The application of a nucleic acid aptamer for recognizing grouper iridovirus and the nucleic acid aptamer
By using SELEX technology to screen for 50bp nucleic acid aptamers and combining them with fluorescent markers, the problems of cumbersome and time-consuming existing detection methods have been solved, enabling rapid and accurate detection of grouper iridovirus, reducing costs and improving detection efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUANGXI ACAD OF SCI
- Filing Date
- 2023-07-03
- Publication Date
- 2026-07-03
AI Technical Summary
Existing methods for detecting grouper iridovirus are cumbersome, time-consuming, and costly, failing to meet the need for rapid and accurate on-site testing.
Nucleic acid aptamers with a length of 50 bp were screened using the exponential enrichment ligand systemic evolution technique (SELEX). These aptamers, combined with fluorescent markers, were used to specifically identify grouper iridoviruses and were rapidly detected using fluorescent molecular probes.
It enables simple, fast, and accurate detection of iridovirus in grouper, reducing costs and improving detection efficiency and sensitivity.
Smart Images
Figure CN116879549B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, and in particular, relates to the application of a nucleic acid aptamer in recognizing grouper iridovirus and the nucleic acid aptamer. Background Technology
[0002] Singapore grouper iridovirus (SGIV) is highly pathogenic, easily infecting grouper and other marine fish in southern China and Southeast Asia. It causes spleen hemorrhage and swelling, with a mortality rate exceeding 90% within a week of infection. Grouper, a major and valuable farmed marine fish in my country and Southeast Asia, has a higher protein content than most fish. Besides containing essential amino acids, it also contains inorganic salts, iron, calcium, phosphorus, and vitamins, making it a highly valuable fish and a popular seafood delicacy. However, with the expansion of grouper farming and the resulting pollution of the aquatic environment, the incidence of viral diseases is rising, hindering the sustainable development of the grouper farming industry.
[0003] Therefore, researching and developing rapid and accurate detection technologies for SGIV virus, and subsequently implementing effective prevention and control measures, is extremely important for controlling large-scale outbreaks of SGIV virus. Currently, diagnostic methods for SGIV include histopathological observation and molecular biological detection methods. While these methods are accurate and reliable, they suffer from drawbacks such as cumbersome operation, long processing times, and expensive instruments and reagents, failing to meet the requirements for rapid and accurate on-site detection and diagnosis. Therefore, efforts should be focused on developing rapid detection technologies and functional products for grouper iridovirus that are easy to operate, low-cost, quick to process, and highly accurate, suitable for on-site use in aquaculture. This is crucial for early detection and identification of the pathogen, enabling targeted treatment plans to control pathogen spread and reduce losses.
[0004] Nucleic acid aptamers are single-stranded oligonucleotides with high specificity for recognizing targets, obtained through multiple rounds of rigorous in vitro screening using System Evolution of Ligandsby Exponential Enrichment (SELEX) technology. Nucleic acid aptamers possess numerous advantages, including structural stability, ease of chemical synthesis and modification, a wide range of targets, and low cost. Based on their biological characteristic of highly specific recognition of pathogenic microorganisms or diseased cells, nucleic acid aptamers are now widely used in the development of detection technologies and the construction of biosensors, enabling precise detection and diagnosis of pathogens or diseases. Therefore, utilizing the characteristics of nucleic acid aptamers to develop precise detection methods for grouper iridovirus has broad application prospects. Summary of the Invention
[0005] To improve the detection level of grouper iridovirus, the present invention aims to provide an application of nucleic acid aptamer for recognizing grouper iridovirus and the nucleic acid aptamer itself.
[0006] According to one aspect of the present invention, an application of a nucleic acid aptamer for recognizing grouper iridovirus is provided, the application of which is not included in the application of disease diagnosis, and the nucleic acid aptamer is a nucleotide sequence of 50 bp in length, specifically as shown in the sequence listing SEQ ID: 1.
[0007] Preferably, at least one of the following is attached to both ends of the nucleic acid aptamer: a fluorescent group, biotin, an enzyme-labeled substance, a radioactive substance, or a therapeutic substance, to obtain a functionalized nucleic acid aptamer derivative that also recognizes grouper iridovirus.
[0008] Preferably, the product is a fluorescent molecular probe, wherein the nucleic acid aptamer is attached with a luminescent marker.
[0009] According to a second aspect of the present invention, a nucleic acid aptamer is provided, which is a nucleotide sequence of 50 bp in length, as shown in the sequence listing SEQ ID: 1.
