Bladder cancer nucleic acid aptamer, nucleic acid aptamer derivative and application thereof

Abstract

The application belongs to the field of molecular biology and medical detection technology, and discloses a bladder cancer nucleic acid aptamer, a nucleic acid aptamer derivative and application thereof.The nucleotide sequence of the nucleic acid aptamer is shown as SEQ ID NO:6.Through an exponential enrichment system evolution (SELEX) technology, a single clone nucleic acid aptamer DNA chain of a bladder cancer tissue sample is screened, and two target proteins targeted and combined with the nucleic acid aptamer are identified.The nucleic acid aptamer can specifically target the target proteins CAPRIN1 and FXR1 on the surface of bladder tumor cells.The nucleic acid aptamer screened in the application has the advantages of high affinity and specificity, no immunogenicity, simple chemical synthesis, stability, easy preservation and labeling, and the like, and provides a new molecular tool for early diagnosis and targeted treatment of bladder cancer.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and medical detection technology, and in particular to a bladder cancer nucleic acid aptamer, a nucleic acid aptamer derivative, and their applications. Background Technology

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system worldwide, with consistently high incidence and mortality rates. Therefore, early diagnosis and precision treatment are crucial for improving patient survival and prognosis. Currently, the clinical diagnosis of bladder cancer mainly relies on cystoscopy and tissue biopsy, methods that are invasive and can cause complications, bringing pain and risks to patients. Therefore, developing non-invasive, highly sensitive, and highly specific early diagnostic tools is a current research focus.

[0003] Nucleic acid aptamers (Apts) are highly structured, small, single-stranded DNA or RNA fragments that can specifically bind to cellular target molecules, obtained through systematic evolutionary exponential enrichment of ligands (SELEX) technology from random oligonucleotide libraries. They possess high affinity and specific recognition of one or more ligand molecules, and are thus known as "chemically synthesizable antibodies." Compared to antibodies, aptamers offer advantages such as small size, ease of in vitro synthesis and modification, high stability, low immunogenicity, and low cost, demonstrating significant application potential in molecular diagnostics, targeted drug delivery, and bioimaging. In tumor detection, Apts can specifically target and bind to tumor proteins, providing a new approach for non-invasive diagnosis and targeted therapy.

[0004] Current research on bladder cancer nucleic acid aptamers relies on screening based on known target proteins. This simple screening model limits the number and diversity of available aptamers. Furthermore, the microenvironment of bladder tumor tissue in the human body is extremely complex, and existing aptamer screening techniques cannot accurately reflect tumor heterogeneity and the true in vivo microenvironment, thus limiting their clinical application. To address these limitations, aptamer screening directly using patient-derived bladder cancer tissue samples yields highly accurate and specific targets, enabling more precise identification of targets that play a crucial role in real human tumors.

[0005] Currently, research on specific nucleic acid aptamers and their target proteins for bladder cancer tissue samples is insufficient, and systematic screening and validation methods are lacking. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a bladder cancer nucleic acid aptamer, nucleic acid aptamer derivatives, and their applications. The nucleic acid aptamer is a bladder cancer-specific ssDNA nucleic acid aptamer capable of specifically targeting the target proteins CAPRIN1 and FXR1 on the surface of bladder tumor cells. This invention also discloses the screening and optimization of the nucleic acid aptamer. The nucleic acid aptamer possesses advantages such as high affinity and specificity, non-immunogenicity, simple chemical synthesis, stability, and ease of storage and labeling.

[0007] To achieve the above objectives, this invention selected clinical bladder cancer tissue specimens, successfully screened for a specific ssDNA, and used liquid chromatography-mass spectrometry to identify potential target proteins that highly target it. Ultimately, this invention provides a method for identifying bladder cancer-specific ssDNA aptamers, aptamer derivatives, and their target proteins.

