Application of genes OsEDS1 and OsPAD4 in resisting rice blast

Abstract

The invention discloses an application of genes OsEDS1 and OsPAD4 in improving the disease resistance of plants, and the genes OsEDS1 and OsPAD4 can enhance the disease resistance of the plants to magnaporthe oryzae infection and are used for cultivating new varieties of disease-resistant plants.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically, it relates to the use of genes OsEDS1 and OsPAD4 in improving rice resistance to rice blast and creating disease-resistant rice germplasm resources. Background Technology

[0002] Throughout their entire life cycle, plants are constantly attacked by various pathogenic microorganisms (fungi, bacteria, viruses, and nematodes, etc.), leading to reduced crop yields and decreased quality. Breeding disease- and pest-resistant varieties is an important means of green control of crop diseases and pests. Research on plant immunity and resistance provides a theoretical basis for production practices and is of great value.

[0003] In the article “Ke Y, Liu H, Li X, Xiao J, Wang S. Rice OsPAD4 functions differently from Arabidopsis AtPAD4 in host-pathogen interactions. Plant J. 78, 619-31 (2014).”, the authors investigated that inhibiting OsPAD4 through RNA interference (RNAi) and inoculating OsPAD4-RNAi materials increased rice susceptibility to Xanthomonas oryzaepv. oryzae (Xoo). In the article "Ke Y, Kang Y, Wu M, Liu H, Hui S, Zhang Q, Li X, Xiao J, Wang S. Jasmonic Acid-Involved OsEDS1 Signaling in Rice-Bacteria Interactions. Rice 12, 25 (2019)", the authors found that the OsEDS1-knouckout mutant (oseds1) exhibited a more susceptible phenotype to the rice diseases Xanthomonas oryzaepv. oryzae (Xoo) and Xanthomonas oryzaepv. oryzicola (Xoc). Previous articles only identified the involvement of OsEDS1 and OsPAD4 in resistance to bacterial diseases in rice, without addressing resistance to fungal diseases. Furthermore, only RNAi or knockout materials were studied, without considering the resistance of overexpressed materials. Summary of the Invention

[0004] In our research on the pathogenesis of fungal diseases in rice, such as rice blast, we investigated the resistance of the genes OsEDS1 and OsPAD4 to fungal diseases and found that they can effectively resist rice plants infected by rice blast fungus such as TH12. Rice lines overexpressing OsEDS1 and OsPAD4 exhibited strong resistance after inoculation with rice blast race TH12. Based on this finding, the present invention includes the following technical solution.

[0005] This invention provides the use of genes OsEDS1 (NCBI number LOC4346962 or XP_015612653) and OsPAD4 (NCBI number LOC4349988 or XP_015617551) in improving plant disease resistance.

[0006] Specifically, the disease resistance refers to resistance to plant diseases caused by plant fungal pathogens such as rice blast fungus.

[0007] The rice blast fungus (Magnaporthe.oryzae) is also known as Pyricularia oryzae.

[0008] In one specific implementation, the rice blast fungus is TH12.

[0009] The aforementioned plants can be monocotyledonous plants, preferably grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum.

[0010] In one implementation, the crop is rice, and the plant disease is rice blast.

[0011] Preferably, the above-mentioned uses are to use the genes OsEDS1 and OsPAD4 for phytoremediation, to improve plant disease resistance, or to cultivate disease-resistant plant varieties.

[0012] In one specific implementation, the above-mentioned uses are to perform plant repair, improve plant disease resistance, or cultivate disease-resistant plant varieties by overexpressing the genes OsEDS1 and / or OsPAD4 in plants.

[0013] Optionally, the genes OsEDS1 and / or OsPAD4 are overexpressed in plants such as rice using the following methods:

[0014] A. Cloning the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the genes OsEDS1 and / or OsPAD4; and / or

[0015] B. By cloning the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence into a plant chromosome using gene editing technology, obtaining transgenic plants that overexpress the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence; and / or

[0016] C. Place the existing genes OsEDS1 or its coding sequence and / or OsPAD4 or their coding sequence in the plant genome, such as rice, under the regulation of a functionally enhanced promoter, such as the 35S promoter or the Ubi promoter.

[0017] The plasmid vectors mentioned in step A above are, for example, vectors used for plant transgenic purposes or modified vectors such as pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vectors pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, and pTF102;

[0018] The Agrobacterium species mentioned are, for example, Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101. For example, the above-mentioned recombinant plasmids are transferred into Agrobacterium strains using the freeze-thaw method to form engineered microorganisms for transforming plant plants.

[0019] Preferably, the plant is rice, such as TP309 or ZH11 or their derivatives.

