the dark at 25°C for 3 days. 1 sucrose + 7g·L -1 Agar + 200 mg / L -1 Carbenicillin (CCB) + 200 mg / L -1 Timentin, after 30 days of culture, differentiated adventitious shoots, which were then transferred to rooting medium (MS solid medium + 30 g·L⁻¹). -1 sucrose + 7g·L -1 Agar + 200 mg / L -1 CCB+200mg·L -1 Timentin + 0.25 mg / L -1 Rooting was induced by NAA to obtain regenerated plants.

[0049] Example 3

[0050] Optimization and Conversion Efficiency Statistics of Regeneration System

[0051] Through extensive preliminary experiments conducted by the inventors, it was discovered that... It has a significant effect on reducing browning of 'Suzhou Green', with a concentration of about 6 mg / L. Therefore, we will continue to conduct optimization experiments on the regeneration system.

[0052] Add 6 mg / L to the differentiation medium in Example 2 , and no addition The results were compared with those of Example 2, and the other steps were the same. The browning rate and budding rate of the explants were regularly recorded.

[0053] Adventitious buds were subjected to PCR detection, and the final positive transformation efficiency was calculated (number of positive seedlings / number of infected explants × 100%).

[0054] Table 2. Effects of different regeneration conditions on the genetic transformation efficiency of 'Suzhou Green'

[0055]

[0056] The results (Table 2) show that "cotyledons with petioles + "The positive conversion efficiency of the combination was significantly higher than that of other groups, while the group without..." Alternatively, the combination using hypocotyls had the lowest efficiency. Since screening with silver nitrate differentiation medium yielded better results, and to ensure consistency in the measurements of each indicator, Examples 4-7 below all used "cotyledon with petiole + "The regenerated plants obtained from the combination were used for experiments."

[0057] Example 4

[0058] Identification of positive plants

[0059] (1) PCR detection: Genomic DNA was extracted from 24 regenerated plants (including 10 SGR1 editing lines, 11 SGR2 editing lines, and 3 double gene editing lines). Gene cloning was performed on the target sites 100 bp upstream and downstream. The results showed that the target bands were amplified in all 24 regenerated plants. (2) Target site sequencing identification: The target regions of SGR1 and SGR2 genes were sequenced in the 24 positive plants. The results showed that there was a 1 bp insertion mutation downstream of the sgRNA1 target site in 9 SGR1 genes. This mutation type accounted for 37.10% of the sequencing results, while the wild-type sequence accounted for 62.90%, indicating that the SGR1 gene achieved site-specific editing. Figure 1 Nine SGR2 gene mutations of 4bp or 8bp were found, further verifying the reliability of the editing system; three regenerated seedlings of the dual gene editing system simultaneously had a 1bp insertion mutation in the SGR1 gene and a 4bp deletion mutation in the SGR2 gene; (3) Sequencing results analysis: the 1bp insertion mutation in the SGR1 gene caused reading frame shift, and the 4bp / 8bp deletion mutation in the SGR2 gene destroyed the conserved structure of the coding region, both of which resulted in loss of gene function, which is in line with the expected editing effect.

[0060] Based on the sequencing results, all regenerated plants were divided into the following four lines:

[0061] WT: Wild type; YB1: Frameshift mutation only in SGR1; YB2: Mutation only in SGR2; DKO: Mutation in both SGR1 and SGR2.

[0062] Example 5

[0063] Leaf senescence phenotype and shelf life determination

[0064] (1) Field phenotypic observation: Plants with positive target mutations and wild-type plants were planted in the experimental field of Nanjing Agricultural University and managed in a routine field. Leaf senescence was recorded starting 60 days after sowing. The results showed that the leaves of wild-type plants began to turn yellow and senescent, while the leaves of SGR1 single mutant, SGR2 single mutant, and double mutant plants remained bright green, with the onset of senescence delayed by 15 days, 18 days, and 22 days, respectively.