[0008] The specific technical solution adopted in this invention is as follows:

[0009] In a first aspect, the present invention provides a bladder cancer nucleic acid aptamer, specifically a bladder cancer-specific ssDNA nucleic acid aptamer, the nucleotide sequence of which is selected from any of the following:

[0010] i. Nucleic acid aptamer BCTA-8, the nucleotide sequence of which is shown in SEQ ID NO: 6;

[0011] ii. An oligonucleotide sequence with more than 60% homology to the nucleic acid aptamer described in i;

[0012] iii. The DNA sequence that hybridizes with the nucleic acid aptamer described in i.

[0013] This invention uses the exponential enrichment systemic evolution (SELEX) technique to screen single-stranded nucleic acid aptamers that target bladder cancer cells. A series of experiments, including in vitro affinity testing, have confirmed that the nucleic acid aptamers screened in this invention have specific targeting recognition effects on the two target proteins CAPRIN1 and FXR1 identified in the samples.

[0014] As a preferred embodiment of the bladder cancer-specific ssDNA aptamer of the present invention, its nucleotide sequence is an oligonucleotide sequence with homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% or more to the aptamer described in i.

[0015] Preferably, the nucleic acid aptamer has a G-quadruplex structure.

[0016] Preferably, the nucleic acid aptamer is a lyophilized powder; the nucleic acid aptamer of the present invention is synthesized using a solid-phase synthesis method, and is preferably in the form of a lyophilized powder.

[0017] Secondly, the present invention provides a bladder cancer nucleic acid aptamer derivative, specifically a bladder cancer-specific ssDNA nucleic acid aptamer derivative, which is obtained by modifying the nucleic acid aptamer described in i above.

[0018] In a preferred embodiment of the derivative of the specific ssDNA nucleic acid aptamer described in this invention, the modification includes marker labeling.

[0019] As a further preferred embodiment of the derivative of the specific ssDNA nucleic acid aptamer described in this invention, the marker includes at least one of isotope markers, fluorescent markers, biotin markers, enzyme markers, and chemiluminescent markers.

[0020] In one embodiment, the nucleic acid aptamer derivative is a derivative of a nucleic acid aptamer obtained by labeling the 5' end of the nucleic acid aptamer with an anthocyanin dye group.

[0021] In one embodiment, the nucleic acid aptamer derivative is a derivative of a nucleic acid aptamer obtained by labeling the 5' end of the aforementioned nucleic acid aptamer with biotin-vitamin H.

[0022] Preferably, the nucleic acid aptamer derivative is a lyophilized powder; the nucleic acid aptamer derivative of the present invention is synthesized by solid-phase synthesis, preferably in the form of lyophilized powder.

[0023] Thirdly, the present invention provides a reagent for detecting target proteins in bladder cancer tissue samples, comprising the aforementioned nucleic acid aptamers and / or nucleic acid aptamer derivatives.

[0024] Fourthly, the present invention provides the application of the described nucleic acid aptamer, the described nucleic acid aptamer derivative, or the described reagent in the preparation of products for detecting or purifying target proteins.

[0025] As a preferred embodiment of the application described in this invention, the product includes at least one of a reagent kit, a biosensor, and a detection chip.

[0026] The beneficial effects of this invention are:

[0027] 1. This invention uses clinical bladder cancer tissue samples for screening to obtain a monoclonal nucleic acid aptamer with high affinity and specificity, and identifies two potential target proteins that can bind to it, namely CAPRIN1 and FXR1.

[0028] 2. The nucleic acid aptamers obtained by screening bladder tumor tissue samples in this invention have high affinity; no immunogenicity; can be chemically synthesized in vitro; have small molecular weight; can be labeled or modified for different sites; and have stable nucleic acid aptamer sequences that are easy to preserve.

[0029] 3. The nucleic acid aptamers of this invention are used to identify the expression of target proteins on the surface of tumor cells, which is efficient, simple and rapid.