[0020] This invention discovered that OsEDS1 and OsPAD4 in rice are involved in resistance to the fungal disease rice blast. Using the field inoculation method for rice blast reported in existing literature, transgenic lines containing knockout and overexpression of OsEDS1 and OsPAD4 were inoculated, and their resistance was observed. The experiment showed that rice lines overexpressing OsEDS1 and OsPAD4 exhibited strong resistance after inoculation with rice blast race TH12. These results suggest that OsEDS1 and OsPAD4 have important value in participating in rice disease resistance and can serve as new breeding targets. They are of significant value for repairing agronomic traits in plants infected with rice blast fungus, improving plant resistance, or breeding disease-resistant plant varieties. Attached Figure Description

[0021] Figure 1The autoimmune phenotype of rod1 suppressed by gene srd8 is shown. (A) Plant morphology of TP309, rod1, and srd8. The srd8 mutant plant exhibits a growth phenotype similar to wild-type TP309. Scale bar, 10 cm. (B) Leaf phenotype of TP309, rod1, and srd8. The leaves of the srd8 mutant do not show a lesion-like phenotype. Scale bar, 1 cm. (C) DAB staining of TP309, rod1, and srd8. DAB staining shows that the accumulation of H2O2 in the leaves of the srd8 mutant is comparable to that of TP309 and lower than that of rod1. Scale bar, 1 cm. (D) srd8 restores rod1's resistance to rice blast. TP309, rod1, and srd8 were inoculated with rice blast fungus (TH12), and the severity of disease was assessed seven days after inoculation. The growth rate of rice blast fungus MoPOT2 inoculated on leaves was calculated using qRT-PCR with rice Ubiquitin as an internal control. Data are presented as mean ± SD (n = 3, independent samples). Two-tailed t-tests were used for data analysis; asterisks indicate statistical significance (**P < 0.01, ***P < 0.001). Scale bar: 1 cm.

[0022] Figure 2 The map-based cloning process of the SRD8 gene is shown. (A) Agarose gel electrophoresis image of the srd8 gene linkage markers. (B) Fine map-based cloning of the srd8 gene. SRD8 is located in a 406-kb region on chromosome 11. (C) Comparison of the DNA sequences of rod1 and srd8's OsPAD4 reveals a G-to-A mutation at the splice site.

[0023] Figure 3 The genetically complementary lines suppressed the autoimmune phenotype of rod1. (A) OsPAD4 knockout plant lines in the rod1 background. The target site was selected on the second exon of OsPAD4, representing two loss-of-function lines of OsPAD4. (B) Plant morphology of TP309, rod1, srd8, and OsPAD4-KO / rod1. Scale bar, 10cm. (C) Leaf phenotype of TP309, rod1, srd8, and OsPAD4-KO / rod1. Scale bar, 1cm. (D) DAB staining of TP309, rod1, srd8, and OsPAD4-KO / rod1. Scale bar, 1cm.

[0024] Figure 4This study demonstrates the positive regulation of rice disease resistance by OsPAD4. The disease phenotypes of representative lines TP309, OsPAD4-KO, and OsPAD4-OE were shown 7 days after inoculation with rice blast (race TH12). The growth of the rice blast fungus MoPOT2 inoculated with the fungus was calculated using qRT-PCR with rice Ubiquitin as an internal control. Data are presented as mean ± sd (n = 3, independent samples). Scale bar: 1 cm.

[0025] Figure 5 The autoimmune phenotype of srd10 suppressing rod1 is shown. (A) Plant morphology of TP309, rod1, and srd10. The srd10 mutant plants exhibit a growth phenotype similar to wild-type TP309. Scale bar, 10 cm. (B) Leaf phenotype of TP309, rod1, and srd10. The leaves of the srd10 mutant do not show a lesion-like phenotype. Scale bar, 1 cm. (C) DAB staining of TP309, rod1, and srd10. DAB staining shows that the accumulation of H2O2 in the leaves of the srd10 mutant is comparable to that of TP309 and lower than that of rod1. Scale bar, 1 cm. (D) srd10 restores rod1's resistance to rice blast. TP309, rod1, and srd10 were inoculated with rice blast fungus (TH12), and the severity of disease was assessed seven days after inoculation. The growth rate of rice blast fungus MoPOT2 inoculated on leaves was calculated using qRT-PCR with rice Ubiquitin as an internal control. Data are presented as mean ± SD (n = 3, independent samples). Two-tailed t-tests were used for data analysis; asterisks indicate statistical significance (**P < 0.01, ***P < 0.001). Scale bar: 1 cm.

[0026] Figure 6 The map-based cloning process of the SRD10 gene is shown. (A) Agarose gel electrophoresis image of the srd10 gene linked to markers. (B) Fine map-based cloning of the srd10 gene. SRD10 is located in a 563-kb region on chromosome 9. (C) Comparison of the DNA sequences of rod1 and srd10's OsEDS1 reveals a C-to-T mutation at base 2807 that causes premature termination.

