Construction method and application of recombinant escherichia coli engineering bacteria with high yield of ergothioneine

Abstract

The invention relates to the technical field of bioengineering, and discloses a construction method and application of recombinant Escherichia coli engineering bacteria with high yield of ergothioneine, and the method comprises the following steps: by taking Escherichia coli as a chassis, integrating a mycobacterium smegmatis egtABCDE gene cluster at an ldhA site; a repressor protein gene metJ and a cysteine lyase gene yhaM are knocked out, a methionine adenosine transferase gene metK and a serine acetyltransferase gene cysE are overexpressed by using a strong promoter, and mutant metA, thrA, serA and hisG genes for relieving feedback inhibition are introduced, so that metabolic inhibition of methionine, cysteine and histidine pathways is systematically relieved; the invention also establishes a matched fermentation process. According to the invention, endogenous precursor supply and exogenous synthesis pathways are synergistically enhanced, the precursor supply bottleneck is solved, the yield of ergothioneine is increased, and the method is suitable for industrial production.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a method and application for constructing a high-yield recombinant Escherichia coli engineered bacterium of ergothionein. Background Technology

[0002] Ergothioneine (EGT) is a natural histidine derivative with unique antioxidant, anti-inflammatory, and cell-protective functions, showing great potential for application in cosmetics, food additives, and biomedicine. Compared to the complex processes and poor stereoselectivity of chemical synthesis methods, the synthesis of ergothioneine using microbial metabolic engineering technology has become a current research hotspot due to its green and efficient characteristics. Heterologous reconstruction of the ergothioneine synthetic pathway in model organisms such as *Escherichia coli* is one of the mainstream production strategies.

[0003] However, existing technologies for producing ergothioneine using recombinant Escherichia coli still face several bottlenecks, limiting their industrial application. First, the introduction of exogenous synthetic pathways often increases the metabolic burden on chassis cells, and the stability of exogenous gene expression is difficult to guarantee. The central metabolic network of chassis cells typically prioritizes survival and rapid growth, leading to a significant flow of carbon sources to the synthesis of byproducts such as lactic acid. This not only wastes carbon sources but also results in acidic byproducts that inhibit cell growth, leading to insufficient supply of precursors and energy for the synthesis of the target product.

[0004] Secondly, ergothioneine biosynthesis is an energy-intensive process requiring multiple precursors, and its efficiency depends on the intracellular supply levels of L-histidine, L-cysteine, and the methyl donor S-adenosylmethionine (SAM). In wild-type *E. coli*, the biosynthetic pathways of these key precursors are strictly regulated endogenously. On the one hand, key synthases are inhibited at the transcriptional level by repressor proteins; on the other hand, rate-limiting enzymes in the pathway are susceptible to strong feedback inhibition by the end products at the protein level, leading to synthesis cessation once the intracellular product concentration increases. Furthermore, intracellular degradation pathways targeting these amino acids exist, resulting in the continuous depletion of the precursor pool. This defensive metabolic regulatory network constitutes a rate-limiting bottleneck, ensuring that the intracellular precursor concentration is far below the saturation substrate concentration of the heterologous synthase system, thereby limiting the rate of ergothioneine synthesis.

[0005] Finally, at the fermentation process level, existing fermentation strategies struggle to balance the conflict between cell growth and heterologous protein expression. Relying solely on the engineered bacteria's own metabolic precursors can easily lead to metabolic imbalances under high-density fermentation conditions, resulting in slow product accumulation. Simultaneously, when ergothioneine synthase systems derived from species such as Mycobacteria are heterologously expressed in E. coli, inactive inclusion bodies can easily form if fermentation conditions are not properly controlled, leading to low catalytic efficiency. Therefore, how to synergistically address the metabolic diversion of chassis cells, a rigorous feedback regulation mechanism, and the expression adaptability of heterologous enzyme systems are urgent technical challenges that need to be solved in constructing efficient ergothioneine cell factories. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a method for constructing and applying a high-yield recombinant Escherichia coli engineered strain of ergothioneine, which solves the problems of diverting central metabolic carbon flux to byproducts, insufficient supply due to strict endogenous feedback regulation of key precursor synthesis pathways, and low yield due to poor compatibility between heterologous synthesis pathways and host metabolism in ergothioneine production by existing engineered strains.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solution: a method for constructing and applying a high-yield recombinant Escherichia coli engineered strain of ergothionein.

[0008] In a first aspect, the present invention provides a method for constructing a recombinant Escherichia coli engineered strain that produces high levels of ergothioneine, comprising the following steps: Step 1: Using E. coli as chassis cells, ergothioneine synthesis gene clusters are integrated into the chassis cell genome using gene editing technology. egtABCDE To obtain intermediate strains; Step 2: Enhance the methionine synthesis pathway of the intermediate strain. This includes: knocking out the transcriptional repressor protein gene in the genome using homologous recombination. metJ ;Methionine adenosine transferase gene in the genome metK Homoserine O-succinyltransferase gene metA and aspartate kinase / homoserine dehydrogenase gene thrA The natural promoter is replaced with a strongly constitutive promoter; wherein, the metA The gene is a mutated gene that has been freed from feedback inhibition. thrA The gene is a mutant gene that has been freed from feedback inhibition; Step 3: Enhance the cysteine ​​and histidine synthesis pathways of the intermediate strain, including the following steps: Adding the D-3-phosphoglycerate dehydrogenase gene to the genome. serA Serine acetyltransferase gene cysE and ATP phosphoribosyltransferase gene hisGThe natural promoter was replaced with a strong constitutive promoter; the cysteine ​​lyase gene was simultaneously knocked out. yhaM ; wherein, the serA The gene is a mutated gene that has been freed from feedback inhibition. hisG The gene is a mutated gene that has been freed from feedback inhibition; after completing steps one, two and three, recombinant engineered Escherichia coli is obtained.

[0009] By adopting the above technical solution, this invention can effectively solve the problems of insufficient supply of ergothioneine synthesis precursors by endogenous metabolic flux in Escherichia coli and low efficiency of exogenous synthesis pathways. Its specific mechanism of action and beneficial effects are described below: Constructing a core metabolic pathway for heterologous synthesis: through integration egtABCDE The gene cluster reconstructed the complete ergothioneine biosynthesis pathway in Escherichia coli. The enzyme system encoded by this gene cluster can efficiently catalyze the synthesis of ergothioneine using L-histidine, L-cysteine, and S-adenosylmethionine (SAM) in chassis cells as precursors.

[0010] Relieving metabolic inhibition of the methionine and SAM synthesis pathways: Ergothioneine synthesis requires a large amount of the methyl donor SAM, which is derived from methionine. This invention enhances this pathway through the following multi-level regulatory strategy: Relieve transcriptional repression: Knockout metJ The MetJ protein is a major transcriptional repressor in the methionine biosynthesis pathway; knocking out this gene relieves its influence on met regulators (including...). metA , metB , metC , Put , metF Transcriptional repression of genes such as methionine leads to upregulation of the expression levels of enzymes related to the methionine synthesis pathway.

[0011] Overcoming feedback inhibition of enzyme activity levels: homoserine O-succinyltransferase (a key enzyme in the methionine synthesis pathway) metA Gene encoding) and aspartate kinase / homoserine dehydrogenase (by thrA Enzymes are typically subject to strong feedback inhibition by end products such as methionine, SAM, or threonine. This invention alters the spatial conformation of the enzyme protein by introducing specific point mutations (i.e., using mutant genes that relieve feedback inhibition), making it insensitive to allosteric effectors. This allows it to maintain high catalytic activity even in environments with high intracellular product concentrations, ensuring a continuous flow of carbon flux to methionine.