[0010] Preferably, the secondary structure of the nucleotide sequence is as follows:
[0011]
[0012] Preferably, the nucleic acid aptamers are prepared through one or more steps including library reverse screening, library forward screening, single-stranded library preparation, real-time PCR monitoring of the enrichment level of each round of screening libraries, multiple rounds of screening, and high-throughput sequencing.
[0013] Preferably, the upstream primers used for screening nucleic acid aptamers in the library are as shown in SEQ ID: 2 of the sequence listing, and the downstream primers are as shown in SEQ ID: 3 of the sequence listing.
[0014] Preferably, the method for preparing the nucleic acid aptamer includes the following steps: Step one, providing a first ssDNA library and a pair of PCR primers, the first ssDNA library containing the following single-stranded DNA sequence: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, the PCR primers including an upstream primer and a downstream primer, the upstream primer including the DNA sequence shown in SEQ ID: 2, and the downstream primer including the DNA sequence shown in SEQ ID: 2. ID: 3 shows the DNA sequence; Step 2: Co-incubate the random ssDNA library with grouper iridovirus cells to screen and obtain a second ssDNA library that specifically recognizes grouper iridovirus; Step 3: Use the second ssDNA library as a template to perform PCR amplification using PCR primers to obtain a dsDNA library; Step 4: Incubate the dsDNA library with streptavidin-labeled magnetic beads, separate the magnetic beads after incubation, and then purify and separate the third ssDNA library that specifically recognizes grouper iridovirus bound to the magnetic beads to obtain nucleic acid aptamers for detecting grouper iridovirus. In the single-stranded DNA sequence of the first ssDNA library, the two ends are fixed sequences, and the "50N" in the middle indicates a random sequence of 50 nucleotides in length.
[0015] Preferably, in step three, PCR amplification is performed according to the following procedure: 92℃ for 5 minutes, 92℃ for 1 minute, 60℃ for 30 seconds, 72℃ for 1 minute, for 25 cycles; 72℃ for 5 minutes.
[0016] Preferably, the nucleotide sequence is modified by means including amination, phosphorylation, thiolation, methylation, or isotopization to obtain a derivative having the same function as the nucleic acid aptamer.
[0017] Preferably, a functional group is attached to one or more positions on the nucleotide sequence, and the functional group is selected from one or more of biotinylate markers, luminescent markers, and enzyme markers.
[0018] This invention utilizes SELEX technology to screen and obtain the nucleotide sequence SEQ ID: 1. The nucleic acid aptamer corresponding to SEQ ID: 1 can bind to grouper iridovirus through van der Waals forces and electrostatic interactions between charged groups. Therefore, the nucleic acid aptamer provided by this invention exhibits high affinity and specificity for grouper iridovirus. Compared with existing protein antibodies, the nucleic acid aptamer provided by this invention has advantages such as high affinity, low cost, stable performance, ease of chemical synthesis, and ease of labeling. Therefore, when using the nucleic acid aptamer provided by this invention to detect grouper iridovirus, the operation is not only simple and rapid, but also achieves high accuracy and sensitivity. Attached Figure Description
[0019] Figure 1 It is a predicted secondary structure diagram of the nucleic acid aptamer as shown in SEQ ID: 1;
[0020] Figure 2 This refers to the binding strength of the hydroxyfluorescein (FAM) labeled nucleic acid aptamers, as shown in SEQ ID: 1, with GS cells infected with different viruses in Test Example 1.
[0021] Figure 3 This refers to the binding strength between the hydroxyfluorescein (FAM) labeled nucleic acid aptamer as shown in SEQ ID: 1 and cells isolated from the liver, spleen and kidney tissues of grouper in Test Example 2. Detailed Implementation
[0022] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.
[0023] Example 1
[0024] 1. Screening and preparation of nucleic acid aptamers for detecting grouper iridovirus.
[0025] S1. Construction of the first ssDNA library and synthesis of primers
[0026] The first ssDNA library, Library 50, was designed and synthesized. Its nucleotide sequence is as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, where the two ends are fixed sequences and the middle 50 nucleotides are random sequences.
[0027] The upstream primer includes the nucleotide sequence shown in SEQ ID: 2 and is labeled with hydroxyfluorescein (FAM), with the specific sequence being: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.
[0028] The downstream primer includes the nucleotide sequence shown in SEQ ID: 3 and is labeled with biotin, specifically 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.
[0029] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0030] S2. SELEX screening yielded aptamers that specifically recognize grouper iridovirus (positive screening).
