Peanut bacterial wilt resistant gene AhNHL24 as well as identification method and application thereof

Abstract

The invention provides a peanut bacterial wilt resistant gene AhNHL24 as well as an identification method and application thereof, and belongs to the technical field of plant genetic engineering. The peanut disease resistance related gene AhNHL24 is separated from peanuts, the DNA sequence of the peanut disease resistance related gene AhNHL24 is shown as SEQ ID NO: 1, and the amino acid sequence of protein coded by the gene AhNHL24 is shown as SEQ ID NO: 2. According to the preparation method of the peanut disease-resistant gene, the AhNHL24 gene is separated and identified through Illumina RNA sequence and comparative transcriptome analysis, and transcription mode analysis and plant expression analysis find that the AhNHL24 gene can improve the resistance of plants to ralstonia solanacearum, so that the invention determines that the peanut AhNHL24 gene can be used as an important gene for peanut bacterial wilt resistance breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a peanut bacterial wilt resistance gene AhNHL24, its identification method, and its application. Background Technology

[0002] Peanuts (Arachis hypogaea L.), also known as long-lived peanuts or groundnuts, are annual herbaceous plants and an important economic and oilseed crop worldwide. They are a significant source of edible vegetable oil and protein for developing countries, playing a crucial role in edible vegetable oil consumption and the snack food industry. Henan Province is China's largest peanut-producing region, accounting for approximately one-quarter of the country's peanut planting area and about 30% of its total output. Peanut cultivation faces numerous challenges, including inefficient farming methods and insufficient variety. These factors collectively contribute to the continuous outbreaks of plant diseases such as peanut bacterial wilt, whose severity increases year by year, seriously affecting peanut quality and yield, and thus hindering the sustainable development of the peanut industry. Peanut bacterial wilt, caused by Ralstonia solanacearum, was first discovered in Indonesia and introduced to my country around 1930, causing large-scale outbreaks in the southern provinces. It is reported that the affected area of ​​peanut bacterial wilt in China is approximately 30,000 hectares. South China is the main endemic area for this disease, with an incidence rate generally between 10-20%, especially severe in the seedling stage, where it can cause yield losses exceeding 70% in extreme cases. Ralstonia solanacearum exhibits extremely strong environmental adaptability and survival ability, making fundamental control difficult through traditional breeding methods alone. Therefore, we need to use molecular breeding techniques to deeply explore the key functional genes for peanut resistance to bacterial wilt, providing germplasm resources for cultivating high-yielding and disease-resistant new varieties. Throughout its long evolutionary history, plants have gradually developed various mechanisms to resist pathogen infection, including the plant's intrinsic immune defense system. When a plant is infected by a pathogen, its immune system activates various signaling molecules, including salicylic acid (SA), jasmonic acid (JA), ethylene (ET), and abscisic acid (ABA). These signaling substances participate in regulating the plant's defense response, responding to external infection by activating the expression of disease resistance-related genes. This mechanism enables plants to develop broad-spectrum resistance, thereby effectively resisting the invasion of various pathogenic microorganisms.

[0003] Studies have shown that the Nonrace-specific disease resistance gene 1 / Harpin-induced gene 1 (NDR1 / HIN1)-like (NHL) gene family is involved in pathogen-induced plant responses to biotic stress. These proteins are widely distributed in the plant kingdom and play a crucial role in resisting biotic and abiotic stresses. Research indicates that NHL genes play an important role in plant-pathogen interactions and abiotic stress resistance. For example, in Arabidopsis thaliana, various Pseudomonas strains significantly induced the expression of AtNHL3, and overexpression of AtNHL3 enhanced plant resistance to Pseudomonas tomato DC3000. The high susceptibility of the CsNHL10 gene to cucumber mosaic virus infection is regulated by the SA signaling pathway. Similarly, overexpression of StPOTHR1 enhanced potato resistance to late blight. In pepper, transient overexpression of CaNHL4 enhanced plant resistance, while plants with silenced CaNHL4 showed a significantly increased susceptibility to various pathogens. However, there is currently no research on the role of peanut NHL family genes in resistance to bacterial wilt. Therefore, in-depth research on the peanut AhNHL24 gene is of great significance for revealing the molecular mechanism of peanut resistance to bacterial wilt.

[0004] Therefore, this invention is proposed to solve the above-mentioned technical problems. Summary of the Invention

[0005] The primary objective of this invention is to provide a peanut bacterial wilt resistance gene, AhNHL24.

[0006] The second objective of this invention is to provide a method and application for identifying the gene AhNHL24.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A peanut bacterial wilt resistance gene, AhNHL24, has a DNA sequence as shown in SEQ ID NO: 1.

[0009] Preferably, the amino acid sequence of the protein encoded by the gene AhNHL24 is shown in SEQ ID NO: 2.

[0010] Preferably, the expression vector of the peanut bacterial wilt resistance gene AhNHL24.