[0027] Figure 7The genetically complementary lines suppressed the autoimmune phenotype of rod1. (A) OsEDS1 knockout plant lines in the rod1 background. The target site was selected on the second exon of OsEDS1, representing two loss-of-function lines of OsEDS1. (B) Plant morphology of TP309, rod1, srd10, and OsEDS1-KO / rod1. Scale bar, 10cm. (C) Leaf phenotype of TP309, rod1, srd10, and OsEDS1-KO / rod1. Scale bar, 1cm. (D) DAB staining of TP309, rod1, srd10, and OsEDS1-KO / rod1. Scale bar, 1cm.

[0028] Figure 8 This study demonstrates the positive regulation of rice disease resistance by OsEDS1. The disease phenotypes of representative lines TP309, OsEDS1-KO, and OsEDS1-OE were shown 7 days after inoculation with rice blast (race TH12). The growth of the rice blast fungus MoPOT2 inoculated with the fungus was calculated using qRT-PCR with rice Ubiquitin as an internal control. Data are presented as mean ± sd (n = 3, independent samples). Scale bar: 1 cm.

[0029] Figure 9 The structural maps of the recombinant plasmids overexpressing the genes OsEDS1 and OsPAD4 are shown. Among them, (A) is the map of plasmid pUN1301-OsEDS1-eGFP; (B) is the map of plasmid pUN1301-OsPAD4-eGFP. Detailed Implementation

[0030] Rice blast pathogens evolve rapidly in nature. After a resistant variety has been widely planted for 3-5 years, some physiological races of rice blast will eventually break through the rice's immune defenses, leading to susceptibility. Therefore, elucidating the immune signaling pathways of rice blast can provide new targets for rice molecular breeding.

[0031] Our research group discovered that the genes OsEDS1 and OsPAD4 can effectively improve the resistance of rice plants to infection by the fungal pathogen rice blast fungus.

[0032] The protein OsEDS1 encoded by the gene OsEDS1 (NCBI number LOC4346962 or XP_015612653) is a lipase-like protein containing 621 amino acids.

[0033] The protein OsPAD4 encoded by the gene OsPAD4 (NCBI number LOC4349988 or XP_015617551) is a lipase-like protein containing 659 amino acids.

[0034] Although this invention has tested the function of genes OsEDS1 and OsPAD4 in rice to resist infection by rice blast fungus, those skilled in the art can expect that genes OsEDS1 and OsPAD4 can also be extended to other gramineous crops such as wheat, corn, soybean, barley, oats, rye, and sorghum to improve the plant's resistance to infection by rice blast fungus. Therefore, genes OsEDS1 and OsPAD4 can also be used in disease resistance breeding to create disease-resistant plant germplasm resources.

[0035] To achieve the expression of genes OsEDS1 and OsPAD4 in plants such as rice, gene expression cassettes or expression constructs can be constructed using genes OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence as exogenous genes. These expression cassettes / expression constructs can then be operatively linked to plasmid vectors through subcloning to obtain recombinant plasmids. The recombinant plasmids can then be transformed into host cells to obtain transformants, i.e., genetically engineered bacteria or recombinant bacteria, or they can be transformed into plants through Agrobacterium-mediated transformation to obtain transgenic plants.

[0036] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0037] As used herein, the terms “(disease resistance) improved,” “enhanced,” or “strengthened” can mean an increase of at least 10% relative to a reference level (e.g., wild-type rice), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times relative to a reference level.

[0038] As used herein, the term "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express the target genes OsEDS1 and OsPAD4. Typically, it includes the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; additionally, it may optionally include signal peptide encoding sequences such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein); these elements are operatively linked.

[0039] As used herein, an "expression construct" or "expression building block" refers to a recombinant DNA molecule containing the intended gene OsEDS1 or its coding region sequence or OsPAD4 or its coding region sequence, which may contain one or more gene expression cassettes. The "construct" is typically contained within an expression vector (plasmid vector).

[0040] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0041] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or sequences. For example, a promoter region is placed at a specific position relative to the target gene OsEDS1 or OsPAD4, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.

[0042] The nucleic acid constructs described in this invention can be manipulated in various ways to ensure the expression of the genes OsEDS1 or OsPAD4. The nucleic acid constructs can be manipulated according to the different expression vectors or requirements before insertion into the vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

[0043] In some embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. Genes OsEDS1 or their coding sequences and / or OsPAD4 or their coding sequences can be cloned into many types of vectors, such as plasmids, phage particles, phage derivatives, animal viruses, and granules. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present invention. Expression vectors can be provided to cells in the form of bacterial or viral vectors. Expression of genes OsEDS1 or OsPAD4 is typically achieved by operably linking the nucleic acid sequence of genes OsEDS1 or OsPAD4 to a promoter and incorporating the construct into an expression vector. This vector is suitable for replication and integration into eukaryotic cells. Typical expression vectors contain expression control sequences that can be used to regulate the expression of the desired nucleic acid sequence.