[0031] S2.1 Dissolve 10 nmol of the first ssDNA library in 500 μL PBS, incubate at 92°C for 5 min, then quickly insert into ice and incubate for 10 min. Incubate the treated first ssDNA library with grouper iridovirus cells on ice for 1 h.
[0032] After S2.2 incubation and binding, the supernatant was removed by centrifugation. The grouper iridovirus cells were washed with 10 mL of PBS, incubated at 92°C for 10 min, and the supernatant was collected by centrifugation at 12000g. This is the second ssDNA library of the grouper iridovirus cells.
[0033] S3. PCR amplification
[0034] Take 100 μL of the second ssDNA library obtained from screening and perform PCR amplification with upstream and downstream primers. The PCR reaction system is as follows (1000 μL): 10×Buffer 100 μL, dNTP Mix (2.5 mM) 80 μL, upstream primer 40 μL, downstream primer 40 μL, second ssDNA library 100 μL, rTaq enzyme 12.5 μL, ddH2O 627.5 μL. Perform PCR amplification according to the following program: 92℃ for 5 minutes, 92℃ for 1 minute, 60℃ for 30 seconds, 72℃ for 1 minute, for 25 cycles; 72℃ for 5 minutes. The supernatant obtained after the first round of screening should be used entirely for subsequent PCR amplification to obtain the amplified dsDNA library.
[0035] S4. Preparation of the third ssDNA library
[0036] 100 μL of streptavidin-labeled magnetic beads were incubated with a dsDNA library at room temperature for 20 min. The biotin on the dsDNA library binds to the magnetic bead surface via the affinity between biotin and streptavidin. The supernatant was removed by magnetic separation. The magnetic beads were washed twice with PBS buffer, and then 200 μL of NaOH solution (200 mM) was added to an EP tube. The tube was incubated at room temperature for 15 min to denature and dissolve the dsDNA library. One strand carrying biotin bound to streptavidin remained on the magnetic bead. This single-stranded DNA bound to the magnetic bead was used as the third ssDNA library. The magnetic beads were then separated, and the supernatant was collected. The forward ssDNA in the supernatant was purified and recovered using a PCR purification and recovery kit. The collected solution was used for the next round of screening.
[0037] S5. Repeated screening
[0038] Replace the first ssDNA library with the third ssDNA library obtained in S4, and repeat the positive screening process, PCR amplification, and single-stranded DNA library preparation process shown in S2–S4 12 times.
[0039] S6. Negative Screening
[0040] In the second and subsequent rounds of screening in S5, normal grouper spleen cell line (GS) was used as a control. The ssDNA libraries obtained after S5 screening underwent negative screening to improve screening efficiency. The specific negative screening process was as follows: the selected ssDNA libraries were dissolved, incubated in a 92°C water bath on ice for 1 hour with normal GS cells, and the supernatant was collected by centrifugation after incubation; this was the negatively screened ssDNA library.
[0041] S7.12 round screening
[0042] The supernatant containing the ssDNA library collected in step S6 was subjected to PCR amplification in step S3 and ssDNA library preparation in step S4. Steps S6, S2, S3, and S4 were repeated sequentially. Flow cytometry was used to detect changes in the recognition ability of the obtained ssDNA library for grouper iridovirus cells. This process was repeated 11 times until the ssDNA library obtained at this stage showed the strongest recognition ability for grouper iridovirus cells. After cloning and sequencing analysis of the amplified products, the aptamer for detecting grouper iridovirus cells in this embodiment was finally obtained, and its nucleotide sequence is as follows:
[0043] GAGAAGCGTTTGTTAGCCTCGTTCCCCCAAGGGACCCCTCTGTGCAGG CC (SEQ ID: 1).
[0044] The secondary structure of SEQ ID: 1 was predicted online using the MFOLD software (http: / / mfold.rna.albany.edu / ?q=mfold / DNA-Folding-Form). The prediction results are as follows: Figure 1 As shown, the aptamer with the nucleotide sequence SEQ ID: 1 forms a special stem-loop structure and hairpin structure.
[0045] Test Example 1
[0046] 1. Test Object
[0047] The nucleic acid aptamer constructed in Example 1 has the nucleotide sequence SEQ ID: 1. The control group 1 was formed by incubating GS cells infected with largemouth bass iridovirus (LMBV) with FAM-labeled SEQ ID: 1, the control group 2 was formed by incubating GS cells infected with Chinese soft-shelled turtle iridovirus (STIV) with FAM-labeled SEQ ID: 1, and the experimental group 1 was formed by incubating GS cells infected with grouper iridovirus (SGIV) with FAM-labeled SEQ ID: 1.