[0011] This invention further provides a method for identifying the peanut bacterial wilt resistance gene AhNHL24. The method isolates and identifies the AhNHL24 gene through Illumina RNA sequencing and comparative transcriptome analysis. Specifically, the steps are as follows:

[0012] (1) Plant peanuts and tobacco. Place healthy peanut seeds in a petri dish and soak them overnight in sterile water at room temperature and in the dark to conduct a germination test.

[0013] (2) Whole genome identification of peanut AhNHL gene family

[0014] Blast searches were performed on the peanut AhNHL gene on PeanutBase. The gene structure of the peanut AhNHL gene sequence was predicted using the HMMER 3.2.2 tool. The length of the gene protein sequence was determined using DNAstar software. Further analysis using the ExPASy online software confirmed the protein characteristics of AhNHL gene family members. Chromosomal location information of AhNHL gene family members was extracted from the peanut genome annotation file, and a chromosomal location map of the AhNHL gene was drawn using MG2C software. Motif analysis of the AhNHL protein was performed using the MEME website. Phylogenetic analysis and sequence alignment of the AhNHL gene were conducted using the deduced full-length aa sequence of the AhNHL protein and its homologs. Possible cis-acting elements were predicted using the online PlantCARE database and visualized using TBtools.

[0015] (3) Illumina RNA sequence and comparative transcriptome analysis

[0016] Using the RNA-seq database provided by the Cornell University Plant Technology Institute, the expression patterns of the AhNHL24 gene in two key developmental stages of peanut (days 1 and 7 post-inoculation) and in six different tissues were detected. Log2-transformed FPKM values ​​were used as the gene expression level indicator, and hierarchical cluster analysis and heatmap visualization were performed using Heml software.

[0017] (4) Inoculation with Ralstonia solanacearum

[0018] Prepare peanut H108(R) and peanut H107(S) seedlings and tobacco seedlings, culture Ralstonia solanacearum pathogen and prepare Ralstonia solanacearum inoculum, use the improved root injury method to inoculate peanut seedlings with Ralstonia solanacearum, and use the infiltration method to inoculate tobacco and peanut leaves with Ralstonia solanacearum.

[0019] (5) Root, stem and leaf tissues of H108(R) and H107(S) seedlings that were simulated inoculated and infected with Ralstonia solanacearum were collected by qRT-PCR. H108(R) and H107(S) seedlings at the 3-leaf stage were treated with salicylic acid (SA), methyl jasmonate (MeJA) and abscisic acid (ABA). Blank control and peanut seedlings inoculated with Ralstonia solanacearum were collected at 0.5, 1.0 and 7.0 days. Total RNA was extracted and reverse transcribed using PrimeScript. The first-strand cDNA was subjected to quantitative real-time PCR (qRT-PCR). Gene-specific primers were designed from the transcription sequence of AhNHL24 gene using primer BLAST software. Primers that amplified a single product (about 150~250bp) were selected for qRT-PCR. The expression profile of AhNHL24 gene was detected by qRT-PCR.

[0020] (6) Cloning and construction of recombinant vectors for AhNHLs

[0021] Using Premier 5.0 software, specific primers for homologous recombination were designed based on the full-length CDS of the AhNHL24 gene. The AhNHL24 gene fragment was amplified using Primer STARTM Max DNA polymerase with the aid of cDNA and specific primers. The PCR product was purified using a seamless cloning kit and then cloned into a linearized pCambia1300 YFP vector. The vector was transformed into viable E. coli DH5α cells. Single colonies of E. coli were picked and inoculated into 50 mL LB broth containing 50 ng / mL kanamycin. Plasmid DNA was extracted using the Plasmid Maxi Kit (Omega Bio-tek, Georgia, USA) for subsequent subcellular localization studies.

[0022] (7) Subcellular localization analysis

[0023] The recombinant vector and control vector were transformed into *Agrobacterium tumefaciens* EHA105 competent cells, respectively. *Agrobacterium* was cultured on LB solid medium containing the corresponding antibiotics. Single colonies were picked and inoculated into LB liquid medium containing 50 ng / mL kanamycin and cultured at 28°C for 18 hours. After culturing at 37°C with shaking at 200 rpm for 12-16 hours, the cells were collected by centrifugation at 3000×g for 10 minutes. 50 mL of the bacterial culture was inoculated into 50 mL of freshly prepared infection medium (containing 10 mM MgCl2, 5 mM MES, 5 μM acetylsalicylic acid, and 50 ng / mL kanamycin). Before infection, the medium was incubated at 28°C for 2-3 hours. Infection was performed on tobacco plants with fully expanded leaves. Subcellular localization analysis was performed by observing protein fusion fluorescence using an LSM710 confocal laser scanning microscope.