[0030] 4. The nucleic acid aptamer synthesis cost of the present invention is lower than that of antibody preparation, with a shorter cycle and better reproducibility. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the SELEX screening principle for bladder cancer-specific ssDNA aptamers in Embodiment 1 of the present invention;

[0032] Figure 2 This is a schematic diagram of the results of examining library affinity by flow cytometry in Embodiment 1 of the present invention;

[0033] Figure 3 This is a schematic diagram showing the fluorescence intensity results of the library binding with cancer cells in Example 1 of the present invention;

[0034] Figure 4 This is a schematic diagram of the results of flow cytometry examination of the affinity of eight nucleic acid aptamers (Apt1, 4-9, 11) for positive screening cells in Example 2 of the present invention; wherein the negative sequence is used as a control, and the flow cytometry binding fluorescence shift is considered to be significantly larger than that of the negative sequence, indicating specific binding ability;

[0035] Figure 5 This is a schematic diagram of the results of flow cytometry examination of the affinity of eight nucleic acid aptamers (Apt1, 4-9, 11) for cell screening in Example 2 of the present invention; wherein the negative sequence is used as a control, and the flow cytometry binding fluorescence shift is considered to be significantly larger than that of the negative sequence, indicating non-specific binding to cells;

[0036] Figure 6 This is a schematic diagram showing the fluorescence intensity results of the binding of nucleic acid aptamers to cancer cells in Example 2 of the present invention; wherein, Figure 6 A represents the fluorescence intensity results of the binding of 8 nucleic acid aptamers to forward and reverse screening cells. The fluorescence intensity of each nucleic acid aptamer binding to the reverse screening cell is extremely low and cannot be shown in the figure. Figure 6 B represents the fluorescence intensity results of the binding of 8 nucleic acid aptamers to positive screening cells; Figure 6 C represents the fluorescence intensity of the binding of 8 nucleic acid aptamers to the reverse screening cells;

[0037] Figure 7 This is a high-resolution mass spectrum of the nucleic acid aptamer of Example 3 of the present invention;

[0038] Figure 8 This is the structure of the nucleic acid aptamer in Example 4 of the present invention;

[0039] Figure 9 This is the flow cytometry result of the affinity of the nucleic acid aptamer for cancer cells in Example 5 of the present invention;

[0040] Figure 10 This is a high-resolution mass spectrum of the nucleic acid aptamer labeled with anthocyanin dye group in Example 6 of the present invention;

[0041] Figure 11 This is a flow cytometry experiment result of nucleic acid aptamers recognizing bladder cancer cells Scaber in Example 7 of the present invention;

[0042] Figure 12 This is the affinity detection (surface plasmon resonance, SPR) of the nucleic acid aptamer to the target protein ACTBL2 in Example 8 of the present invention.

[0043] Figure 13 This is the affinity detection (surface plasmon resonance, SPR) of the nucleic acid aptamer to the target protein SULT1E1 in Example 8 of the present invention.

[0044] Figure 14 This is the affinity detection (surface plasmon resonance, SPR) of the nucleic acid aptamer to the target protein UAP1L1 in Example 8 of the present invention.

[0045] Figure 15 This is the affinity detection (surface plasmon resonance, SPR) of the nucleic acid aptamer to the target protein FXR1 in Example 8 of the present invention.

[0046] Figure 16 This is the affinity test (surface plasmon resonance, SPR) of the nucleic acid aptamer to the target protein CAPR1N1 in Example 8 of the present invention. Detailed Implementation

[0047] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0048] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. The present invention can be embodied in many different forms of embodiments, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0049] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. In the examples, the nucleic acid aptamer sequences and cyanine dye groups or biotin-vitamin H-labeled nucleic acid aptamers were synthesized by Shanghai Sangon Biotech Co., Ltd.; ACTBL2, CAPRIN1, and FXR1 proteins were purchased from Shanghai Zeye Biotechnology Co., Ltd., with product catalog numbers ZY61556, ZY60240, and ZY67829, respectively; the Q-PCR mix solution was an aqueous solution containing 10× enzyme buffer, 10mM dNTP mix, 100μM Lib1S1, 100μM Lib1A2, 50U Taq Plus enzyme, and EvaGreen; the PCR mix solution was an aqueous solution containing 10× enzyme buffer, 10mM dNTP mix, 100μM Lib1S1-FAM, 100μM Lib1A2-polyA, and 50U Taq Plus enzyme; the blocking buffer was a DPBS solution containing 10μg / mL salmon sperm DNA and 1mg / mL bovine serum albumin; the washing buffer was a solution containing 5mM MgCl2, 4.5 The solution was prepared with 0.1 mg / mL glucose in DPBS; the binding buffer was prepared by adding 0.1 mg / mL tRNA and 1 mg / mL bovine serum albumin to the wash buffer.