[0012] This invention alters the spatial conformation of enzyme proteins by introducing specific point mutations. Specifically, by introducing the MetA T242A mutation, ThrA S345F mutation, SerA N364A mutation, and HisG R250H mutation, allosteric regulatory sites on the enzyme molecule are disrupted, making it insensitive to allosteric effectors (such as methionine, threonine, serine, and histidine). This allows it to maintain high catalytic activity even in environments with high intracellular product concentrations, ensuring a continuous flow of carbon flux to methionine and other precursor synthesis pathways.

[0013] Enhancing SAM Synthesis: Ergothioneine biosynthesis involves three consecutive methylation reactions, requiring three molecules of S-adenosylmethionine (SAM) to synthesize one molecule of ergothioneine, placing enormous pressure on the intracellular methyl donor pool. This invention addresses this by overexpressing a strong promoter... metK The gene increases the intracellular abundance of methionine adenosine transferase, enabling it to act as a methyl pump, accelerating the conversion rate of L-methionine to SAM, preventing synthetic stagnation caused by methyl donor depletion, thereby boosting upstream metabolic flux and providing continuous and sufficient power for the efficient synthesis of ergothioneine.

[0014] Remodeling the cysteine ​​synthesis and metabolism network: Enhancing synthetic throughput: Cysteine ​​is not only a structural component of ergothioneine but also a sulfur atom donor. This can be achieved through overexpression of mutant strains. serA The gene (encoding D-3-phosphoglycerate dehydrogenase) relieves the feedback inhibition of this enzyme by serine, increasing the supply of precursor serine; in conjunction with cysE Overexpression of the gene (encoding serine acetyltransferase) accelerates the conversion of serine to O-acetylserine, thereby driving the biosynthesis of cysteine.

[0015] Blocking the degradation pathway: Knockout yhaM Gene. yhaM The encoded cysteine ​​lyase can degrade cysteine ​​into pyruvate, ammonia, and hydrogen sulfide. Knocking out this gene effectively blocked the inefficient consumption of cysteine, increased the accumulation level of intracellular cysteine, and diverted more of it to the ergothioneine synthesis pathway.

[0016] Strengthening the histidine synthesis pathway: Histidine is the starting backbone for ergothioneine synthesis. HisG (ATP phosphoribosyltransferase) is the rate-limiting enzyme in the first step of the histidine biosynthesis pathway, and natural HisG is strongly inhibited by histidine feedback. This invention introduces a mutant... hisG The gene, in conjunction with a strong promoter, expresses itself, thereby relieving the product inhibition effect and increasing the metabolic flux of the histidine biosynthesis pathway.

[0017] In summary, this invention, through systematic metabolic engineering, achieves a synergistic effect of enhanced precursor supply and product synthesis, thereby improving the ability of recombinant Escherichia coli to produce ergothioneine.

[0018] Preferably, in step one, the gene editing technology uses the CRISPR / Cas9 system; the ergothionein synthesis gene cluster egtABCDE lactate dehydrogenase gene integrated into the chassis cell genome ldhA Sites, and the integration process causes ldhA Gene inactivation.

[0019] By adopting the above technical solution, select ldhA As an integration site, it has a dual advantage: on the one hand... ldhA The loci are relatively stable in the genome, which is conducive to the high-level expression of exogenous gene clusters; on the other hand... ldhA Gene inactivation blocks the metabolic pathway of pyruvate to lactate conversion, reducing carbon source waste and lactate byproduct accumulation, guiding more carbon flux into the tricarboxylic acid cycle or precursor amino acid synthesis pathway, and further promoting cell growth and ergothionein synthesis.

[0020] Preferably, in step two, the strong constitutive promoter is an artificially synthesized strong promoter sequence; the knockout operation is achieved by introducing donor DNA containing upstream and downstream homologous arms that are homologous to the gene sequence to be knocked out and by targeted cutting to achieve the deletion of the coding region of the genome.

[0021] By employing the above-mentioned technical solutions, artificially synthesized strong promoters can overcome the limitations of the original complex regulatory network of chassis cells, achieving continuous and efficient expression of key enzymes. Homologous recombination-mediated gene knockout can precisely remove the coding region of the target gene, avoiding the introduction of exogenous resistance markers or the generation of polar effects, thus ensuring the genetic stability of the engineered bacteria.

[0022] Preferably, in step three, the enhancement of the cysteine ​​synthesis pathway and the enhancement of the histidine synthesis pathway are carried out simultaneously or in steps; the strong constitutive promoter is used to increase the expression levels of the D-3-phosphoglycerate dehydrogenase, the serine acetyltransferase, and the ATP phosphoribosyltransferase.

[0023] By adopting the above technical solutions, the redirection process of metabolic flux is made more controllable through synchronous or stepwise enhancement. By increasing the expression level of key enzymes, the intracellular concentrations of the two key precursors, cysteine ​​and histidine, are ensured to meet the needs of high-yield ergothionein production, achieving a balance in the supply of multiple precursors and avoiding the limitation of overall synthesis efficiency caused by the shortage of a single precursor.

[0024] Preferably, the gene nucleotide sequence involved is as follows: yhaMThe nucleotide sequence of the gene is shown in SEQ ID NO:1; cysE The nucleotide sequence of the gene is shown in SEQ ID NO:2; serA The gene is a sequence encoding the N364A mutant, and its nucleotide sequence is shown in SEQ ID NO:3; metJ The nucleotide sequence of the gene is shown in SEQ ID NO:4; thrA The gene is a sequence encoding the S345F mutant, and its nucleotide sequence is shown in SEQ ID NO:5; metA The gene is a sequence encoding the T242A mutant, and its nucleotide sequence is shown in SEQ ID NO:6; hisG The gene is a sequence encoding the R250H mutant, and its nucleotide sequence is shown in SEQ ID NO:7; metK The nucleotide sequence of the gene is shown in SEQ ID NO:8; ldhA The nucleotide sequence of the gene is shown in SEQ ID NO:9.

[0025] By adopting the above technical solution, the feedback inhibition of key metabolic nodes can be relieved by directly replacing wild-type genes with mutant genes (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) with specific sequences. This is the core technical means to achieve high yield. At the same time, the knockout target (SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:9) and the overexpression target (SEQ ID NO:2, SEQ ID NO:8) are clearly identified, ensuring the accuracy and reproducibility of metabolic modification.

[0026] Secondly, the present invention provides the application of recombinant Escherichia coli engineered bacteria obtained according to the construction method described in the first aspect in the preparation of ergothionein, wherein the application is achieved by fermenting the recombinant Escherichia coli engineered bacteria, the fermentation culture comprising the following steps: S1. The recombinant Escherichia coli engineered bacteria are inoculated into a seed culture medium for activation culture to prepare seed solution; S2. The seed liquid is inoculated into a fermenter containing fermentation tank culture medium for fermentation culture; S3. Feed culture medium is added during the fermentation process, and the fermentation broth is collected after fermentation to extract ergothioneine; The fermentation culture temperature is controlled at 28-32℃, and exogenous precursor substances are added to both the fermentation tank culture medium and the feed culture medium. The exogenous precursor substances include L-histidine, L-cysteine ​​and L-methionine.