[0024] (8) Transient overexpression of the AhNHL gene in tobacco and peanut leaves

[0025] The recombinant vector and the empty vector pCambia1300-YFP were transfected into Agrobacterium tumefaciens strain EHA105, respectively. Agrobacterium tumefaciens was cultured and used for leaf infiltration. Leaf disc infiltration was used to infiltrate tobacco and peanut leaves to achieve transient overexpression of the AhNHL gene in tobacco and peanut leaves.

[0026] (9) Trypan blue staining

[0027] Immerse the leaves in trypan blue staining solution and stain in a boiling water bath. Place the stained leaves in chloral hydrate solution (1.25 g / mL), place at 25°C and shake at 50 rpm to decolorize. Change the solution every 3 hours until the leaves are completely decolorized.

[0028] (10) Phenotypic analysis of enhanced resistance to Ralstonia solanacearum and Sclerotium truncatum in transgenic AhNHL24 tobacco plants

[0029] (11) Potential regulatory pathways of AhNHL24-mediated peanut resistance to Ralstonia solanacearum and Sclerotium sclerotiorum.

[0030] The expression levels of defense-related genes in tobacco leaves under Ralstonia solanacearum and Sclerotium truncatum infection were detected by qRT-PCR. Roots of tobacco plants under simulated inoculation and Ralstonia solanacearum infection were collected at 5.0 days. Total RNA was extracted and reverse transcribed using PrimeScript. The resulting first-strand cDNA was then subjected to quantitative real-time PCR (qRT-PCR). Specific primers were designed using primer BLAST software, and primers that amplified a single product (approximately 100–300 bp) were selected for qRT-PCR. The expression profiles of defense-related genes in tobacco leaves were detected by qRT-PCR.

[0031] This invention further provides an application of the peanut bacterial wilt resistance gene AhNHL24, which improves the plant's resistance to bacterial wilt fungus by overexpressing the peanut bacterial wilt resistance gene AhNHL24.

[0032] Preferably, the plant is peanut or tobacco.

[0033] Preferably, the bacterial wilt fungus is Ralstonia solanaceae.

[0034] The beneficial effects of this invention are:

[0035] The AhNHL24 gene (SEQ ID NO:1) was successfully isolated from peanut and its disease resistance function was confirmed, filling a gap in research on the resistance of the peanut NHL family to bacterial wilt. This invention screened and identified 45 AhNHL genes, and overexpression of the protein fusion AhNHL24-YFP in tobacco and peanut leaves increased resistance to Ralstonia solanacearum. After inoculation, the lesion area significantly decreased, demonstrating a rapid increase in disease resistance. Furthermore, the lesion area in the overexpression region was significantly smaller than that in the control region after inoculation with Ralstonia solanacearum. This provides rapid and intuitive evidence for the preliminary verification of gene function.

[0036] This invention identifies the AhNHL24 gene as an important gene for breeding peanut resistance to bacterial wilt. This invention provides valuable gene resources for molecular breeding of broad-spectrum disease resistance in peanuts, and therefore has significant theoretical and practical implications. Attached Figure Description

[0037] Figure 1 To obtain the expression analysis diagram of peanut AhNHL24 gene by qRT-PCR, (A) shows the expression analysis of peanut AhNHL24 gene against Ralstonia solanacearum infection at 0.5, 1.0 and 7.0 days, and (B) shows the expression analysis of peanut defensin gene under SA (3 mmol / L), MeJA (100 mmol / L) and ABA (10 μg / mL) treatments. The Y-axis represents the relative expression level. Different letters (ae) between different treatment groups indicate statistically significant differences based on the Tukey-Kramer test at the p < 0.05 level. Data are expressed as the mean of three biological replicates, and the error bar represents the standard deviation (SD).

[0038] Figure 2 The diagram shows the transient overexpression and functional analysis of the AhNHL24 gene during the resistance to Ralstonia solanacearum. (A) is a subcellular localization diagram of AhNHL24 in tobacco leaves. (B) is a diagram of the symptoms of tobacco leaves with transient overexpression of AhNHL24-YFP and YFP after inoculation with Ralstonia solanacearum. (C) is a diagram of the symptoms of peanut leaves with transient overexpression of YFP and AhNHL24-YFP after inoculation with Ralstonia solanacearum and a trypan blue staining diagram.

[0039] Figure 3The diagram shows the comprehensive characterization of the enhanced resistance of transgenic AhNHL24 tobacco to Ralstonia solanacearum and Sclerotium truncatum. (A) is a DNA level detection diagram, (B) is a phenotype of tobacco plants after 12 days of Ralstonia solanacearum stress, (C) is a phenotype of OE-AhNHL24#17 tobacco plants after 12 days of Ralstonia solanacearum inoculation, (D) is a comparison of the disease progression of wild-type and OE-AhNHL24#17 tobacco plants after Ralstonia solanacearum infection, (E) is a phenotype of OE-AhNHL24#17 tobacco plants after 12 days of Sclerotium truncatum inoculation, and (F) is a comparison of the disease progression of wild-type and OE-AhNHL24#17 tobacco plants after Sclerotium truncatum infection.