[0044] Gene knock-in vectors can be used to integrate the genes described herein, such as OsEDS1 or its coding sequence, and / or OsPAD4 or its coding sequence, into regions of interest in the host genome. Typically, gene knock-in vectors contain, in addition to the polynucleotide sequences described herein, 5' and 3' homologous arms required for genomic homologous recombination. In some embodiments, the nucleic acid constructs described herein contain 5' homologous arms, the polynucleotide sequences described herein, and 3' homologous arms. When using gene knock-in vectors, CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequences into the sites of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion site by designing guide RNAs targeting the target gene, resulting in increased homologous recombination efficiency in the modified gene region, thus homologously recombinating the target gene OsEDS1 or OsPAD4 sequence fragment contained in the gene knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0045] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Furthermore, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline, ampicillin resistance, or chloramphenicol for *E. coli*, *Agrobacterium*, etc.

[0046] When the polynucleotides of this invention are expressed in higher eukaryotic cells, the insertion of an enhancer sequence into the vector will enhance transcription. Enhancers are cis-acting factors of DNA, typically approximately 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0047] Vectors containing appropriate DNA sequences and appropriate promoters or control sequences can be used to transform appropriate host cells so that they can express proteins.

[0048] When constructing transgenic plants using the traditional Agrobacterium-mediated transformation method, the methods for constructing transgenic plants include:

[0049] 1) Provide Agrobacterium carrying an expression vector, said expression vector containing the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence;

[0050] 2) Contact plant cells, tissues, or organs with Agrobacterium in step 1) to transfer the coding sequence into the plant cells and integrate it into the chromosomes of the plant cells;

[0051] 3) Select plant cells or tissues into which the coding sequence has been introduced; and

[0052] 4) Regenerate plants from the plant cells or tissues in step 3).

[0053] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0054] Example

[0055] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0056] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0057] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0058] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0059] The primer synthesis and gene sequencing in this embodiment were commissioned to Shanghai Bioscient Biotechnology Co., Ltd.

[0060] The molecular biology methods and transgenic plant construction methods, including the construction of OsEDS1 and OsPAD4 overexpression recombinant plasmids and gene editing technology, in the embodiments are operated using techniques commonly used in the field.

[0061] Experimental materials include:

[0062] Wild-type rice variety: TP309

[0063] Rice blast fungus (M. oryzae): TH12

[0064] rod1 (preserved in this laboratory)

[0065] SRD8 and SRD10 (screened from rod1 mutagenic materials, preserved in our laboratory)

[0066] Transgenic lines (preserved in this laboratory): ROD1-KO / Kasalath, OsEDS1-KO / rod1, OsEDS1-KO / TP309, OsEDS1-OE / TP309, OsPAD4-KO / rod1, OsPAD4-KO / TP309, OsPAD4-OE / TP309.

[0067] These rice materials preserved in our laboratory, including the recombinant plasmids overexpressing genes OsEDS1 and OsPAD4 in the examples, and the CRISPR / Cas9 plasmids used for gene editing operations, were constructed and preserved by Professor He Zuhua's research group at the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. Any unit or individual may obtain these plasmids to verify the present invention, but they may not be used for other purposes, including development, scientific research, and teaching, without the permission of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences.

[0068] Genome mapping population construction: srd8 and srd10 were crossed with ROD1-KO / Kasalath respectively, and the F2 offspring population was sampled and mapped.

[0069] Some of the PCR primers used in the examples are listed in Table 1.

[0070] Table 1. Some PCR primers used in the examples

[0071]

[0072]

[0073] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0074] Example 1: Map-based cloning of genes OsEDS1 and OsPAD4 in the rice genome