[0065] (2) Determination of shelf life: After harvest, select functional leaves of uniform size and store them at room temperature (25℃). Observe the condition of the leaves regularly. After 3 days of storage, 50% of the leaves of wild type turned yellow and lost their commercial value; the shelf life of leaves of SGR1 single mutant was 7 days, SGR2 single mutant was 8 days, and double mutant was 11 days, with a significantly extended shelf life.

[0066] Example 6

[0067] Agronomic trait determination

[0068] After recording the leaf senescence, the plants were harvested uniformly, and the agronomic traits of the gene-edited (YB1, YB2, DKO) and wild-type (WT) plants were measured separately.

[0069] Plant height: The natural height of the plant from its base where it touches the ground to its highest point. Measured with a ruler.

[0070] Maximum leaf area: Take the largest leaf and measure it using a Li-3050C leaf area meter.

[0071] Yield: After harvesting, remove the outer yellowed leaves, rotten leaves, and roots, keeping only the edible parts above ground. Weigh each plant using an electronic scale and take the average weight. Finally, calculate the yield per mu (unit of land area). Yield per mu (kg / mu) = weight of single plant * 667 / (0.2 * 0.2).

[0072] Table 3. Comparison of agronomic traits between gene-edited and wild-type genes.

[0073]

[0074] The results showed that the edited plants did not differ significantly from the wild type in agronomic traits, and gene editing did not affect the existing superior traits of the wild type.

[0075] Example 7

[0076] 1. Pre-harvest aging index determination

[0077] (1) Chlorophyll content determination

[0078] The chlorophyll content was determined using the 95% ethanol extraction method. On the 55th day after sowing, 0.1g of fresh outer leaves from non-heading Chinese cabbage plants were taken and placed in test tubes. 5ml of 95% ethanol was added to each test tube, ensuring the sample was completely immersed in the ethanol solution. After soaking in the dark for 48 hours, the chlorophyll extract was poured into a cuvette. Using 95% ethanol as a control, the sample was zeroed, and the absorbance was measured at wavelengths of 665nm, 649nm, and 470nm.

[0079] Ca = 13.95 A665 - 6.88 A649

[0080] Cb = 24.96 A649 - 7.32 A665

[0081] In the formula: Ca and Cb are the concentrations of chlorophyll a and b, respectively.

[0082] Chloroplast pigment content (mg / g) = (pigment concentration × extraction liquid volume) / sample fresh weight

[0083] Total chlorophyll content = Ca + Cb.

[0084] Figure 6 The results showed a significant difference in chlorophyll content between the gene-edited and wild-type strains. The chlorophyll content of the YB1 strain was approximately 1.4 times that of the wild-type, the YB2 strain was approximately 1.5 times that of the wild-type, and the DKO strain was approximately 3.15 times that of the wild-type. The effect of dual gene editing (315%) was significantly higher than the sum of the effects of two single knockouts (150% + 140% - 100% = 190%), demonstrating the synergistic enhancement effect of SGR1 and SGR2. Chlorophyll degradation is the most direct factor leading to leaf yellowing and senescence. This result reveals that gene editing of the chlorophyll-holding gene delayed chlorophyll degradation, thereby delaying senescence. Given the negative regulatory role of SGR2 in Arabidopsis, the effect of dual gene editing was unexpected.

[0085] (2) Determination of malondialdehyde content

[0086] The thiobarbituric acid method was used for determination. On the 55th day after sowing, 0.5g of leaves were chopped and placed in a mortar, 5ml of 5% TCA solution was added, and the mixture was ground into a homogenate. The homogenate was then transferred to a centrifuge tube and centrifuged at 3000 rpm for 20 min. 2ml of the supernatant was collected in a centrifuge tube, and an equal volume of 0.67% TBA (thiobarbituric acid) was added. The mixture was boiled in a 100℃ water bath for 30 min, rapidly cooled with cold water, and centrifuged at 3000 rpm for 10 min. The OD values ​​of the supernatant were measured at 450nm, 532nm, and 600nm (zeroed with deionized water).

[0087] Calculate the MDA content in the tissue:

[0088] MDA concentration C (umol / L) = 6.45 * (OD532 - OD600) - 0.56 * OD450

[0089] MDA content (umol / g FW) = C × V / W

[0090] In the formula, V is the volume of the extract (1.8 ml) and W is the fresh weight of the sample (0.5 g).