[0040] Figure 4 To infer the disease resistance pathway of the AhNHL24 gene by analyzing the expression of defense-related genes in tobacco using qRT-PCR, (A) shows the expression of defense-related genes in tobacco leaves detected by qRT-PCR, and (B) shows the inferred regulatory pathway of AhNHL24-mediated resistance to Ralstonia solanacearum and Sclerotium truncatum infection in peanuts. The vertical axis represents the relative expression level. Data are presented as the mean of three biological replicates. Error bars represent standard deviation (SD). Different letters (ae) between different treatment groups indicate statistically significant differences at the p < 0.05 level based on the Tukey-Kramer test. Detailed Implementation

[0041] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] The cultivars “H108(R)”, a peanut variety highly resistant to bacterial wilt, and “H107(S)”, a peanut variety highly susceptible to bacterial wilt, used in the experiments of this invention were cultivated by Professor Yin Dongmei of Henan Agricultural University; the highly pathogenic bacterial wilt fungus used was donated by the peanut disease research group of the Institute of Plant Protection, Henan Academy of Agricultural Sciences.

[0043] The DNA sequence of the AhNHL24 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the AhNHL24 gene is shown in SEQ ID NO: 2.

[0044] SEQ ID NO: 1:

[0045] ATGGCGGATAATCAAAGAATTCACCCGGATATTGAGGCTTCACCTAGACCGTCGGCGCCGTTAGTCCCCGGAAACATTGCGAAATCCGAGAACGGCGATCCGAATAATAGCCCTCTACCACCACCACTTCCTCAAAGAACCTTGCCAGTGATGCATTCAAAGCCACCAAGGAGAAGAAGAAGCTGTTGCTG TAGATTCTATGTTGCACATTCACAACACTCCTGATTCTCATCATTGCCATAGCAATCACTGCTGGAATCTTGTTCCTAGCATTCAGGCCAAAGATTCCAAAGTACTCAGTTGACAAACTCAGAATCACAGAGTTCAATTTCTCTAGTGGCACTAACATTCTCTCTGTCACTTCCAATGTTAGAATCACTG CTAGAAATCCAAACAAGAAAATTGGGATCTATTATGAAGGTGGGAGCCACATAAGTGCATGGTATAGTGGTTCTCAACTTTGTGAAGGGTCTATGATAAAATTCTATCAAGGTCATAAGAATACTACTGTTCTTGATTTGCCACTCAGAGGCCAAATTCAAGATGCAAGTGGATTAGTTAGCAAGATTCAGCAGCAGATTCAAGATACCAATAATATCCCTCTAGATATTAAGGTCAAACAGCCAGTTAGGGTTAAATTTGGAAAATTGAAGCTTTTTAAGGTCAATTTCAGGGTTAGGTGCAAGCTTGGTGGATAGCCTTAGTGCTAACAATGATATTAAGATTTCAAGCAGCAGCTGTAAGTTCAGGTTTAGACTATGA

[0046] SEQ ID NO: 2:

[0047] MAD NQR IHP DIE ASP RPS APL VPG NIA KSE NGD PNN SPL PPP LPQ RTL PVMHSK PPR RRR SCC CRF LCC TFT TLL ILI IAI AIT AGI LFL AFR PKI PKY SVD KLR ITEFNF SSG TNI LSV TSN VRI TAR NPN KKI GIY YEG GSH ISA WYS GSQ LCE GSM IKF YQGHKN TTV LDL PLR GQI QDA SGL VSK IQQ QIQ DTN NIP LDI KVK QPV RVK FGK LKL FKVNFR VRC KLV VDS LSA NND IKI SSS SCK FRF RL

[0048] Example 1

[0049] 1. Planting peanuts and tobacco

[0050] Healthy peanut seeds were placed in petri dishes and soaked overnight in sterile water under room temperature and darkness for germination tests. Germinated peanut seeds were then transplanted into 10×10×10cm plastic pots, with 4 seedlings per pot, in a well-ventilated greenhouse at Henan Agricultural University. Peanut seedlings were cultivated using a vermiculite and potting soil (v:v=2:1; pH6.0) as the substrate, under greenhouse conditions of 28℃ for 16 hours of light and 26℃ for 8 hours of darkness. Hoagland solution was applied every three days to maintain growth. Tobacco (Nicotiana benthamiana) was used as the experimental subject and grown under specific conditions in a plant growth chamber at 24℃, with a 16-hour light cycle (15000 lx), followed by 8 hours of darkness and a humidity level of approximately 60%.

[0051] 2. Genome identification of the peanut AhNHL gene family

[0052] Peanut protein datasets were obtained from the peanut database (http: / / peanutbase.org / ). Additionally, the Hidden Markov Model (HMM) matrix file (PF01436) associated with conserved domains of peanut NHL genes was obtained from the PFAM database (http: / / pfam.xfam.org / ). Candidate NHL genes for peanuts were screened using HMMER software. The coding sequence (CDS) and predicted amino acid (AA) sequences of NHL genes in peanut (A. hypogaea) were retrieved from the peanut database. To confirm NHL gene family members, conserved domains present in each candidate amino acid sequence were identified using the online software SMART (http: / / Smart.embl-Heidelberg.de / ) and CDD (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / ).