[0050] Lib1S1: GGGACCAGCACACGCATAAC, (SEQ ID NO: 9);

[0051] Lib1A2:CACGGTAGCACGCATAACGC, (SEQ ID NO: 10);

[0052] Lib1A2-pLoyA:AAAAAAAAAAAAAAAAAAAAAAAAA-Spacer18-CACGGTAGCACGCATAACGC;AAAAAAAAAAAAAAAAAAAAAAAAAAA is SEQ ID NO: 11;

[0053] Lib1S1-FAM:FAM-GGGACCAGCACACGCATAAC.

[0054] Example 1

[0055] The screening of bladder cancer-specific ssDNA aptamers includes the following steps:

[0056] Bladder tumor tissue samples (from intraoperative tissues of bladder cancer patients, including cancer tissue for positive screening and inflammatory tissue for negative screening) were pretreated. Tissue samples were added to 1 mL of pre-chilled DPBS, centrifuged twice, and the supernatant was discarded. 100 μL of blocking buffer was added, and the samples were incubated at 4°C on a shaker for 20 min. The samples were then centrifuged again, the supernatant was discarded, and the samples were stored on ice. Further repeated screening was then performed (see...). Figure 1 Taking the first round of screening as an example, the steps are as follows:

[0057] (1) Take one Lib library dry powder (a random single-stranded DNA library with 76 bp bases, purchased from Sangon Biotech (Shanghai) Co., Ltd.), centrifuge at 14000 rpm for 5-10 min, add DPBS and vortex to dissolve, centrifuge at 14000 rpm for 5-10 min and then place in a PCR instrument for renaturation (95℃ for 10 min, immediately in an ice water bath for 5 min, and equilibrate to room temperature);

[0058] (2) Add the renatured library to the reverse sieve magnetic beads, mix slowly with a pipette, and incubate on a shaker at room temperature for 60 min;

[0059] (3) Separate the magnetic beads using a magnetic separator, take the supernatant and label it as pool-, and wash with DPBS 4 times;

[0060] (4) Add ultrapure water to the positive screening cancer tissue, boil in a water bath for 10 min, centrifuge at 12000 g for 1 min, and take the supernatant as Elution+;

[0061] (5) Add pool- to the positive screening cancer tissue, mix slowly with a pipette, incubate on a shaker at room temperature for 60 min, and wash the resulting incubation solution 4 times with DPBS;

[0062] (6) Add ultrapure water to the inflamed tissue and boil for 10 min, centrifuge at 12000 g for 1 min, and retain the supernatant as Elution-;

[0063] (7) Add Elution+ and Elution- to the Q-PCR mix for PCR amplification (95 ℃ 2 min; 95 ℃ 0.5 min, 57 ℃ 0.5 min, 72 ℃ 0.5 min, 25 cycles);

[0064] (8) Mix the PCR mix solution and Elution+, add EM90 oil, vortex to prepare an emulsion, and perform PCR amplification (95 ℃ 2 min; 95 ℃ 1 min, 57 ℃ 1 min, 72 ℃ 1 min, 25 cycles).

[0065] (9) After the amplification in steps (7) and (8) is completed, add n-butanol to each product, mix well, centrifuge, discard the clear upper layer, collect the lower layer amplification product, add urea loading buffer and mix well, heat the PCR instrument at 95 ℃ for 10 min, separate the single strands by denaturing PAGE gel electrophoresis, and concentrate with n-butanol to obtain ssDNA.

[0066] (10) Subsequent screening can be adjusted based on the screening results of each round, and the operation steps are the same as above.