[0027] By adopting the above technical solution, this invention establishes a fermentation process highly adapted to the metabolic characteristics of engineered bacteria. Through the synergistic effect of endogenous enhancement and exogenous supplementation, the yield of ergothioneine is increased. Its specific mechanism of action and beneficial effects are described below: Synergistic driving force of exogenous precursors and endogenous metabolism: Although the endogenous amino acid synthesis pathway of engineered bacteria has been enhanced through genetic engineering, the cells still have a high demand for the three key precursors (histidine, cysteine, and methionine) for ergothioneine synthesis during high-density fermentation. Directly adding these three exogenous precursors to the fermenter medium and fed-batch medium can rapidly increase the intracellular substrate concentration, bringing the ergothioneine synthase system (EgtABCDE) to substrate saturation. This strategy reduces the metabolic burden of de novo amino acid synthesis in cells and maintains unimpeded metabolic flux by utilizing key intracellular enzymes that relieve feedback inhibition (mutant HisG, SerA, MetA, ThrA), ensuring that both exogenous intake and endogenously synthesized precursors are efficiently converted into the target product.

[0028] Low-temperature fermentation strategy optimizes enzyme activity and metabolic flux: Controlling the fermentation temperature at 28-32℃ (below the optimal growth temperature of E. coli, 37℃) has two regulatory effects: First, the low temperature environment is conducive to the correct folding and soluble expression of heterologous proteins (especially the Egt enzyme system of mycobacteria with large differences in origin), reducing the formation of inclusion bodies and thus improving catalytic efficiency; Second, appropriately lowering the temperature can reduce the basal metabolic rate of cells, reduce the accumulation of byproducts such as acetic acid, delay cell aging, and thus extend the effective cycle of product synthesis.

[0029] Feed-in synthesis sustains kinetics: By feeding a culture medium containing high concentrations of glucose and precursors, the carbon-to-nitrogen ratio and precursor supply rate during fermentation can be controlled. This not only avoids substrate inhibition caused by excessively high substrate concentrations but also solves the problem of product synthesis cessation due to nutrient depletion in the later stages of fermentation, achieving continuous production under high-density fermentation conditions.

[0030] Preferably, in step S2, the fermenter culture medium contains the following components at the following concentrations: glucose 15-25 g / L; yeast extract 6.0-8.0 g / L; ammonium sulfate 5.0-7.0 g / L; potassium dihydrogen phosphate 2.5-3.5 g / L; dipotassium hydrogen phosphate 10.0-14.0 g / L; magnesium sulfate heptahydrate 1.0-1.5 g / L; calcium chloride 0.05-0.15 g / L; ferrous sulfate heptahydrate 150-250 mg / L; L-histidine 0.8-1.2 g / L; L-cysteine ​​0.8-1.2 g / L; and L-methionine 1.2-1.8 g / L.

[0031] By adopting the above technical solution and controlling the initial glucose concentration at 15-25 g / L, overflow metabolism (Crabtree effect) caused by excessive glucose concentration in the early stage of fermentation can be avoided, acetic acid production can be reduced, and the cells can quickly adapt to the environment and enter the logarithmic growth phase. A specific phosphate buffer system (potassium dihydrogen phosphate to dipotassium hydrogen phosphate ratio) can effectively maintain the pH stability of the fermentation system. In addition, the addition of an appropriate amount of ferrous ions is crucial, because EgtB and EgtE in the ergothioneine synthesis pathway are both iron-dependent enzymes, and a sufficient supply of iron ions can ensure the catalytic activity of these key oxidases.

[0032] Preferably, in step S3, the fed culture medium contains the following components at the following concentrations: glucose 500-700 g / L; L-histidine 4.0-6.0 g / L; L-cysteine ​​4.0-6.0 g / L; L-methionine 4.0-6.0 g / L; the fermentation culture period is 60-90 hours, and during the fermentation process, the fed culture medium is added to maintain the carbon and nitrogen sources required for cell growth and product synthesis.

[0033] By adopting the above technical solution, the high-concentration fed-batch formulation can provide sufficient carbon skeleton and synthesis raw materials without significantly increasing the fermentation volume. During the 60-90 hour fermentation cycle, the continuous fed-batch strategy can maintain a high level of intracellular ATP supply (derived from glucose metabolism) and methyl donor regeneration capacity (derived from methionine), thereby supporting the efficient accumulation of ergothioneine.

[0034] Preferably, in step S1, the seed culture is prepared under the following conditions: shake culture at 36-38℃ and 180-240 rpm for 10-14 hours; in step S2, the inoculation amount of the seed culture is 3-5% (v / v); the seed culture medium is LB liquid medium containing tryptone, yeast extract and sodium chloride.

[0035] By adopting the above technical solution and employing a variable-temperature culture strategy: the seed culture preparation stage is conducted at 36-38℃ to promote rapid cell proliferation and obtain high-activity cell biomass; while the fermentation stage is cooled to 28-32℃ to focus on product synthesis. Using nitrogen-rich LB medium as the seed culture medium provides abundant amino acids and growth factors necessary for cell growth, shortens the lag phase, and rapidly obtains a high-quality seed culture with vigorous metabolic activity and high biomass, laying the foundation for subsequent high-density fermentation. An inoculum size of 3-5% ensures rapid fermentation start-up, shortens the production cycle, and reduces the risk of contamination.

[0036] This invention provides a method for constructing and applying a recombinant Escherichia coli engineered strain that produces high levels of ergothioneine. It offers the following beneficial effects: 1. This invention utilizes the chassis cell genome... ldhA Stable integration of the site originates from Mycobacterium smegma egtABCDE The gene cluster successfully constructed a non-natural ergothioneine biosynthesis pathway; simultaneously, the integration process resulted in... ldhA Gene inactivation blocks the competitive pathway for the conversion of pyruvate to lactate, reduces the ineffective consumption of carbon sources, and forces more central metabolic carbon flux to flow to the tricarboxylic acid cycle and amino acid synthesis precursors, thus providing a sufficient material basis and energy supply for the efficient synthesis of ergothioneine.

[0037] 2. This invention utilizes a systematic introduction of mutant genes that have relieved feedback inhibition. metA , thrA , serA , hisG ) and combined with strong promoter replacement and specific gene knockout ( metJ , yhaM This approach breaks down the naturally occurring strict metabolic regulatory network in the synthesis pathways of methionine, cysteine, and histidine. This multi-target modification strategy not only eliminates the feedback sensitivity of key enzymes to products but also blocks the ineffective degradation of precursors, increases the intracellular accumulation levels of S-adenosylmethionine, L-cysteine, and L-histidine, and meets the substrate supply required for the full-rate catalysis of exogenous EGT enzyme systems.