[0053] The physicochemical properties of peanut NHL family genes, such as molecular weight, amino acid number, and isoelectric point, were predicted using the online software ProtParam (http: / / web.expasy.org / protparam / ). Subcellular localization and domain motifs of AhNHL proteins were predicted using WoLF POSRT (https: / / www.genscript.com / psort.html), MEME (https: / / meme-suite.org / meme / index.html), and TBtools (v1.098684), respectively. The chromosomal locations of peanut NHL family genes obtained from PeanutBase were mapped to corresponding chromosomes using the MG2C software platform (http: / / mg2c.iask.in / mg2c_v2.0 / ). Collinearity analysis of NHL family genes in peanut and other plant species (such as rice, maize, Arabidopsis, and soybean) was performed using MCScanx software.

[0054] The GSDS tool enables gene structure analysis by comparing CDS sequences with genomic sequences. TBtools (v1.046) is used to visualize the structure of the NHL gene family. The MEME server is used to identify conserved motifs. Sequence alignment and phylogenetic analysis are performed based on the full-length amino acid sequence of the peanut NHL gene. The protein structure of AhNHLs is predicted using the SWISS-MODEL server (https: / / swissmodel.expasy.org). Phylogenetic trees are constructed using MEGA 7.0 software, combining the AA sequences of NHL genes from peanut and other plant species (including soybean, pepper, rice, Arabidopsis, and grape). The phylogenetic trees are constructed using a bootstrap neighbor-joining method with bootstrap values ​​determined by 1000 random replicates. For promoter sequence analysis, the sequence of the upstream 2000 base pairs of the peanut NHL gene is extracted, and cis-acting elements are analyzed using the online PlantCARE software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ).

[0055] 3. Illumina RNA sequence and comparative transcriptome analysis

[0056] To investigate the molecular mechanisms of peanut tolerance to biotic stress (R. solanacearum infection) and abiotic stress (Cd stress), we further examined the expression level of the peanut NHL gene in bacterial wilt using our published RNA-seq data. [The text then abruptly shifts to a seemingly unrelated topic:] ...to Cd tolerance... 2+ Peanut seedlings' effect on Cd 2+ The stress response was analyzed using RNA-seq and comparative transcriptomics. Furthermore, the tissue-specific expression pattern of the peanut NHL gene was investigated using transcriptomics data available in the peanut basic database. The raw RNA sequence data of the NHL gene in peanut leaves, shoot tips, roots, root nodules and seeds, cadmium-treated roots, and roots inoculated with *Ralstonia solanacearum* were normalized using the Log2 (TPM+1) normalization method. Visualization results were generated using R-4.0.2 software, and the normalized results were visualized using TBtools.

[0057] 4. Inoculation with Ralstonia solanacearum

[0058] Ralstonia solanacearum was streaked onto triphenyltetrazolium chloride (TTC) agar containing 10.0 g / L peptone, 1 g / L casein hydrate, 5.0 g / L D-glucose, and 15.0 g / L agar. Single colonies were picked with sterile toothpicks and inoculated into TTC liquid medium, then incubated for 2 days in a shaker at 200 rpm / min at 28°C. The resuspended bacteria were adjusted to OD using a Nanodrop 2000c spectrophotometer. 600 It is around 0.5, and its concentration is about 10. 8 CFU / mL.

[0059] The root-damage method previously studied was used to inoculate peanut seedlings with Ralstonia solanacearum, with slight modifications. When the peanuts had three true leaves, the taproot tip was cut off, and the seedlings were inoculated with a Ralstonia solanacearum solution at a concentration of 10⁸ CFU / mL. The seedlings were then placed in an incubator at 28℃, 60% humidity, and a 16-hour light / 8-hour light cycle. The Ralstonia solanacearum inoculation was performed using the osmosis method. For each leaf, 100 μL of different bacterial concentrations (10⁸ CFU / mL) was inoculated using a needleless syringe. 8 10 7 and 10 6 The inoculum was prepared in CFU / mL, while TTC liquid medium was used as a control.

[0060] 5. qRT-PCR

[0061] Peanut gene expression in response to Ralstonia solanacearum infection and plant hormone induction was determined by qRT-PCR. Roots, stems, and leaves of simulated inoculation (using TTC liquid medium) and Ralstonia solanacearum-infected H108 and H107 seedlings were collected at 0.5, 1.0, and 7.0 days. Three-week-old H108 and H107 seedlings were treated with salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA). Optimal concentrations of plant hormones were determined based on their use in other plants. Peanut seedlings were sprayed with 3 mmol / L SA, 100 mmol / L MeJA, and 10 μg / mL ABA, with double-distilled water as a control. Leaves of treated peanut seedlings were collected at 0.5, 1.0, and 7.0 days. Each sample was collected independently in triplicate, frozen in liquid nitrogen, and immediately placed at -80°C.