[0067] Finally, as Figure 2 and Figure 3 As shown, the affinity of the libraries obtained from each round of screening was determined by flow cytometry. Figure 2 The results of flow cytometry binding with tumor tissue cells after different rounds of screening are shown in the middle. Pool0, pool4, and pool6 represent the original library, the library after 4 rounds of screening, and the library after 6 rounds of screening, respectively. Figure 3 The results showed that with the increase of screening rounds, the binding amount of the library to cancer tissue cells in the positive screening was significantly increased (fluorescence intensity pool6 was 4.13 times that of pool0, and fluorescence intensity pool4 was 1.60 times that of pool0); the binding amount to adjacent inflammatory tissue cells in the negative screening was also increased (fluorescence intensity pool6 was 3.18 times that of pool0, and fluorescence intensity pool4 was 1.95 times that of pool0), but not as significantly as the positive screening.

[0068] The final nine aptamers with strong affinity were obtained through screening, and their nucleotide sequences are as follows:

[0069] The nucleic acid sequence of BCTA-1 (Apt1) is as follows:

[0070] 5'-CACGCATAACACCCAGTTTTCTCTGCCGCATTGATCAATCATGCGTGCGTTATGCGTG-3', SEQID NO: 1;

[0071] The nucleic acid sequence of BCTA-4 (Apt4) is as follows:

[0072] 5'-CACGCATAACCAAAACTGTCCGACTCATCTGGTGCTCTCAATATATTGCGTTATGCGTG-3', SEQID NO: 2;

[0073] The BCTA-5 (Apt5) nucleic acid sequence is as follows:

[0074] 5'-CACGCATAACCACACGCGATCTTGTTTTGCCCGAGCTCCCCACAATGCGTTATGCGTG-3', SEQID NO: 3;

[0075] The nucleic acid sequence of BCTA-6 (Apt6) is as follows:

[0076] 5'-CACGCATAACTTCCCAATGAACCCACCTCAGTCACGCACCGAAGAAGCGTTATGCGTG-3', SEQID NO: 4;

[0077] The nucleic acid sequence of BCTA-7 (Apt7) is as follows:

[0078] 5'-CACGCATAACTCAATCACTCATCGTAGTAAGGTAGAGGCTGGCCCAGCGTTATGCGTG-3', SEQID NO: 5;

[0079] The BCTA-8 (Apt8) nucleic acid sequence is as follows:

[0080] 5'-CACGCATAACTCTGATTGTGTCGGCCGCATTGCCCTCCTCTTCCATGCGTTATGCGTG-3', SEQ ID NO: 6;

[0081] The nucleic acid sequence of BCTA-9 (Apt9) is as follows:

[0082] 5'-CACGCATAACCTCAACACAATCGCCTTGTCCTGGCTGACAATCCTTGCGTTATGCGTG-3', SEQ ID NO: 7;

[0083] The nucleic acid sequence of BCTA-11 (Apt11) is as follows:

[0084] 5'-CACGCATAACCTTCCCACGATCGGGTTCCGCGCAAAAAACGCCGTAGCGTTATGCGTG-3', SEQ ID NO: 8.

[0085] Example 2 Optimization of Nucleic Acid Aptamers

[0086] Pretreatment of bladder tumor tissue samples: Take positive or negative screening tissue and add 1 mL of pre-cooled DPBS, centrifuge and rinse twice, and discard the supernatant; add 500 μL of DPBS and 500 μL of 2× tissue digestion enzyme to each, incubate on a shaker at room temperature for 30 min, centrifuge and discard the supernatant; add 1 mL of DPBS, gently vortex, centrifuge at 4 ℃ for 5 min, centrifuge and rinse twice, discard the supernatant, resuspend the cells in DPBS and store on ice to obtain positive or negative screening cells.