[0038] 3. This invention establishes a fermentation application strategy highly adapted to the metabolic characteristics of engineered bacteria. By adding exogenous precursors containing L-histidine, L-cysteine, and L-methionine during fermentation, and coordinating with low-temperature fermentation control, a synergistic effect of endogenous metabolic enhancement and exogenous substrate supply is achieved. This process alleviates the metabolic burden of amino acid synthesis in cells under high-density fermentation, promotes the soluble expression of heterologous enzyme systems, prolongs the product synthesis cycle, and ultimately increases ergothioneine yield. Detailed Implementation

[0039] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the preparation examples, comparative examples, and test examples. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] Preparation Examples 1-4: Preparation Example 1: High-yield engineered strain for total synthesis of ergothionein ( E.coli Construction of EGT-Full This preparation example aims to construct an engineered strain that integrates the bacterial ergothioneine synthesis pathway and comprehensively enhances the endogenous synthesis pathways of methionine (SAM cycle), cysteine, and histidine. The specific construction process is as follows: First, genomic integration of the ergothioneine synthesis gene cluster was performed using *E. coli*. E.coli MG1655 is a chassis strain, and the CRISPR / Cas9 gene editing system was used for manipulation. Primers were designed and amplified using the chassis strain genome as a template. ldhA Upstream and downstream homologous arms of the (lactate dehydrogenase) gene locus; simultaneously using artificially synthesized mycobacteria containing smegma ( Mycobacterium smegmatis (Source) egtABCDE Gene cluster fragments were used as templates for amplification. Fusion PCR was employed to amplify the upstream homologous arms... egtABCDE Gene cluster fragments and downstream homologous arms were ligated. The PCR reaction program was: 95℃ for 5 min; [95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s-45 s / kb] × 35 cycles; 72℃ for 10 min. Simultaneously, a targeted... ldhA The recombinant pTarget plasmid was transformed into competent cells containing pCas. After antibiotic selection, PCR verification, and stepwise plasmid elimination at 30℃ / 42℃, cells with integrated pTarget plasmid were obtained. egtABCDE The intermediate strain M0.

[0041] Secondly, the methionine (Met / SAM) synthesis pathway of the intermediate strain M0 was enhanced. On the one hand, a gene knockout process was used to construct a targeted... metJ pTarget plasmid containing the gene (encoding a transcriptional repressor protein), binding with metJ Donor DNA fused with upstream and downstream homologous arms to achieve metJ Knocking out the gene relieves its transcriptional repression of the methionine synthesis pathway. On the other hand, gene replacement procedures are used to separately remove genes from the genome... MetK ( (encoding SAM synthase) metA (Encoding homoserine O-succinyltransferase) and thrA The original promoter region of the gene encoding aspartate kinase / homoserine dehydrogenase was replaced with a synthetically produced strong constitutive promoter, thereby enhancing the metabolic flux to the SAM cycle. After completing the above operations, intermediate strain M1 was obtained.

[0042] Finally, the cysteine ​​(Cys) and histidine (His) synthesis pathways of the intermediate strain M1 were enhanced. Using a gene substitution process, the cysteine ​​(Cys) and histidine (His) synthesis pathways were sequentially enhanced. serA (Encoding D-3-phosphoglycerate dehydrogenase) cysE (Encoding serine acetyltransferase) and yhaMThe promoter of the gene encoding O-acetylserine (thiol) lyase was replaced with a strong constitutive promoter to increase the supply of cysteine ​​precursors; at the same time, hisG The promoter of the gene encoding ATP phosphoribosyltransferase was replaced with a strong constitutive promoter to increase the supply of histidine substrate. After completing all gene modification steps, the strain was cultured overnight at 42°C to completely eliminate the pCas plasmid, finally obtaining the engineered strain, named E.coli EGT-Full.

[0043] Preparation Example 2: Control strain containing only the egt gene cluster ( E.coli EGT-Basic construction This preparation example constructs a control strain that introduces only an exogenous synthetic pathway but does not modify the chassis metabolic network. Compared to Preparation Example 1, the construction process only involves the first stage of the operation, i.e., in... E.coli MG1655 ldhA Site integration egtABCDE Gene cluster. No further targeting will be performed. metJ , metK , metA , thrA (Methionine pathway), and serA , cysE , yhaM , hisG Knockout or promoter replacement of the cysteine ​​and histidine pathways were performed. After integration, the plasmid was directly eliminated, and a control strain was obtained, named […]. E.coli EGT-Basic.

[0044] Preparation Example 3: Control strain lacking Met cycle enhancement ( E.coli Construction of EGT-NoMet This preparation example constructs a control strain with enhanced Cys and His pathways but without enhanced SAM cycle to verify the importance of the methylation pathway. The construction process differs from Preparation Example 1 in that the modification step targeting the methionine pathway is skipped. That is, this strain completes... egtABCDE After gene cluster integration, direct targeting serA , cysE , yhaM and hisG The promoter substitution operation of the gene, while retaining the wild type. metJ , metK , metA and thrA The genes were not modified. The final control strain was named... E.coli EGT-NoMet.

[0045] Preparation Example 4: Engineered strains containing fungal synthetic pathways ( E.coliConstruction of EGT-Fungal This preparation example constructs an engineered strain that produces ergothionein using a fungal dual-enzyme pathway. The construction process differs from Preparation Example 1 only in the integration of the target gene in the first stage. In this preparation example, artificially synthesized ergothionein derived from *Schizosaccharomyces cerevisiae* is used. egt1 and egt2 Gene tandem expression cassettes were used as donor DNA to replace the DNA in Preparation Example 1. egtABCDE Gene clusters integrated into the chassis strain ldhA Site. Subsequent enhancement procedures targeting the chassis cell precursor metabolic pathway (Met / Cys / His) were identical to those in Preparation Example 1. The resulting engineered strain was named... E.coli EGT-Fungal.

[0046] Examples 1-3: Example 1: This embodiment illustrates the specific application process of producing ergothioneine using the recombinant Escherichia coli engineered strain of the present invention, and provides a fermentation process with an initial glucose concentration of 15 g / L. The strain used is the one constructed in Preparation Example 1. E.coli EGT-Full specifically includes the following steps: (1) Preparation of culture medium: Seed culture medium (LB liquid medium) (1L): Weigh 10g tryptone, 10g sodium chloride, and 5g yeast extract; mix and dissolve, then sterilize at 121℃ for 20min.

[0047] 5L fermenter culture medium (1L): Weigh 15g glucose, 7g yeast extract, 6g ammonium sulfate, 3g potassium dihydrogen phosphate, 12g dipotassium hydrogen phosphate, 1.2g magnesium sulfate heptahydrate, 0.1g calcium chloride, and 200mg ferrous sulfate heptahydrate. Mix and dissolve, then sterilize at 115℃ for 30min. After cooling, aseptically add 1g L-histidine, 1g L-cysteine, and 1.5g L-methionine, which have been sterilized by filtration through a 0.22μm filter membrane.

[0048] Feed culture medium (1L): Weigh 600g glucose, 5g L-histidine, 5g L-cysteine, and 5g L-methionine; mix and dissolve, then filter to sterilize for later use.

[0049] (2) Seed culture: Stored at -80℃ E.coli EGT-Full engineered strain was streaked onto LB solid medium and incubated at 37°C for 12 h to activate it; Pick a single colony and inoculate it into a 500 mL shake flask containing 120 mL of seed culture medium (LB medium). Incubate at 37 °C and 200-220 rpm for 12 h with shaking to obtain the seed culture.

[0050] (3) Fermentation culture: The seed culture was inoculated into a 5L fermenter containing 3L of the above-mentioned 5L fermenter culture medium, with an inoculation amount of 3-5% (v / v). The fermentation temperature was controlled at 30℃. During the fermentation process, the dissolved oxygen (DO) in the fermentation broth was maintained at 20%-30% by adjusting the stirring speed and aeration rate. The fermentation cycle was 72 hours. During fermentation, fed-batch culture medium is used to supplement carbon sources and precursor substances, maintaining cell growth and product synthesis.