[0062] After total RNA extraction, reverse transcription was performed according to the instructions of the Prime Script RT kit and gDNA Eraser (Takara, China). Subsequently, the resulting cDNA was analyzed by qRT-PCR according to the previously described protocol. Gene-specific primers were designed using Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) based on the transcribed sequences of AhNHL and defense-related genes. To correct for the total cDNA amount in each reaction, the AhACTIN7 gene (XM_025826875) was used as an internal control. Only primers amplifying a single product of approximately 150-250 bp were selected for qRT-PCR. The qRT-PCR reaction system consisted of 1.0 μL of first-strand cDNA (10-fold dilution), 1.0 μL of forward and reverse primers (10.0 μM), 10.0 μL of Takara 2×SYBR Green I Master Mix, and 7.0 μL of ddH2O, with a final reaction volume of 20 μL. All reactions were performed in 96-well plates using a Bio-Rad CFX-96 real-time PCR system (Bio-Rad, Canada), with three replicates per reaction. Polymerase chain reaction (PCR) amplification conditions included an initial denaturation step at 95°C for 3 minutes, followed by 40 cycles, each consisting of denaturation at 95°C for 10 seconds, annealing at 54°C for 30 seconds, and extension at 65°C for 5 seconds. Finally, a final extension step was performed at 68°C for 5 minutes. Target gene expression levels were quantified using the previously described comparative quantification method (2...). −ΔΔCT The results were evaluated. Analysis revealed that the AhNHL24 gene was significantly induced by Ralstonia solanacearum treatment, and the response trend of AhNHL24 in H108 was significantly higher than that in H107. Furthermore, H108 and H107 were treated with three hormones at four different time points (0, 0.5, 1, and 7 dpi). qRT-PCR analysis showed that the AhNHL24 gene was also significantly induced in both H107 and H108.

[0063] The primer sequences required in this study are shown in Table 1 below.

[0064] Table 1

[0065]

[0066] 6. Cloning and construction of recombinant vectors for AhNHL24

[0067] Primers with homologous arms were designed using Primer Premier 5.0 software based on the complete CDS of AhNHL24. PCR amplification was performed using Primer STAR Max DNA polymerase (Takara, Dalian, China) with H108 cDNA as a template. The PCR reaction system and conditions were as follows: 1 μL each of forward and reverse primers, 25 μL of erythromycin, 2 μL of template cDNA, 21 μL of ddH2O, and a total reaction volume of 50 μL. The PCR reaction was performed according to the following program: 94℃ for 2 min; 32 cycles of 94℃ for 30 s, 56℃ for 30 s, and 72℃ for 2 min; 72℃ for 7 min, and then isothermal at 4℃. The PCR product was detected by 1% agarose gel electrophoresis. After confirming the detection was correct, the PCR product was recovered from the gel using a DNA recovery kit to obtain the target gene.

[0068] The pCambia1300-YFP plant expression vector was then double-digested with Kpn I and Sca I restriction endonucleases to produce sticky ends, resulting in a linearized pCambia1300-YFP vector. The full-length target gene was then ligated to the corresponding position in the linearized pCambia1300-YFP vector to obtain the pCambia1300-AhNHL24-YFP recombinant plasmid. Next, the recombinant vector pCambia1300-AhNHL24-YFP was transformed into DH5α *E. coli* competent cells (Tiangen, Beijing, China). Single *E. coli* colonies were selected and inoculated into 50 mL LB broth containing 50 ng / mL kanamycin. After culturing at 37°C for 12–16 hours, bacterial cells were collected by centrifugation at 3000 × g for 10 minutes. Plasmid DNA was extracted using the Plasmid Maxi Kit (OmegaBio-tek, Georgia, USA) for subsequent subcellular localization studies.

[0069] 7. Subcellular localization analysis

[0070] The recombinant and control vectors were transformed into *Agrobacterium tumefaciens* EHA105 competent cells, and then cultured on LB solid medium containing the corresponding antibiotics. Single colonies were picked and inoculated into 1 mL of LB liquid medium containing 50 ng / mL kanamycin and cultured at 28°C for 18 hours. After incubation at 37°C with shaking at 200 rpm for 12-16 hours, the cells were collected by centrifugation at 3000×g for 10 minutes. 50 mL of the bacterial culture was inoculated into 50 mL of freshly prepared infection medium (containing 10 mM MgCl2, 5 mM MMEs, 5 μM acetylsalicylic acid, and 50 ng / mL kanamycin) and incubated at 28°C for 2-3 hours before infection. The empty plant overexpression vector pCambia1300-YFP was used as a negative control to infect tobacco plants with fully expanded leaves, followed by dark incubation for 12 hours. Protein fusion fluorescence was observed using an LSM710 confocal laser scanning microscope, and 3-5 images were randomly acquired. Laser confocal microscopy revealed that the fluorescence signal in the empty control group carrying YFP was widely distributed in the cell membrane and nucleus, which is consistent with the free diffusion characteristics of YFP. The AhNHL24 gene, however, was significantly enriched on the cell membrane, and a weak signal was also detected in the nucleus.