[0087] Eight Apt (5'-modified FAM) sequences obtained in Example 1 were screened at single concentrations using flow cytometry. The cells from both the positive and negative screening were divided into 10 aliquots each. One aliquot served as a blank control, and another as a negative control (using a negative sequence). The remaining eight aliquots were treated with 500 nM of salmon sperm DNA corresponding to Apt1, 4–9, 11, and 1 mg / mL, respectively. The aliquots were mixed by pipetting and incubated at 4 °C for 1 h. After incubation, the cells were washed twice with washing buffer, the supernatant was discarded, and the cells were resuspended in washing buffer. The samples were analyzed using the BD FACSVerse™ system. Single-concentration screening using flow cytometry successfully yielded several monoclonal sequences with binding ratios greater than 10-fold to the tissue control and no binding to the negative screening cells. Among these, BCTA-8 (Apt8) showed superior binding ability and specificity. Figure 4 , Figure 5 and Figure 6 As shown.

[0088] Example 3: Preparation of nucleic acid aptamers

[0089] The nucleic acid aptamers BCTA-8 (Apt8) of Examples 1 and 2 were synthesized using a solid-phase synthesis method. DNA containing a solid-phase carrier and protecting groups was synthesized through a multi-step solid-phase process, followed by ammoniation protection and purification to obtain the final product. Oligonucleotide sequences were synthesized using phosphoramide technology in the solid-phase synthesis.

[0090] The solid-phase synthesis method described in this embodiment is as follows:

[0091] First, depending on the scale, nucleic acid synthesis was performed using a nucleic acid synthesizer on a solid support (CPG carrier) made of glass with controllable porosity; all phosphoramide monomers were deprotected under alkaline conditions; all phosphoramide monomers were dissolved in anhydrous acetonitrile (100 mM) and dried with molecular sieves; an acetonitrile solution of 5-ethimercaptotetrazole (0.6 M) was used as an activating agent solution; the coupling time was 200 seconds; for unreacted active groups, a mixture of acetic anhydride, N-methylimidazolium, pyridine, and acetonitrile (N-methylimidazolium / acetonitrile ratio of 1:4; acetic anhydride / pyridine / acetonitrile ratio of 2:3:5) was used as a capping agent to cleave and deprotect the oligomers bound to the solid support.

[0092] Secondly, after solid-phase synthesis, the dried solid support was treated with ammonia solution at 55 °C for 16 h. The solution was then evaporated, and the solid residue was redissolved in water. The target nucleic acid chain was obtained by HPLC purification. Figure 7 As shown, quality control using high-resolution mass spectrometry revealed that the molecular weight of BCTA-8 was 17997.66 Da, indicating that the DNA sequence was correct.

[0093] Example 4: Structural detection of nucleic acid aptamers

[0094] G-quadruplexes may be important as the three-dimensional structure of aptamers because they improve nucleic acid properties, such as increased resistance to nuclease degradation. Circular dichroism (CD) spectroscopy is one of the most commonly used identification methods for characterizing tetradruplex types and their formation.

[0095] The nucleic acid aptamer BCTA-8 sample prepared in Example 3 was heated in a constant temperature metal bath at 95 °C for 5 min, and then allowed to stand at room temperature at 4 °C for 10 min to equilibrate to room temperature. The sample was diluted to 1 µM in DPBS (with 5 mM MgCl2 added), and then scanned from 200 nm to 400 nm in a 1 mm, 400 µL detection dish (under nitrogen protection throughout the experiment).

[0096] like Figure 8 As shown, the nucleic acid aptamer BCTA-8 has the characteristic peaks of the G-quadruplex structure.

[0097] Example 5: Affinity Detection of Nucleic Acid Aptamers

[0098] Flow cytometry can be used to perform a relative quantitative assessment of the affinity of nucleic acid aptamers, i.e., to determine their dissociation constant. Prepare the nucleic acid aptamer BCTA-8 described in Example 3 at gradient concentrations of 2000 nM (stock solution), 1000 nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.625 nM, 7.8125 nM, 3.90625 nM, and 1.953125 nM, each in 50 μL volume. Add 10 μL of 1 mg / ml salmon sperm DNA to each and mix thoroughly. Divide the positive screening cells into 11 aliquots, centrifuge to remove the supernatant, and incubate 10 aliquots in binding buffer with diluted Apt solution at 4°C for 1 h, ensuring a final incubation volume of 200 μL. After incubation, wash three times with washing buffer and analyze the samples using the BD FACSVerse™ system.