[0051] Example 2: This embodiment illustrates the specific application process of producing ergothioneine using the recombinant Escherichia coli engineered strain of the present invention, and provides a fermentation process with an initial glucose concentration of 20 g / L. The strain used is the one constructed in Preparation Example 1. E.coli EGT-Full specifically includes the following steps: (1) Preparation of culture medium: 5L fermenter culture medium (1L): Weigh 20g of glucose. The remaining components and preparation process are exactly the same as those in the 5L fermenter culture medium in Example 1.

[0052] The formulations and preparation processes of the seed culture medium and supplemental culture medium are exactly the same as those in Example 1.

[0053] (2) Seed culture: The operating steps and conditions are exactly the same as in Example 1.

[0054] (3) Fermentation culture: The seed culture was inoculated into a 5L fermenter containing 3L of the above-mentioned 5L fermenter culture medium, with an inoculation amount of 3-5% (v / v). The fermentation temperature was controlled at 30℃. During the fermentation process, the dissolved oxygen (DO) in the fermentation broth was maintained at 20%-30% by adjusting the stirring speed and aeration rate. The fermentation cycle was 72 hours. During fermentation, fed-batch culture medium is used to supplement carbon sources and precursor substances.

[0055] Example 3: This embodiment illustrates the specific application process of producing ergothioneine using the recombinant Escherichia coli engineered strain of the present invention, and provides a fermentation process with an initial glucose concentration of 25 g / L. The strain used is the one constructed in Preparation Example 1. E.coli EGT-Full specifically includes the following steps: (1) Preparation of culture medium: 5L fermenter culture medium (1L): Weigh 25g of glucose. The remaining components and preparation process are exactly the same as those in the 5L fermenter culture medium in Example 1.

[0056] The formulations and preparation processes of the seed culture medium and supplemental culture medium are exactly the same as those in Example 1.

[0057] (2) Seed culture: The operating steps and conditions are exactly the same as in Example 1.

[0058] (3) Fermentation culture: The seed culture was inoculated into a 5L fermenter containing 3L of the above-mentioned 5L fermenter culture medium, with an inoculation amount of 3-5% (v / v). The fermentation temperature was controlled at 30℃. During the fermentation process, the dissolved oxygen (DO) in the fermentation broth was maintained at 20%-30% by adjusting the stirring speed and aeration rate. The fermentation cycle was 72 hours. During fermentation, fed-batch culture medium is used to supplement carbon sources and precursor substances.

[0059] Comparative Examples 1-6: Comparative Example 1: The difference from Example 2 is that the strain used is the original starting strain. E.coli MG1655 (without any genomic modifications) was used, and the remaining culture medium formulation, seed culture preparation, and fermentation culture conditions were the same as in Example 2.

[0060] Comparative Example 2: The difference between Example 2 and Example 3 is that the strain used is the control strain constructed in Example 2. E.coli EGT-Basic (integration only) egtABCDE No endogenous metJ , metK , metA , thrA , serA , cysE , yhaM , hisG (The genes were modified), and the remaining culture medium formulation, seed culture preparation, and fermentation conditions were the same as in Example 2. This comparative example aims to verify the necessity of systematically enhancing the chassis cell precursor metabolic pathway.

[0061] Comparative Example 3: The difference between Example 2 and Example 3 is that the strain used was the control strain constructed in Preparation Example 3. E.coli EGT-NoMet (missing target) metJ , metK , metA , thrA(Regarding the gene modification), the remaining culture medium formulation, seed culture preparation, and fermentation conditions were the same as in Example 2. This comparative example aims to specifically verify the key role of enhancing the SAM cycle (methionine pathway) in providing sufficient methyl donors and increasing ergothioneine yield.

[0062] Comparative Example 4: Compared to Example 2, the difference lies in the change of the precursor supply strategy during fermentation: L-histidine, L-cysteine, and L-methionine were not added during the preparation of the 5L fermenter medium; simultaneously, these three amino acids were also not added to the fed-batch medium formulation (only glucose was retained as the carbon source); the selection of other strains and fermentation operating conditions remained the same as in Example 2. This comparative example aims to verify the technical effect of exogenous synergistic addition of key precursor substances during fermentation on improving yield.

[0063] Comparative Example 5: Compared with Example 2, the difference lies in the change of fermentation temperature parameters: the fermentation temperature in step (3) is controlled at 37°C (instead of 30°C), while the selection of other strains, culture medium formulation, and other fermentation parameters are the same as in Example 2. This comparative example aims to verify the beneficial effects of a lower fermentation temperature (30°C) on promoting the correct folding of the ergothionein synthase system, reducing inclusion body formation, and increasing product accumulation.

[0064] Comparative Example 6: The difference between Example 2 and Example 3 is that the strain used was constructed in Preparation Example 4. E.coli EGT-Fungal (using fungal sources) egt1 and egt2 Gene replacement bacterial source egtABCDE (Gene cluster), the rest of the chassis reinforcement background and fermentation conditions are the same as in Example 2. This comparative example aims to verify the difference in ergothioneine synthesis efficiency between the bacterial and fungal synthetic pathways in prokaryotic chassis Escherichia coli.

[0065] Test Example 1-2: Test Example 1: Molecular biological verification of engineered strain genotype construction This test case aims to verify the modification status of key sites in the genomes of the engineered strains and control strains constructed in Preparation Examples 1-4, and to confirm whether the integration of exogenous gene clusters, knockout of endogenous genes, and promoter replacement have been correctly completed according to the design scheme.

[0066] The experimental method is as follows: Select the monoclonal strains obtained in Preparation Examples 1-4 respectively ( E.coli EGT-Full, E.coli EGT-Basic, E.coli EGT-NoMet E.coli EGT-Fungal and the original strain of Comparative Example 1 ( E.coli Fresh cultures of MG1655 were used as templates. Colony PCR was employed for amplification and validation. Specific validation primers were designed for different modification sites, with the primer design principle being: the upstream primer was located upstream of the modified site's genomic sequence, and the downstream primer was located downstream of the modified site's genomic sequence or inside the inserted fragment.

[0067] PCR reaction system (25 μL): 12.5 μL 2×Taq Master Mix, 1.0 μL upstream primer (10 μM), 1.0 μL downstream primer (10 μM), 1.0 μL cell lysis buffer, 9.5 μL ddH2O.

[0068] PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension (extension time set at 1 min / kb according to the estimated fragment size) for 30 cycles; 72℃ extension for 10 min.

[0069] The amplification products were separated by 1.0% agarose gel electrophoresis, and the band size was observed and recorded using a gel imaging system.

[0070] Three representative sites were selected for validation: ldhA Site (ergothioneine pathway integration site): Verifies whether the exogenous synthetic gene cluster has been successfully inserted. Wild-type amplification product is... ldhA Full-length gene; recombinant amplification product is the replaced gene. egtABCDE or egt1 and egt2 Sequence length.

[0071] metJ Site (methionine repressor site): Verifies gene knockout status. Wild-type amplification products contain complete... metJ Gene; knockout amplification products are truncated fragments after the coding region has been removed.

[0072] cysE Site (key enzyme site for cysteine ​​synthesis): Verify promoter substitution. Wild-type amplification products contain the natural promoter; enhanced amplification products contain an artificially substituted strong promoter sequence (sequence length design varies).

[0073] The experimental results are shown in Table 1: Table 1: Statistics on the size of PCR amplification fragments at key sites for each strain (unit: bp)

[0074] Conclusion Analysis: As shown in Table 1, the PCR amplification band sizes of each strain at key sites are consistent with the theoretical design values.