[0091] Results: Malondialdehyde (MDA) can reflect the integrity of the cell membrane to some extent. The higher the MDA content, the greater the cell membrane permeability and the more severe the cell aging. Figure 6 The results showed that the malondialdehyde (MDA) content in the leaves of wild-type plants was about 60% higher than that of the gene-edited plants, while there was no significant difference in MDA content between the gene-edited YB1 and YB2 lines; the MDA content in the leaves of wild-type plants was nearly four times that of the DKO line. This difference in MDA content also demonstrates the high efficiency of dual gene editing in anti-aging.

[0092] 2. Postharvest preservation index determination

[0093] Determination of weight loss rate

[0094] After harvesting, non-heading Chinese cabbage was stored in PE plastic bags at room temperature (25℃). The weight of the Chinese cabbage was measured and recorded on day 0, day 1, day 3, day 5, day 7, and day 10.

[0095] Weight loss rate (%) = (initial weight - final weight) / initial weight × 100%.

[0096] Result: As Figure 7 As shown, the weight loss rates of the wild-type, YB1, YB2, and DKO strains were very similar after 3 days of storage. However, between 3 and 5 days, the weight loss rate of the wild-type strain approached 20%, significantly reducing its marketability. YB1 and YB2 strains only gradually lost their marketability after 7 days, while DKO maintained a certain level of marketability even after 10 days. This demonstrates that gene editing of the green-holding gene improved the shelf life of non-heading Chinese cabbage.

[0097] The gene editing method provided by this invention can precisely target the SGR1 and / or SGR2 genes in non-heading Chinese cabbage, rapidly obtaining plants with improved green-holding traits. This method can not only be used for breeding new non-heading Chinese cabbage varieties, shortening the breeding cycle (stable green-holding varieties can be obtained in 2-3 generations), but also reduce post-harvest preservation costs, reduce losses during transportation and storage, and increase commercial value. Furthermore, the technical concept of this invention can be extended to improving the green-holding trait in cruciferous crops such as rapeseed and cabbage, providing a general technical solution for vegetable quality breeding, and has broad application prospects and market value.

Claims

1. A method for delaying leaf senescence in non-heading Chinese cabbage by gene editing a green-keeping gene, characterized in that, Includes the following steps: (1) Based on the SGR1 gene Bra020829 and SGR2 gene Bra000755 of non-heading Chinese cabbage, sgRNA was designed, and the DNA fragment containing the sequence encoding the sgRNA was ligated into a vector carrying CRISPR / Cas9 to construct a gene editing vector. The sgRNAs used for gene editing of the non-heading Chinese cabbage SGR1 gene Bra020829 include sgRNA1 and sgRNA2. The nucleotide sequence of sgRNA1 is: CCAACGCTCCCTAGAACTTA, and the nucleotide sequence of sgRNA2 is: TGATTCGAAGATCGCTGGTC. The sgRNAs used for gene editing of the non-heading Chinese cabbage SGR2 gene Bra000755 include sgRNA1 and sgRNA2. The nucleotide sequence of sgRNA1 is: TCACAGTGACATAACCGCTA, and the nucleotide sequence of sgRNA2 is: TGTTCCGGGACGAAGTAGTG. The gene editing vector backbone is pYLCRISPR / Cas9P35S-N; (2) After transforming the gene editing vector of step (1) into Agrobacterium tumefaciens, the explants of the non-heading Chinese cabbage recipient material were infected. The infected explants were then subjected to adventitious shoot induction and screening on a selection and regeneration medium containing AgNO3 to obtain transformed plants containing gene editing elements. The concentration of AgNO3 was 6 mg / L. (3) Molecular identification was performed on the transformed plants from step (2) to screen for positive plants with site-directed mutations in the SGR1 and SGR2 genes. (4) Observe the leaf senescence phenotype and determine the shelf life of the positive plants to obtain non-heading Chinese cabbage plants with delayed leaf senescence and strong green retention.

Images