[0048] 2. Testing Methods
[0049] The binding efficacy and specificity of FAM-labeled nucleic acid aptamers to GS cells infected with different viruses were detected using a multifunctional microplate reader. The specific procedures included the following steps: FAM-labeled SEQ ID: 1 nucleic acid aptamer was dissolved in 500 μL PBS to prepare a 500 nmol / L solution. The solution was incubated at 92°C for 5 min, then immediately placed on ice for 10 min. The treated nucleic acid aptamer was then incubated on ice for 1 h with GS cells infected with LMBV, STIV, and SGIV viruses, respectively. After binding, the cells were centrifuged, washed three times, and resuspended in 400 μL PBS buffer to obtain a resuspended solution.
[0050] 3. Test Results and Analysis
[0051] The binding efficacy and specificity of nucleic acid aptamers to GS cells infected with different viruses were tested, as follows: Figure 2 As shown, the results confirm that, compared with control groups 1 and 2, the FAM-labeled nucleic acid aptamer shown in SEQ ID: 1 has higher affinity and specificity for GS cells infected with SGIV virus.
[0052] Test Example 2
[0053] 1. Test Object
[0054] The nucleic acid aptamer constructed in Example 1 has the nucleotide sequence SEQ ID: 1. The control group 3 was formed by incubating FAM-labeled SEQ ID: 1 with cells isolated from the liver, spleen and kidney tissues of normal grouper. The experimental group 2 was formed by incubating FAM-labeled SEQ ID: 1 with cells infected with SGIV virus isolated from the liver, spleen and kidney tissues of diseased grouper.
[0055] 2. Testing Methods
[0056] The binding of FAM-labeled nucleic acid aptamers to cells isolated from the liver, spleen, and kidney tissues of grouper was detected using a multifunctional microplate reader. The specific procedures included the following steps: The FAM-labeled nucleic acid aptamer (SEQ ID: 1) was dissolved in 500 μL of PBS to prepare a 500 nmol / L solution. The solution was incubated at 92°C for 5 min, then immediately placed on ice for 10 min. The treated nucleic acid aptamer was then incubated with the cells on ice for 1 h. After binding, the cells were centrifuged, washed three times, and resuspended in 400 μL of PBS buffer to obtain a resuspended solution.
[0057] 3. Test Results and Analysis
[0058] The results of the test on the binding of nucleic acid aptamers to cells isolated from the liver, spleen, and kidney tissues of grouper are as follows: Figure 3 As shown in the figure. The results confirmed that, compared with the control group, the FAM-labeled nucleic acid aptamer shown in SEQ ID: 1 had higher affinity and specificity for cells infected with SGIV virus.
[0059] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. The application of a nucleic acid aptamer in the preparation of a reagent for recognizing grouper iridovirus, characterized in that, The nucleic acid aptamer is a nucleotide sequence of 50 bp in length, as shown in the sequence listing SEQ ID:
1.
2. The application as described in claim 1, characterized in that, The nucleic acid aptamer is attached to both ends with at least one of the following: a fluorescent group, biotin, an enzyme-labeled substance, a radioactive substance, or a therapeutic substance, to obtain a functionalized nucleic acid aptamer derivative that also recognizes grouper iridovirus.
3. The application as described in claim 2, characterized in that, The application is a fluorescent molecular probe, and the nucleic acid aptamer is attached with a luminescent label.
4. A nucleic acid aptamer for recognizing grouper iridovirus, characterized in that, The nucleic acid aptamer sequence is a nucleotide sequence of 50 bp in length, as shown in the sequence listing SEQ ID:
1.
5. The nucleic acid aptamer as described in claim 4, characterized in that, Its secondary structure is as follows:
6. The nucleic acid aptamer as described in claim 4, characterized in that, The nucleic acid aptamers are prepared through one or more steps, including library reverse screening, library forward screening, single-stranded library preparation, quantitative real-time PCR monitoring of the enrichment level of each round of screening libraries, multiple rounds of screening, and high-throughput sequencing.
7. The nucleic acid aptamer as described in claim 6, characterized in that, The upstream primers used for the nucleic acid aptamers in library screening are shown in SEQ ID: 2, and the downstream primers are shown in SEQ ID:
3.
8. The nucleic acid aptamer according to any one of claims 4 to 7, characterized in that, The nucleotide sequence has a functional group attached to one or more positions, and the functional group is selected from one or more of biotinylate markers, luminescent markers, and enzyme markers.