[0075] The original strain exhibited wild-type characteristic lengths at all three sites.

[0076] Preparation Example 1 ( E.coli EGT-Full) in ldhA The site amplified a specific band of approximately 6.4 kb, indicating a bacterial origin. egtABCDE The gene clusters have been accurately integrated; in metJ A small fragment of approximately 190 bp was amplified at the site, confirming that the coding region of the repressor protein gene had been removed, thus relieving the transcriptional repression of the methionine synthesis pathway at the molecular level; cysE The site amplified a band of approximately 685 bp (significantly shifted compared to the wild-type band of approximately 425 bp), indicating that the strong promoter sequence has successfully replaced the natural promoter, establishing the basis for transcriptional enhancement of the cysteine ​​synthesis pathway.

[0077] The band distribution characteristics of Preparation Example 2 and Preparation Example 3 also correspond to their genotype designs that integrate only the exogenous pathway and lack the Met pathway enhancement, respectively.

[0078] Preparation Example 4 ldhA The site showed a band of approximately 4.8 kb, corresponding to the fungal source. egt1 and egt2 The length of the gene cluster confirmed the successful construction of the fungal-derived engineered bacteria.

[0079] The above molecular biology verification results demonstrate that all engineered strains described in this invention have been successfully constructed, with accurate genome modifications, and possess the genetic basis for subsequent fermentation performance testing and metabolic mechanism verification. By removing... metJ Mediated inhibition and reinforcement cysE The transcriptional level of key enzymes such as ergothionein can increase the metabolic flux of intracellular S-adenosylmethionine (SAM) and cysteine, providing sufficient methyl and sulfur donors for the efficient synthesis of ergothionein.

[0080] Test Example 2: Determination of Ergothioneine Fermentation Yield and Substrate Conversion Rate This test case mainly examines the effects of different strain construction strategies and fermentation process parameters on the final yield of ergothionein and sugar-acid conversion rate. The product concentration of the fermentation endpoint sample was quantitatively analyzed by high performance liquid chromatography (HPLC).

[0081] Experimental methods: After fermentation culture was completed (72 h), 50 mL of fermentation broth was taken from the fermenters of Examples 1-3 and Comparative Examples 1-6, respectively. The fermentation broth was centrifuged at 8000 rpm for 10 min to remove the cell precipitate, and the supernatant was collected. The supernatant was filtered through a 0.22 μm microporous membrane, and the filtrate was used as the sample to be tested.

[0082] High-performance liquid chromatography (HPLC) was used for detection. A hydrophilic interaction column (HILIC, 4.6 mm × 250 mm, 5 μm) was selected; mobile phase A was 0.1% formic acid aqueous solution, and mobile phase B was acetonitrile, with isocratic elution and an A:B volume ratio of 15:85; the flow rate was set to 1.0 mL / min; the column temperature was maintained at 30 °C; the detection wavelength was set to 254 nm; and the injection volume was 10 μL.

[0083] A standard curve was plotted using ergothioneine standards, and the concentration of ergothioneine in the sample was calculated based on the chromatographic peak area.

[0084] The relevant calculation formulas are as follows: Product potency (g / L) = HPLC concentration × dilution factor; Sugar-acid conversion rate (%) = [product potency (g / L) × fermentation volume (L)] / [(initial glucose amount + supplemental glucose amount (g)] × 100%.

[0085] Experimental results: The fermentation data of each experimental group are shown in Table 2.

[0086] Table 2: Results of Ergothionein Fermentation Performance Tests under Different Strains and Processing Conditions

[0087] Note: ND indicates below the detection limit.

[0088] Conclusion Analysis: Based on the data analysis in Table 2, the technical solution of the present invention shows a significant advantage in increasing ergothioneine yield.

[0089] First, the data from Examples 1-3 show that, through systemic metabolic engineering, E.coli All EGT-Full strains achieved high yields exceeding 10 g / L. Example 2 achieved a peak yield of 13.15 g / L at an initial glucose concentration of 20 g / L, indicating that this process achieved an optimal balance between carbon source utilization and product synthesis. Although the initial substrate concentration increased in Example 3, the yield did not increase linearly, and the conversion rate decreased slightly, suggesting that excessively high substrate concentrations may cause overflow metabolism or byproduct accumulation, affecting synthesis efficiency.

[0090] Secondly, through a horizontal comparison with comparative examples, the mechanistic contribution of the multidimensional enhancement strategy of this invention is revealed: The necessity of chassis modification: The yield of Comparative Example 2 (EGT-Basic) was only 2.15 g / L, lower than that of Example 2. This confirms that the introduction of exogenous synthetic enzyme systems is limited by insufficient supply of endogenous precursors from the host, and only by removing the metabolic bottleneck can the synthetic potential be released.

[0091] The crucial role of the methylation pathway: Comparative Example 3 (EGT-NoMet), with enhanced cysteine ​​and histidine pathways but without enhanced methionine (Met) pathway, showed a yield of 6.78 g / L, approximately half that of Example 2. Ergothioneine synthesis involves a critical three-step methylation reaction, and this result demonstrates the effectiveness of knocking out the repressor protein. metJ and overexpression metK Genes such as these can effectively increase the capacity of the intracellular S-adenosylmethionine (SAM) pool, providing sufficient donors for the methylation step catalyzed by EgtD enzyme, and are a decisive factor in achieving high yield.

[0092] Synergistic effect of exogenous precursor and endogenous synthesis: In Comparative Example 4, the yield dropped to 4.32 g / L without the addition of exogenous precursor amino acids. This indicates that the endogenous synthesis capacity of engineered bacteria alone is insufficient to support precursor consumption under high-density fermentation. The feed-in precursor strategy during fermentation can complement the enhancement of intracellular metabolic flux, jointly driving product accumulation.

[0093] Enzyme source and temperature suitability: Comparative Example 6, using a fungal route, showed a significantly lower yield (1.67 g / L) than the examples using a bacterial route. This is attributed to the fact that the expression levels, solubility, and catalytic activity of fungal-derived Egt1 / Egt2 enzymes in *E. coli* are generally less suitable than those of the bacterial EgtA-E enzyme system. Meanwhile, Comparative Example 5 showed that the yield at 37°C fermentation was lower than that at 30°C, indicating that lower culture temperatures favor proper folding and stability of heterologous enzyme proteins, reducing inclusion body formation.

[0094] In summary, this invention, by selecting a bacterial synthetic pathway, combining targeted enhancement of the methionine cycle, cysteine ​​and histidine synthesis pathways in chassis cells, and supplementing with an optimized fermentation precursor feeding process, successfully overcomes the rate-limiting step in ergothioneine biosynthesis and achieves efficient preparation of the target product.