[0075] Researchers in our laboratory conducted large-scale EMS and γ-ray mutagenesis on rod1 seeds, screening out plants with the same phenotype as TP309 and the rod1 genotype. Among them, srd8 and srd10 showed plant morphology similar to wild-type TP309, with plant height restored to that of TP309 and no lesion-like spots appearing on the leaves. Figure 1 A and B in the middle, Figure 5 (A and 5B). DAB staining results indicate that hydrogen peroxide accumulated in rod1 has been restored to wild-type TP309 in srd8 and srd10. Figure 1 C and Figure 5 (C). Furthermore, srd8 and srd10 completely restored rod1-mediated resistance to rice blast. Figure 1 China D and Figure 5 (D). To clone this gene, we knocked out ROD1 in the indica rice variety Kasalath, which we named ROD1-KO. Kasa We crossed this material with srd8 and srd10, respectively, and used the F2 population for gene mapping. First, we screened for SSR molecular markers evenly distributed on the 12 rice chromosomes, identifying 198 primer pairs that differed between the two parents. We selected approximately 20 spotted individuals and 20 unspotted individuals from the F2 population as spotted and unspotted pools for initial mapping. We found that srd8 is located at RM4862 on chromosome 11. All three unspotted pools showed the banding pattern of the parent TP309, while the spotted pools showed a heterozygous banding pattern, indicating linkage of srd8 at this position. Figure 2 (A). Next, we further expanded the target population, using 248 phenotypic individuals to pinpoint the gene range to 406 kb. Figure 2 (B). Combined with genome sequencing results, we found that the second intron of the LOC_Os11g09010 gene underwent a mutation from G to A, resulting in an alteration of the gene's splicing site. Figure 2 (C) srd10 is located at RM1896 on chromosome 9. All three spotless pools showed the banding pattern of the parental TP309, while the spotted pools showed a heterozygous banding pattern, indicating linkage of srd10 at this position. Figure 6 (A). Next, we further expanded the target population, using 366 phenotypic individuals to pinpoint the gene range to 563kb. Figure 6 B). Based on the genome sequencing results, we found that the base at position 2807 bp of the LOC_Os09g22450 gene was mutated from C to T, causing the premature appearance of the stop codon TGA in this gene. Figure 6 (C)

[0076] Example 2: Construction of recombinant plasmids for overexpressing genes OsEDS1 and OsPAD4

[0077] The construction of the OsEDS1 / OsPAD4 gene overexpression vector includes the following steps.

[0078] 1. Amplification of the target sequence

[0079] Using genomic cDNA as a template, OsEDS1 and OsPAD4 were amplified with high-fidelity DNA polymerase KOD FX (TOYOBO, Cat#KFX-101) according to the following PCR system:

[0080]

[0081] Genomic DNA template usage: ~200 ng. Program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 68℃ extension at 1 kb / min, approximately 35 cycles; 68℃ extension for 10 min; 16℃ for 1 min.

[0082] The primers used include:

[0083] pUN1301-EDS1-F: GTCGACTCTAGAGGATCCATGCCGGCGGCGGCGGCGCTG, pUN1301-EDS1-R: GCCCTTGCTCACGGTACCCCAGGGCACAAGTTTCGCGA.

[0084] pUN1301-PAD4-F: GTCGACTCTAGAGGATCCATGGAAGACGCCAGCAGGGG, pUN1301-PAD4-R: GCCCTTGCTCACGGTACCAAATTGAAACAATATTGTCCTA.

[0085] Extraction of total RNA from rice:

[0086] 1) Take plant leaves into a 2mL tube, add steel balls, freeze with liquid nitrogen, and then crush them using a ball mill.

[0087] 2) Add 1 mL of TRIzol (Thermofisher, 15596018) and shake to mix.

[0088] 3) Let stand at room temperature for 5 minutes, then centrifuge at 12,000 rpm at 4°C for 10 minutes.

[0089] 4) Transfer 800 μL of supernatant to a new 1.5 mL centrifuge tube, add 200 μL of chloroform, and vortex to mix.

[0090] 5) Let it stand at room temperature for 10 minutes to allow it to separate into layers, then centrifuge at 12,000 rpm at 4°C for 10 minutes.

[0091] 6) Pipette 400 μL of supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, invert to mix, incubate at room temperature for 10 min, and then centrifuge at 12000 rpm at 4 °C for 10 min.

[0092] 7) Discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 7500 rpm for 5 min and then discard the supernatant.

[0093] 8) After centrifuging for a few seconds, remove the residual liquid and dry at room temperature for 10 minutes.

[0094] 9) Add 20 μL of DEPC-treated water to dissolve the RNA. Store the RNA sample at -80℃.

[0095] RNA reverse transcription:

[0096] Refer to SuperScript TM III. Reverse transcription was performed using the First-Strand Synthesis System (Invitrogen, Cat#18080051) reverse transcription kit, with cDNA template used for gene amplification. The specific steps are as follows:

[0097] 1) Prepare the following system:

[0098]

[0099] 2) After mixing, incubate at 65°C for 5 minutes, then immediately place on ice.

[0100] 3) Add 10 μL of cDNA synthesis reaction solution to the above mixture and mix gently.

[0101]

[0102]

[0103] 4) React at 50℃ for 50 min, then stop the reaction at 85℃ for 5 min, and place on ice.

[0104] 5) Add 1 μL of RNase H and react at 37°C for 20 min.

[0105] 6) Store the cDNA at -20℃.

[0106] 2. Purification of PCR products by agarose gel electrophoresis

[0107] Referring to the instructions for the Hlingene agarose gel DNA recovery kit (Hlingene, NG202S), the simplified steps are as follows:

[0108] 1) Separate PCR products by 1% agarose gel electrophoresis. Under UV light, cut out the target band and place it in a 1.5 mL centrifuge tube. Add 300 μL of sol solution to every 0.1 g of gel. Incubate at 65 °C for 10 min, mixing every 2-3 min until the gel is completely dissolved.