[0099] The results are as follows Figure 9 As shown, the concentration gradient affinity assay for nucleic acid aptamer BCTA-8 yielded a Kd value of 138.8 nM, indicating that this nucleic acid aptamer has high affinity and specificity.

[0100] Example 6 Nucleic acid aptamers labeled with cyanine dye groups

[0101] The nucleic acid aptamer BCTA-8 was labeled with the cyanine dye group Cy5. The details are as follows:

[0102] The dissolved Cy5 activated ester (dissolved in DMSO, 10 equivalents) was added to the amino-modified nucleic acid aptamer, and an appropriate amount of carbonate solution was added. The mixture was sonicated until completely dissolved and reacted at 25 °C for 1 h. After the reaction was completed, the mixture was sent to HPLC for purification to obtain each Cy5 fluorescently labeled nucleic acid aptamer.

[0103] like Figure 10 As shown, mass spectrometry analysis identified the labeled nucleic acid aptamer derivatives.

[0104] Example 7: Specific Target Recognition and Binding Experiment of Nucleic Acid Aptamers

[0105] Cy5-labeled nucleic acid aptamers from Example 6 were used, and a Cy5-labeled random sequence library (whose nucleotide sequence is obtained by randomly combining 60 bases of uniform length but random sequence during DNA synthesis without specifying the base type) was used as a control. Human Scaber cells (purchased from Shanghai Haixin Biotechnology Co., Ltd.) were then analyzed by flow cytometry. The specific steps were as follows: cells were collected (5 × 10⁻⁶ cells / year). 5 Cells (1 cell / tube) were washed twice with washing buffer and then incubated with Cy5-labeled aptamers (250 nM) in binding buffer at 4 °C for 30 min. After incubation, the cells were washed three times with washing buffer and the samples were analyzed using the BD FACSVerse™ system.

[0106] The results are as follows Figure 11 As shown, the nucleic acid aptamer BCTA-8 can specifically target the human bladder cancer cell line Scaber.

[0107] Example 8: Identification of Target Proteins

[0108] Tumor tissue-associated target proteins were identified using liquid chromatography-tandem mass spectrometry (LC-MS). Five proteins were selected, and the affinity differences between them and nucleic acid aptamers were determined using the SPR detection method. The binding and dissociation kinetics of the nucleic acid aptamers and target proteins were evaluated to determine the target proteins. Details are as follows:

[0109] (1) Extraction and identification of tumor tissue proteins: Weigh an appropriate amount of tumor tissue retained during the bladder cancer surgery described above, wash the tumor tissue twice with pre-cooled DPBS, add cell lysis buffer and homogenize the tissue, centrifuge at 12000 rpm / min for 20 min, and retain the supernatant, which is the extracted tumor tissue protein. Take 100 μL of SA magnetic beads, wash 5 times with DPBS, remove the supernatant, add nucleic acid aptamers and / or Lib1-76nt (5' end modified with biotin) to the magnetic beads, mix well, incubate on a shaker at room temperature for 30 min, remove the supernatant, and wash 5 times with DPBS; add 100 μL of 1% BSA protein, incubate for 30 min, remove the supernatant, and wash 5 times with DPBS; add the tumor tissue protein extracted in the above steps, incubate at room temperature for 1 h, remove the supernatant, and wash 5 times with DPBS; after elution with elution buffer, perform mass spectrometry analysis by LC-MS. As shown in Table 1, the protein identification results, categorized for bladder tumor-related proteins, yielded a list of proteins with varying degrees of relevance to bladder tumors. Mass spectrometry analysis indicated that BCTA-8 can specifically bind to certain proteins in tumor tissue.

[0110] Table 1. Summary of potential target protein results (correlation with bladder tumor: 3>2>1)

[0111]

[0112]

[0113] (2) Target protein coupling: Using a CM5 chip, the sensor surface was activated by injecting a mixture of 0.1 M N-hydroxysuccinimide (NHS) and 0.4 M 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) for 15 min. The target proteins ACTBL2, CAPRIN1, FXR1, SULT1E1, and UAP1L1 were then diluted to 50 μg / mL with 10 mM sodium acetate at pH 4.0, coupled at a flow rate of 10 μL / min, with a target coupling density of 1000 RU, and immobilized on the CM5 chip surface. Finally, the surface was blocked with 1 M ethanolamine (pH 8.5).