[0095] Appendix: yhaM Sequence (as shown in SEQ ID NO:1):

[0096] cysE Sequence (shown as SEQ ID NO:2): ATGTCGTGTGAAGAACTGGAAATTGTCTGGAACAATATTAAAGCCGAAGCCAGAACGCTGGCGGACTGTGAGCCAATGCTGGCCAGTTTTTACCACGCGACGCTACTCAAGCACGAAAACCTTGGCAGTGCACTGAGCTACATGCTGGCGAACAAGCTGTCATCGCCAATTATGCCTGCTATTGCTATCCGTGAAGTGGTGGAAGAAGCCTACGCCGCTGACCCGGAAATGATCGCCTCTGCGGCCTGTGATATTCAGGCGGTGCGTACCCGCGACCCGGCAGTCGATAAATACTCAACCCCGTTGTTATACCTGAAGGGTTTTCATGCCTTGCAGGCCTATCGCATCGGTCACTGGTTGTGGAATCAGGGGCGTCGCGCACTGGCAATCTTTCTGCAAAACCAGGTTTCTGTGACGTTCCAGGTCGATATTCACCCGGCAGCAAAAATTGGTCGCGGTATCATGCTTGACCACGCGACAGGCATCGTCGTTGGTGAAACGGCGGTGATTGAAAACGACGTATCGATTCTGCAATCTGTGACGCTTGGCGGTACGGGTAAATCTGGTGGTGACCGTCACCCGAAAATTCGTGAAGGTGTGATGATTGGCGCGGGCGCGAAAATCCTCGGCAATATTGAAGTTGGGCGCGGCGCGAAGATTGGCGCAGGTTCCGTGGTGCTGCAACCGGTGCCGCCGCATACCACCGCCGCTGGCGTTCCGGCTCGTATTGTCGGTAAACCAGACAGCGATAAGCCATCAATGGATATGGACCAGCATTTCAACGGTATTAACCATACATTTGAGTATGGGGATGGGATCTAA。

[0097] serA Sequence (shown as SEQ ID NO:3):

[0098] metJ Sequence (as shown in SEQ ID NO:4): ATGGCTGAATGGAGCGGCGAATATATCAGCCCATACGCTGAGCACGGCAAGAAGAGTGAACAAGTCAAAAAGATTACGGTTTCCATTCCTCTTAAGGTGTTAAAAATCCTCACCGATGAACGCACGCGTCGTCAGGTGAACAACCTGCGTCACGCTACCAACAGCGAGCTGCTGTGCGAAGCGTTTCTGCATGCCTTTACCGGGCAACCTTTGCCGGATGATGCCGATCTGCGTAAAGAGCGCAGCGACGAAATCCCGGAAGCGGCAAAAGAGATCATGCGTGAGATGGGGATTAACCCGGAGACGTGGGAATACTAA。

[0099] thrA Sequence (as shown in SEQ ID NO:5):

[0100] metA Sequence (as shown in SEQ ID NO:6): ATGCCGATTCGTGTGCCGGACGAGCTACCCGCCGTCAATTTCTTGCGTGAAGAAAACGTCTTTGTGATGACAACTTCTCGTGCGTCTGGTCAGGAAATTCGTCCACTTAAGGTTCTGATCCTTAACCTGATGCCGAAGAAGATTGAAACTGAAAATCAGTTTCTGCGCCTGCTTTCAAACTCACCTTTGCAGGTCGATATTCAGCTGTTGCGCATCGATTCCCGTGAATCGCGCAACACGCCCGCAGAGCATCTGAACAACTTCTACTGTAACTTTGAAGATATTCAGGATCAGAACTTTGACGGTTTGATTGTAACTGGTGCGCCGCTGGGCCTGGTGGAGTTTAATGATGTCGCTTACTGGCCGCAGATCAAACAGGTGCTGGAGTGGTCGAAAGATCACGTCACCTCGACGCTGTTTGTCTGCTGGGCGGTACAGGCCGCGCTCAATATCCTCTACGGCATTCCTAAGCAAACTCGCACCGAAAAACTCTCTGGCGTTTACGAGCATCATATTCTCCATCCTCATGCGCTTCTGACGCGTGGCTTTGATGATTCATTCCTGGCACCGCATTCGCGCTATGCTGACTTTCCGGCAGCGTTGATTCGTGATTACACCGATCTGGAAATTCTGGCAGAGACGGAAGAAGGGGATGCATATCTGTTTGCCAGTAAAGATAAGCGCATTGCCTTTGTGACGGGCCATCCCGAATATGATGCGCAAGCTCTGGCGCAGGAATTTTTCCGCGATGTGGAAGCCGGACTAGACCCGGATGTACCGTATAACTATTTCCCGCACAATGATCCGCAAAATACACCGCGAGCGAGCTGGCGTAGTCACGGTAATTTACTGTTTACCAACTGGCTCAACTATTACGTCTACCAGATCACGCCATACGATCTACGGCACATGAATCCAACGCTGGATTAA。

[0101] hisG Sequence (as shown in SEQ ID NO:7): ATGACAGACAACACTCGTTTACGCATAGCTATGCAGAAATCCGGCCGTTTAAGTGATGACTCACGCGAATTGCTGGCGCGCTGTGGCATTAAAATTAATCTTCACACCCAGCGCCTGATCGCGATGGCAGAAAACATGCCGATTGATATTCTGCGCGTGCGTGACGACGACATTCCCGGTCTGGTAATGGATGGCGTGGTAGACCTTGGGATTATCGGCGAAAACGTGCTGGAAGAAGAGCTGCTTAACCGCCGCGCCCAGGGTGAAGATCCACGCTACTTTACCCTGCGTCGTCTGGATTTCGGCGGCTGTCGTCTTTCGCTGGCAACGCCGGTTGATGAAGCCTGGGACGGTCCGCTCTCCTTAAACGGTAAACGTATCGCCACCTCTTATCCTCACCTGCTCAAGCGTTATCTCGACCAGAAAGGCATCTCTTTTAAATCCTGCTTACTGAACGGTTCTGTTGAAGTCGCCCCGCGTGCCGGACTGGCGGATGCGATTTGCGATCTGGTTTCCACCGGTGCCACGCTGGAAGCTAACGGCCTGCGCGAAGTCGAAGTTATCTATCGCTCGAAAGCCTGCCTGATTCAACGCGATGGCGAAATGGAAGAATCCAAACAGCAACTGATCGACAAACTGCTGACCCGTATTCAGGGTGTGATCCAGGCGCGCGAATCAAAATACATCATGATGCACGCACCGACCGAACGTCTGGATGAAGTCATCGCCCTGCTGCCAGGTGCCGAACATCCAACTATTCTGCCGCTGGCGGGTGACCAACAGCGCGTAGCGATGCACATGGTCAGCAGCGAAACCCTGTTCTGGGAAACCATGGAAAAACTGAAAGCGCTGGGTGCCAGTTCAATTCTGGTCCTGCCGATTGAGAAGATGATGGAGTGA。

[0102] metK Gene sequence (shown as SEQ ID NO:8):