[0071] 8. Transient overexpression of the AhNHL24 gene in tobacco and peanut leaves

[0072] The peanut disease resistance gene AhNHL24 was transiently overexpressed in tobacco and peanut leaves using an Agrobacterium-mediated method. In short, the recombinant vector and the empty vector pCambia1300-YFP were transfected into Agrobacterium strain EHA105. The successfully ligated Agrobacterium was grown on YEP plates (with added kanamycin and rifampin antibiotics) for 16–18 hours. Single colonies were then inoculated into 1 mL of YEP liquid medium (50 ng / mL kanamycin) and further grown at 28°C for 18 hours. After culturing the bacterial cells at 37°C with shaking at 200 rpm for 12–16 hours, the Ralstonia solanacearum cells were collected by centrifugation at 3000 × g for 10 minutes. The Agrobacterium concentration was increased to OD200. 600 When the OD value is 0.5–0.7, centrifuge at 2500 × g for 5 minutes and collect the bacterial cells. Resuspend the Agrobacterium in liquid medium containing 100 mmol / L MgCl2, 200 mmol / L MES, and 100 μmol / L AS, and adjust the OD value to 0.5–0.7. 600 =0.7~1.0 range.

[0073] Healthy tobacco leaves were injected using a syringe without a needle. The injected tobacco leaves were then cultured in the dark at 28°C for 12 hours, followed by 28°C under light for 2 days. Observations showed that AhNHL24-overexpressing plants exhibited a superior disease resistance phenotype, with significantly smaller lesion areas compared to the control group. To further verify this result, we also established a transient expression system in peanut leaves. Transient transformation was performed by injecting peanut leaves with Agrobacterium. After inoculation with the same pathogen, we observed that in the control group, peanut leaves curled and turned yellow, and this curling and yellowing became more pronounced with increasing duration of Ralstonia solanacearum infection. In contrast, the disease severity in AhNHL24-overexpressing plants was significantly reduced, with fewer lesions compared to the control.

[0074] 9. Trypan blue staining

[0075] Leaves inoculated with the overexpressing gene were immersed in trypan blue staining solution and then cooled to room temperature after immersion in a boiling water bath for 2 minutes. Subsequently, the stained leaves were immersed in chloral hydrate solution (1.25 g / mL) at 25°C with shaking at 50 rpm / min. To ensure complete desaturation, the solution was changed every 3 hours until the leaves were completely decolorized. Before photographing, the leaves were soaked in 75% ethanol for 20 minutes. Trypan blue staining showed that, compared with the unexpressed control, overexpression of AhNHL24-YFP in peanut leaves reduced cell death.

[0076] 10. Phenotypic analysis of enhanced resistance to Ralstonia solanacearum and Sclerotinia sclerotiorum in transgenic AhNHL24 tobacco plants

[0077] The recombinant and control vectors were transformed into *Agrobacterium tumefaciens* EHA105 competent cells, respectively. Subsequently, the *Agrobacterium* were inoculated onto LB solid medium containing the corresponding antibiotics. Single colonies were picked and inoculated into 1 mL of LB liquid medium containing 50 ng / mL kanamycin and incubated at 28°C for 18 hours. After incubation at 37°C with shaking at 200 rpm for 12-16 hours, the cells were collected by centrifugation at 3000×g for 10 minutes. 50 mL of the bacterial culture was transferred to 50 mL of freshly prepared infection medium (containing 10 mM MgCl2, 5 mM MES, 5 μM acetylsalicylic acid, and 50 ng / mL kanamycin) and incubated at 28°C for 2-3 hours before infection. Tobacco plants with fully expanded leaves were selected for inoculation and then incubated in the dark for 48 hours.

[0078] Using NbActin as an internal reference gene, the expression level of the target gene in wild-type (WT) and three overexpressing AhNHL24 transgenic lines (OE-AhNHL24#11, OE-AhNHL24#15, and OE-AhNHL24#17) was detected by qRT-PCR. The results showed that, compared with WT, all three overexpressing lines exhibited distinct specific bands, indicating successful overexpression of the AhNHL24 gene in transgenic tobacco.