[0109] 2) Transfer the above solution to an adsorption tube, let it stand for 1 minute, then centrifuge at 12000 rpm for 1 minute and discard the waste liquid.

[0110] 3) Add 500 μL of WB rinsing solution (with anhydrous ethanol), centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0111] 4) Repeat step 3).

[0112] 5) After 2 minutes of air-free centrifugation at 12,000 rpm, transfer the adsorption column to a new centrifuge tube.

[0113] 6) Add 50 μL of ddH2O preheated at 65℃ to the adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.

[0114] 3. Homologous recombination of linearized vectors and PCR products

[0115] 1) Vector enzyme digestion

[0116] The pUN1301-GFP plasmid digestion system is as follows:

[0117]

[0118] After gently mixing and briefly centrifuging, incubate in a 37°C water bath for 30-60 minutes.

[0119] 2) Recover the enzyme digestion fragments and determine their concentration, according to... The IIOne Step Cloning Kit (Vazyme, Cat#C112-02) instructions are as follows for performing the recombination reaction (20 μL system as follows):

[0120] Recombination reaction system

[0121]

[0122] Water bath at 37℃ for 30 minutes.

[0123] 4. Escherichia coli competent cell transformation

[0124] 1) Take out the E. coli competent cells Mach1-T1 (Shanghai Weidi Biotechnology Co., Ltd., DL1015M) stored at -80℃ and thaw them on ice.

[0125] 2) Add 1 μL of plasmid or 10 μL of ligation product and place on ice for 30 min.

[0126] 3) Heat shock at 42℃ for 60 seconds, then place on ice for 3 minutes.

[0127] 4) Add 700 μL of liquid LB medium and incubate at 37°C in a shaker for 1 h.

[0128] 5) Spread the mixture onto a screening plate containing the corresponding antibiotic and incubate overnight.

[0129] 5. Plasmid extraction

[0130] Small-scale plasmid extraction:

[0131] Referring to the instructions for the Hlingene plasmid small-scale rapid extraction kit (Hlingene, HDP201-01), the simplified steps are as follows:

[0132] 1) Collect 2 ml of bacteria in a centrifuge tube and centrifuge at 12000 rpm for 1 min.

[0133] 2) Add 250 μL of S1 solution (with RNase A) and mix thoroughly.

[0134] 3) Add 250 μL of S2 solution and gently invert the container 5-6 times to mix. At this point, the solution will become viscous and clear.

[0135] 4) Add 350 μL of S3 solution and immediately invert to mix.

[0136] 5) Centrifuge at 12000 rpm for 10 min, and transfer the supernatant to an adsorption tube.

[0137] 6) Centrifuge at 12000 rpm for 30 seconds to 1 minute, then discard the waste liquid.

[0138] 7) Add 500 μL of WB washing solution (with anhydrous ethanol), centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0139] 8) Repeat step 7).

[0140] 9) After 2 minutes of air-free centrifugation at 12000 rpm, transfer the adsorption column to a new centrifuge tube.

[0141] 10) Add 60 μL of ddH2O preheated at 65 °C to the adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.

[0142] The map of the recombinant plasmid pUN1301-OsEDS1-eGFP constructed is as follows: Figure 9 As shown in Figure A.

[0143] The map of the recombinant plasmid pUN1301-OsPAD4-eGFP constructed is as follows: Figure 9 As shown in B.

[0144] The functions of genes OsEDS1 and OsPAD4 are verified or characterized in the following examples.

[0145] Example 3: Inoculation with rice blast fungus

[0146] The rice blast fungus was activated by inoculating races onto CM medium and incubating at 28°C (12h light / 12h dark) for 10–12 days. The medium was then rinsed with 0.05% Tween 20 sterile water, and the spore suspension was collected using a glass rod. After filtration through a 40μm filter membrane, the spore concentration was measured under a microscope and finally adjusted to 1×10⁻⁶. 5 Spores / mL are used for inoculation. Approximately 4 weeks after rice transplanting, insert a syringe about 2 cm below the ligule of newly emerging leaves and inject the spore solution until it overflows from the tip of the new leaf. Disease symptoms can be observed 7 days after rice blast inoculation.

[0147] CM culture medium

[0148]

[0149] Adjust the pH to 6.5 with 10M NaOH, and add ddH2O to bring the total volume to 1L. Add 17.5g of agar powder per liter of culture medium.