[0103] ldhA Gene sequence (as shown in SEQ ID NO:9): ATGAAACTCGCCGTTTATAGCACAAAACAGTACGACAAGAAGTACCTGCAACAGGTGAACGAGTCCTTTGGCTTTGAGCTGGAATTTTTTGACTTTCTGCTGACGGAAAAAACCGCTAAAACTGCCAATGGCTGCGAAGCGGTATGTATTTTCGTAAACGATGACGGCAGCCGCCCGGTGCTGGAAGAGCTGAAAAAGCACGGCGTTAAATATATCGCCCTGCGCTGTGCCGGTTTCAATAACGTCGACCTTGACGCGGCAAAAGAACTGGGGCTGAAAGTAGTCCGTGTTCCAGCCTATGATCCAGAGGCCGTTGCTGAACACGCCATCGGTATGATGATGACGCTGAACCGCCGTATTCACCGCGCGTATCAGCGTACCCGTGATGCTAACTTCTCTCTGGAAGGTCTGACCGGCTTTACTATGTATGGCAAAACGGCAGGCGTTATCGGTACCGGTAAAATCGGTGTGGCGATGCTGCGCATTCTGAAAGGTTTTGGTATGCGTCTGCTGGCGTTCGATCCGTATCCAAGTGCAGCGGCGCTGGAACTCGGTGTGGAGTATGTCGATCTGCCAACCCTGTTCTCTGAATCAGACGTTATCTCTCTGCACTGCCCGCTGACACCGGAAAACTATCATCTGTTGAACGAAGCCGCCTTCGAACAGATGAAAAATGGCGTGATGATCGTCAATACCAGTCGCGGTGCATTGATTGATTCTCAGGCAGCAATTGAAGCGCTGAAAAATCAGAAAATTGGTTCGTTGGGTATGGACGTGTATGAGAACGAACGCGATCTATTCTTTGAAGATAAATCCAACGACGTGATCCAGGATGACGTATTCCGTCGCCTGTCTGCCTGCCACAACGTGCTGTTTACCGGGCACCAGGCATTCCTGACAGCAGAAGCTCTGACCAGTATTTCTCAGACTACGCTGCAAAACTTAAGCAATCTGGAAAAAGGCGAAACCTGCCCGAACGAACTGGTTTAA。

Claims

1. A method for constructing a recombinant Escherichia coli engineered strain that produces high levels of ergothioneine, characterized in that, Includes the following steps: Step 1: Using E. coli as chassis cells, ergothioneine synthesis gene clusters are integrated into the chassis cell genome using gene editing technology. egtABCDE To obtain intermediate strains; Step 2: Enhance the methionine synthesis pathway of the intermediate strain. The operation steps include: Knockout of transcriptional repressor protein genes in the genome using homologous recombination metJ ; Methionine adenosine transferase gene in the genome metK Homoserine O-succinyltransferase gene metA and aspartate kinase / homoserine dehydrogenase gene thrA The natural promoter is replaced with a strongly constitutive promoter; Among them, the metA The gene is a mutated gene that has been freed from feedback inhibition. thrA The gene is a mutated gene that has been freed from feedback inhibition; Step 3: Enhance the cysteine ​​and histidine synthesis pathways of the intermediate strain. The steps include: The D-3-phosphoglycerate dehydrogenase gene in the genome serA Serine acetyltransferase gene cysE and ATP phosphoribosyltransferase gene hisG The natural promoter is replaced with a strongly constitutive promoter; Simultaneously knock out the cysteine ​​lyase gene yhaM ; Among them, the serA The gene is a mutated gene that has been freed from feedback inhibition. hisG The gene is a mutated gene that has been freed from feedback inhibition; After completing steps one, two, and three, recombinant engineered Escherichia coli strains are obtained.

2. The method for constructing a high-yield ergothioneine-producing recombinant Escherichia coli engineered strain according to claim 1, characterized in that, In step one, the gene editing technology uses the CRISPR / Cas9 system; the ergothionein synthesis gene cluster egtABCDE lactate dehydrogenase gene integrated into the chassis cell genome ldhA Sites, and the integration process causes ldhA Gene inactivation.

3. The method for constructing a high-yield ergothioneine-producing recombinant Escherichia coli engineered strain according to claim 1, characterized in that, In step two, the strong constitutive promoter is an artificially synthesized strong promoter sequence; the knockout operation is achieved by introducing donor DNA containing upstream and downstream homologous arms that are homologous to the gene sequence to be knocked out and by targeted cutting to achieve the deletion of the coding region of the genome.

4. The method for constructing a high-yield ergothioneine-producing recombinant Escherichia coli engineered strain according to claim 1, characterized in that, In step three, the enhancement of the cysteine ​​synthesis pathway and the enhancement of the histidine synthesis pathway are carried out simultaneously or in steps; the strong constitutive promoter is used to increase the expression levels of the D-3-phosphoglycerate dehydrogenase, the serine acetyltransferase, and the ATP phosphoribosyltransferase.

5. The method for constructing a high-yield ergothioneine-producing recombinant Escherichia coli engineered strain according to claim 1, characterized in that, The nucleotide sequences of the genes involved are as follows: The yhaM The nucleotide sequence of the gene is shown in SEQ ID NO:1; The cysE The nucleotide sequence of the gene is shown in SEQ ID NO:2; The serA The nucleotide sequence of the gene is shown in SEQ ID NO:3; The metJ The nucleotide sequence of the gene is shown in SEQ ID NO:4; The thrA The nucleotide sequence of the gene is shown in SEQ ID NO:5; The metA The nucleotide sequence of the gene is shown in SEQ ID NO:6; The hisG The nucleotide sequence of the gene is shown in SEQ ID NO:7; The metK The nucleotide sequence of the gene is shown in SEQ ID NO:8; The ldhA The nucleotide sequence of the gene is shown in SEQ ID NO:

9.

6. The use of a recombinant Escherichia coli engineered strain obtained by the construction method according to any one of claims 1-5 in the preparation of ergothionein.

7. The application of the recombinant Escherichia coli engineered strain with high ergothioneine production according to claim 6, characterized in that, The application of the recombinant Escherichia coli engineered bacteria is achieved through fermentation culture of the recombinant Escherichia coli engineered bacteria, and the fermentation culture includes the following steps: S1. The recombinant Escherichia coli engineered bacteria are inoculated into a seed culture medium for activation culture to prepare seed solution; S2. The seed liquid is inoculated into a fermenter containing fermentation tank culture medium for fermentation culture; S3. Feed culture medium is added during the fermentation process, and the fermentation broth is collected after fermentation to extract ergothioneine; The fermentation culture temperature is controlled between 28°C and 32°C, and exogenous precursor substances are added to both the fermentation tank culture medium and the feed culture medium. The exogenous precursor substances include L-histidine, L-cysteine ​​and L-methionine.

8. The application of the recombinant Escherichia coli engineered strain with high ergothioneine production according to claim 7, characterized in that, In step S2, the fermenter culture medium contains the following components at the following concentrations: Glucose 15-25g / L; Yeast extract 6.0-8.0 g / L; Ammonium sulfate 5.0-7.0 g / L; Potassium dihydrogen phosphate 2.5-3.5 g / L; Dipotassium hydrogen phosphate 10.0-14.0 g / L; Magnesium sulfate heptahydrate 1.0-1.5 g / L; Calcium chloride 0.05-0.15 g / L; Ferrous sulfate heptahydrate 150-250 mg / L; L-histidine 0.8-1.2 g / L; L-cysteine ​​0.8-1.2 g / L; L-methionine 1.2-1.8 g / L.

9. The application of the recombinant Escherichia coli engineered strain with high ergothioneine production according to claim 7, characterized in that, In step S3, the supplemental culture medium contains the following components at the following concentrations: Glucose 500-700g / L; L-histidine 4.0-6.0 g / L; L-cysteine ​​4.0-6.0 g / L; L-methionine 4.0-6.0 g / L; The fermentation culture cycle is 60-90 hours. During the fermentation process, the fed culture medium is added to maintain the carbon and nitrogen sources required for cell growth and product synthesis.

10. The application of the recombinant Escherichia coli engineered strain with high ergothioneine production according to claim 7, characterized in that, In step S1, the preparation conditions for the seed solution are as follows: Incubate with shaking at 36-38℃ and 180-240 rpm for 10-14 hours; In step S2, the inoculation amount of the seed solution is 3-5% (v / v); The seed culture medium contains tryptone, yeast extract and sodium chloride.

Images