[0079] Twelve days after inoculation with Ralstonia solanacearum, phenotypic changes in WT and overexpression lines were observed. Results showed that WT plants exhibited severe wilting symptoms, while the overexpression lines showed significantly reduced symptoms, indicating that AhNHL24 gene overexpression enhanced plant resistance to Ralstonia solanacearum. Further comparison of local phenotypes between the OE-AhNHL24#17 line and WT plants revealed that the overexpression line showed better overall growth and significantly lower leaf wilting compared to WT, further validating the disease-resistance function of this gene. The dynamic change curve of disease incidence showed that, compared to WT, the OE-AhNHL24#17 line exhibited significantly lower disease incidence at all time points, with a slower upward trend over time, quantitatively demonstrating that AhNHL24 overexpression can significantly reduce the incidence of Ralstonia solanacearum.

[0080] Similarly, after inoculation with *S. rolfsii*, the control group (uninoculated plants) grew normally, while the WT plants in the experimental group showed obvious disease symptoms. The symptoms of the overexpressing line OE-AhNHL24#17 were significantly reduced, indicating that AhNHL24 overexpression also confers resistance to this pathogen. Disease incidence curve analysis showed that the incidence rate of the OE-AhNHL24#17 line was lower than that of WT at all time points, and the increase over time was smaller, quantitatively verifying that AhNHL24 overexpression reduces the susceptibility of plants to *S. rolfsii*. These results indicate that the AhNHL24 gene is involved in enhancing plant resistance to *Ralstonia solanacearum* and *S. rolfsii*.

[0081] 11. Potential regulatory pathways of AhNHL24-mediated resistance of peanuts to Ralstonia solanacearum and Sclerotium sclerotiorum.

[0082] The expression levels of defense-related genes in tobacco leaves under Ralstonia solanacearum and Sclerotium truncatum infection were detected by qRT-PCR. Roots of tobacco plants under simulated inoculation (using double-distilled water) and Ralstonia solanacearum infection were collected at 5.0 days. Each sample was collected independently with three biological replicates, and was immediately placed at -80°C after being frozen in liquid nitrogen.

[0083] After total RNA extraction, reverse transcription was performed according to the instructions of the Prime Script RT kit and gDNA Eraser (Takara, China). Gene-specific primers were designed using Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). NbActin7 was used as an internal control gene to normalize the total cDNA amount in each reaction. Only primers capable of amplifying a single product (approximately 100–300 bp) were selected for qRT-PCR. The total reaction volume was 20 μL, including 2.0 μL of 5-fold diluted cDNA, 0.8 μL of forward and reverse primers (10.0 μmol / L), 10.0 μL of 2×SYBR Green I Master Mix (Takara), and 6.4 μL of sterile distilled water. A Bio-Rad CFX-96 real-time PCR system (Bio-Rad, Canada) was used with three technical replicates. PCR reaction conditions: 95℃ for 3 minutes, 95℃ for 15 seconds, 58℃ for 30 seconds, and 72℃ for 30 seconds, for 40 cycles, followed by 68℃ for 5 minutes. Candidate gene expression was quantified using relative quantification (23). −ΔΔCT The results were quantified using a specific method. Analysis of the results revealed that after AhNHL24 overexpression, the expression levels of genes related to glutathione metabolism and phenylpropane biosynthesis pathways were significantly upregulated under both Ralstonia solanacearum and Sclerotium sclerotiorum infection conditions. Therefore, we infer that the AhNHL24 gene may enhance peanut plant resistance to bacterial (Ralstonia solanacearum) and fungal (Sclerotium sclerotiorum) pathogens by regulating these two important metabolic pathways—glutathione metabolism and phenylpropane biosynthesis.

[0084] Experimental results are as follows Figures 1-4 As shown in the above, it can be seen that the AhNHL24 gene plays a crucial role in peanut resistance to Ralstonia solanacearum. Overexpression of this gene significantly promotes peanut resistance to Ralstonia solanacearum, making it an ideal gene for enhancing plant disease resistance. Genetic transformation can be used to express this gene in tobacco, enabling it to acquire resistance to multiple pathogens, thereby improving crop disease resistance in the field.

[0085] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A peanut bacterial wilt resistance gene, AhNHL24, characterized in that, The DNA sequence of the gene AhNHL24 is shown in SEQ ID NO:

1.

2. The peanut bacterial wilt resistance gene AhNHL24 according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the gene AhNHL24 is shown in SEQ ID NO:

2.

3. The recombinant expression vector of the peanut bacterial wilt resistance gene AhNHL24 according to claim 1.

4. A method for identifying the peanut bacterial wilt resistance gene AhNHL24, characterized in that, The method described above isolated and identified the AhNHL24 gene through Illumina RNA sequence and comparative transcriptome analysis.

5. The application of the peanut bacterial wilt resistance gene AhNHL24, characterized in that, Overexpression of the peanut disease resistance gene AhNHL24 enhances plant resistance to Ralstonia solanacearum.

6. The application of the peanut bacterial wilt resistance gene AhNHL24 according to claim 5, characterized in that, The plants mentioned are peanuts and tobacco.

7. The application of the peanut bacterial wilt resistance gene AhNHL24 according to claim 5, characterized in that, The bacterial wilt bacteria mentioned are Ralstonia solanaceae.

Images