[0114] (3) Test conditions for nucleic acid aptamers: When binding to ACTBL2, CAPRIN1, FXR1 and UAP1L1 proteins, the nucleic acid aptamers were diluted to a concentration of 2000 nM with DPBS buffer, and then diluted down by 2-fold for a total of 10 concentration gradients, increasing by 0. The concentration gradients were 3.90625 nM, 7.8125 nM, 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM and 2000 nM. The flow rate was set to 30 μL / min, the binding time was 120 s and the dissociation time was 180 s. When binding to SULT1E1 protein, the aptamer was diluted to a concentration of 4000 nM with DPBS buffer, and then down-diluted for a total of 10 concentration gradients, increasing by 0. The concentration gradients were 7.8125 nM, 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 2000 nM, and 4000 nM, respectively. The flow rate was 30 μL / min, the binding time was 120 s, and the dissociation time was 180 s.

[0115] (4) Determination of kinetic parameters: The experiment adopted a multi-cycle operation, with the analysis time as the abscissa and the response value as the ordinate. The obtained data were fitted using BIAcore T200 analysis software. The fitting model used was the 1:1 Langmuir binding model, and the binding rate constant, dissociation rate constant, and binding-dissociation constant, etc., were determined.

[0116] like Figure 12 , Figure 13 and Figure 14 As shown, the nucleic acid aptamer BCTA-8 does not specifically bind to the proteins ACTBL2, SULT1E1, and UAP1L1. Figure 15 and Figure 16 As shown (where Fitted BCTA-8 is the curve fitted to the SPR affinity assay for BCTA-8), the nucleic acid aptamer BCTA-8 binds highly to FXR1 protein with a significant concentration gradient trend, indicating specific binding, with a KD value of 3.66 nM; it also binds highly to CAPRIN1 protein with a slow dissociation rate and a significant concentration gradient trend, indicating specific binding, with a KD value of 5.85 nM. This demonstrates that BCTA-8 has high affinity for both FXR1 and CAPRIN1 proteins.

[0117] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A nucleic acid aptamer for bladder cancer, characterized in that, The nucleic acid aptamer is BCTA-8, and its nucleotide sequence is shown in SEQ ID NO:

6.

2. A bladder cancer nucleic acid aptamer derivative, characterized in that, The nucleic acid aptamer derivative is obtained by modifying the nucleic acid aptamer described in claim 1; The modification includes marker marking.

3. The bladder cancer nucleic acid aptamer derivative as described in claim 2, characterized in that, The markers include at least one of isotope markers, fluorescent markers, biotin markers, enzyme markers, and chemiluminescent markers.

4. The bladder cancer nucleic acid aptamer derivative as described in claim 2, characterized in that, The nucleic acid aptamer derivative is a derivative of the nucleic acid aptamer obtained by labeling the 5' end of the nucleic acid aptamer of claim 1 with an anthocyanin dye group.

5. The bladder cancer nucleic acid aptamer derivative as described in claim 2, characterized in that, The nucleic acid aptamer derivative is a derivative of the nucleic acid aptamer obtained by labeling the 5' end of the nucleic acid aptamer described in claim 1 with biotin-vitamin H.

6. A reagent for detecting target proteins in bladder cancer tissue samples, characterized in that, Includes the nucleic acid aptamer as described in claim 1 and / or the bladder cancer nucleic acid aptamer derivative as described in any one of claims 2-5.

7. The use of a nucleic acid aptamer as described in claim 1, a bladder cancer nucleic acid aptamer derivative as described in any one of claims 2-5, or a reagent as described in claim 6 in the preparation of products for detecting or purifying target proteins.

8. The application as described in claim 7, characterized in that, The product includes at least one of a reagent kit, a biosensor, and a detection chip.

Images