[0150] 1000×Trace elements (100mL)

[0151]

[0152]

[0153] 1000×Vitamin solution (100mL)

[0154]

[0155] Methods for statistical analysis of rice blast growth:

[0156] A certain amount of rice leaves infected with rice blast were crushed using liquid nitrogen. 400 μL of extraction buffer (50 mM Tris-Cl, pH 7.5; 20 mM EDTA Na2, pH 8.0; 2% Sarcosine; 0.5% SDS; 5 M Urea, 5% Phenol, 0.3 M NaCl) was added and vortexed to mix. 400 μL of a 25:24:1 solution of phenol / chloroform / isoamyl alcohol was added, and the mixture was vigorously vortexed for 10 min. After centrifugation at 14000 rpm for 10 min, the supernatant was transferred to a new 1.5 mL EP tube. An equal volume of isopropanol was added, and the mixture was precipitated at -20 °C for 10 min. After centrifugation at 14000 rpm for 10 min, the supernatant was discarded. The precipitate was washed with 1 mL of 75% ethanol at 7500 rpm for 5 min, the supernatant was removed, and the mixture was dried at room temperature. 40 μL of ddH2O (containing 10 μg / mL RNase) was added to dissolve the precipitate. The relative content of rice blast fungus DNA was detected using the Real-time PCR method.

[0157] Example 4: Transformation of mature rice embryo callus

[0158] 4.1 Induction of callus in mature rice embryos

[0159] 1. Use a threshing machine to remove the husks from the rice seeds, discarding any moldy or deformed seeds.

[0160] 2. Add a small amount of 75% ethanol, shake by hand for about 30 seconds, and rinse once with sterile water.

[0161] 3. Add 25-30% (v / v) NaClO and shake on a shaker at 200 rpm for 30 minutes.

[0162] 4. Rinse with sterile water 5-6 times, and once in between, place it in a shaker and shake for 10 minutes.

[0163] 5. Place the seeds on sterile filter paper to absorb the moisture on the seed surface, and then sow the seeds on NBD medium to induce callus.

[0164] 6. After culturing in the dark for about 14 days, remove the endosperm, plumule, and radicle. The resulting callus can be used for transgenic or subculture. Subculture is performed every two weeks, and the number of subcultures depends on the state of the callus.

[0165] NBD rice screening medium (1L): NB Basal Medium (PhytoTech) 4.1g, sucrose 30g, glutamine 0.5g, proline 0.5g, hydrolyzed casein 0.5g, 1mL 2,4-D solution (1mg / mL), pH 5.8, solids require 4.5g / L Phytagel.

[0166] 4.2 Preparation of Agrobacterium-mediated transformation culture

[0167] 1. Transform the constructed plasmid into EHA105 competent cells and incubate at 28°C for two days.

[0168] 2. Select a single clone and place it in 5 mL of LB liquid medium containing the corresponding antibiotic for culture. Incubate at 28°C with shaking for 48 h.

[0169] 3. Take 1 mL of the overnight culture and transfer it to 15 mL of AB (20 mg / L Rif + 50 mg / L Kan + 100 mg / LAS) liquid medium. Incubate at 28°C until OD600 = 0.5 (about 4 hours).

[0170] AB liquid culture medium (1L): KH2PO4 3g, NaH2PO4 1g, NH4Cl 1g, MgSO4·7H2O

[0171] 300mg, KCl 150mg, CaCl2 10mg, FeSO4·7H2O 2.5mg, Glucose 5g.

[0172] 4.3 Co-culture of rice callus and bacterial solution

[0173] 1. Centrifuge the bacterial culture at 5000 rpm for 10 min and discard the supernatant.

[0174] 2. Resuspend the bacterial cells in AAM containing 100 mg / L AS until the bacterial solution has an OD600 of 0.4-0.6.

[0175] 3. Co-culture the bacterial solution with rice callus tissue for 20 minutes.

[0176] 4. Blot dry the bacterial culture, pick up the callus tissue and place it on NBD solid culture medium (with 100 mg / L AS) lined with sterile filter paper. Add 1 mL of AAM (with 100 mg / L AS) culture medium to each dish to thoroughly moisten the sterile filter paper. Incubate for 2-3 days.

[0177] 4.4 Screening

[0178] Blot the callus tissue dry with sterile filter paper and transfer it to a selection medium containing hygromycin to screen for resistant callus. Change the medium every two weeks.

[0179] Screening medium:

[0180] S1: 100 mg / L carboxybenzyl + 30 mg / L Hyg

[0181] S2: 100 mg / L carboxybenzyl + 40 mg / L Hyg

[0182] S3: 100 mg / L carboxybenzyl + 50 mg / L Hyg

[0183] 4.5 Differentiation

[0184] Selected rice callus tissues were transferred to rice differentiation medium and cultured under light. The medium was changed every two weeks until the callus differentiated into seedlings.

[0185] MS rice differentiation medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 4.43g, sucrose 30g, 6-BA 3mg / L, NAA 0.5mg / L, pH 6.3, solids require the addition of 4.5g / L Phytagel.

[0186] 4.6 Rooting

[0187] Transfer the seedlings from the differentiation medium to the rooting medium. After about 2 weeks of growth, remove the seedlings, wash off the agar medium, and culture them in water for 7 days before transplanting them into the soil.

[0188] 1 / 2MS rice rooting medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 2.165g, sucrose 20g, pH 6.3, solids require the addition of 4.5g / L Phytagel.

[0189] Example 5: DAB staining for H2O2 accumulation detection

[0190] 1. Take rice leaves and immerse them in DAB staining solution. Vacuuming can be used to ensure that the leaves are completely immersed in the DAB staining solution.

[0191] 2. Reaction under light at room temperature for 8-12 hours.

[0192] 3. After the reaction is complete, remove the leaves and immerse them in a 95% ethanol solution for decolorization in a boiling water bath for 10 minutes. Decolorize in the 95% ethanol solution for at least 4 hours until decolorization is complete.

[0193] 4. Observe whether brown spots appear on the leaves (the polymer formed by the reaction of DAB and H2O2 is brown).

[0194] DAB staining solution

[0195]

[0196] Results and Discussion

[0197] Our laboratory isolated and identified a genetically stable natural line, rod1, from breeding materials, derived from a natural variation of the japonica rice variety TP309. rod1 exhibits strong resistance to the three major rice diseases: rice blast, bacterial blight, and sheath blight. Studies have shown that ROD1 encodes a calcium-dependent phospholipid-binding protein. ROD1 promotes H2O2 degradation by activating the catalase CatB, and its stability can be finely regulated by a pair of E3 ubiquitin ligases, RIP1 and APIP6. The fungal effector Avrpiz-t structurally mimics ROD1 and activates the same ROS scavenging cascade to suppress host immunity and promote virulence. To further investigate the role of ROD1, a key regulator of broad-spectrum disease resistance in rice, in the disease resistance signaling pathway, we screened rod1 repressor lines to refine the ROD1 disease resistance signaling pathway.

[0198] We found that the repressor srd8 completely restored the autoimmune phenotype and disease resistance of rod1. Figure 1 By locating the SRD8 gene through map-based cloning and genome sequencing, we identified a gene homologous to the Arabidopsis PAD4 family, which we named OsPAD4. Figure 2 We identified OsPAD4 as the functional gene through genetic complementation experiments. Figure 3 We inoculated OsPAD4 overexpressing lines with rice blast race TH12 and found that, compared with wild-type TP309, the OsPAD4 overexpressing lines showed significantly enhanced resistance, with no lesions appearing on the leaves. Figure 4 ).

[0199] The repressor srd10 completely restored the autoimmune phenotype and disease resistance of rod1. Figure 5 By locating the SRD10 gene through map-based cloning and genome sequencing, we identified a gene homologous to the Arabidopsis EDS1 family, which we named OsEDS1. Figure 6 We identified OsEDS1 as the functional gene through genetic complementation experiments. Figure 7 We found that OsEDS1 overexpressing lines exhibited significantly enhanced resistance to rice blast race TH12 after inoculation with the wild-type TP309. Figure 8 This will provide new ideas for breeding new disease-resistant rice varieties.

[0200] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

[0201] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.

Claims

1. The use of genes OsEDS1 and OsPAD4 in improving plant disease resistance.

2. The use as described in claim 1, characterized in that, The disease resistance mentioned refers to resistance to plant diseases caused by the rice blast fungus (Magnaporthe oryzae).

3. The use as described in claim 2, characterized in that, The rice blast fungus is TH12.

4. The use as described in claim 2, characterized in that, The plants are grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum.

5. The use as described in claim 4, characterized in that, The crop in question is rice, and the plant disease in question is rice blast.

6. The use as described in claim 1, characterized in that, The genes OsEDS1 and OsPAD4 can be used for phytoremediation, improving plant disease resistance, or breeding disease-resistant plant varieties.

7. The use as described in claim 6, characterized in that, Plant repair, disease resistance enhancement, or the cultivation of disease-resistant plant varieties can be achieved by overexpressing the genes OsEDS1 and / or OsPAD4 in plants.

8. The use as described in claim 7, characterized in that, Overexpress the genes OsEDS1 and / or OsPAD4 in plants using the following methods: A. Cloning the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the genes OsEDS1 and / or OsPAD4; and / or B. By cloning the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence into a plant chromosome using gene editing technology, obtaining transgenic plants that overexpress the gene OsEDS1 or its coding region sequence and / or OsPAD4 or its coding region sequence; and / or C. Place the existing genes OsEDS1 and / or OsPAD4 in the plant genome under the regulation of a functionally enhanced promoter.

9. The use as described in claim 8, characterized in that, The plasmid vectors mentioned in step A are selected from the following group: pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, pTF102; The Agrobacterium species are selected from the following group: Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101.

10. The use as described in any one of claims 6-9, characterized in that, The plant in question is either rice TP309 or ZH11.

Images