Application of wAP2 protein and related biological materials thereof in regulation and control of plant disease resistance

By overexpressing wAP2 protein and related biological materials, the problem of increased chemical reagent usage was solved, and effective resistance regulation to wheat stripe rust was achieved, demonstrating the application potential of wAP2 protein in the breeding of disease-resistant varieties.

CN121915099APending Publication Date: 2026-04-24CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-10-24
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Current technologies for controlling wheat stripe rust increase the use of chemical agents, threatening environmental safety. Furthermore, methods for breeding disease-resistant varieties have not fully utilized the potential of disease-resistant genes, necessitating new methods for regulating plant disease resistance.

Method used

By utilizing the wAP2 protein and related biological materials, plant disease resistance can be regulated through overexpression of the wAP2 protein or nucleic acid molecules, especially to improve wheat resistance to stripe rust. This includes using fusion proteins with similar or identical amino acid sequences, recombinant vectors, and recombinant microorganisms.

Benefits of technology

It improved the plant's disease resistance, especially to stripe rust, and reduced the number of stripe rust spores, demonstrating the potential of wAP2 protein in breeding disease-resistant wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005100221610000011
    Figure HDA0005100221610000011
Patent Text Reader

Abstract

The invention discloses application of wAP2 protein and related biological materials thereof in regulation and control of plant disease resistance. WAP2 is over-expressed in wild type wheat Kronos to obtain wAP2-converted wheat, and after a stripe rust inoculation experiment is carried out on the wAP2-converted wheat, it is found that the over-expression of the wAP2 can improve the stripe rust resistance of the wheat. It is found for the first time that the wAP2 protein and related biological materials thereof can regulate and control the disease resistance of wheat, and the wAP2 protein and the related biological materials can play an important role in breeding disease-resistant wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of wAP2 protein and related biomaterials in regulating plant disease resistance. Background Technology

[0002] Wheat stripe rust is a typical long-range airborne disease that spreads rapidly with the wind. Currently, my country mainly employs an integrated control strategy combining chemical pesticides, the breeding of resistant varieties, and field management measures to control wheat stripe rust. Chemical pesticides play a crucial role in agricultural production as an effective means of controlling crop diseases and pests, but their usage and intensity are increasing year by year. Excessive pesticide use seriously threatens human health and ecological safety. In contrast, breeding and promoting stripe rust-resistant wheat varieties is the preferred control measure for green agriculture, as it is not only economical and effective but also more environmentally friendly. Currently, many disease-resistance genes have been applied to wheat varieties, playing a significant role in improving their traits. Therefore, research on wheat resistance genes is of great importance for the genetic improvement of wheat. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate plant disease resistance.

[0004] To address the aforementioned technical problems, this invention first provides a novel use for the wAP2 protein.

[0005] This invention provides the use of the wAP2 protein in any of the following A1)-A3):

[0006] A1) Regulates plant disease resistance;

[0007] A2) Develop transgenic plants with enhanced disease resistance;

[0008] A3) Plant breeding;

[0009] The wAP2 protein is any one of the following B1)-B4):

[0010] B1) The amino acid sequence of the protein is shown in sequence 2;

[0011] B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2;

[0012] B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2.

[0013] B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

[0014] In the protein described in B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag includes, but is not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0015] In one specific embodiment of the present invention, the tag is a Myc-tagged protein. The amino acid sequence of the fusion protein is shown in Sequence 3, wherein positions 1-116 of Sequence 3 are the amino acid sequence of the Myc tag, and positions 117-434 are the amino acid sequence of the wAP2 protein.

[0016] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0017] In the protein described in B4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences, the identity value (%) can be obtained. The identity includes amino acid sequences that have 80% or higher homology with the amino acid sequence shown in Sequence 2 of this invention, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher.

[0018] The proteins described in B1)-B4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0019] To address the aforementioned technical problems, this invention also provides new uses for biomaterials related to the wAP2 protein.

[0020] This invention provides the application of biomaterials related to the above-mentioned wAP2 protein in any of the following A1)-A3):

[0021] A1) Regulates plant disease resistance;

[0022] A2) Develop transgenic plants with enhanced disease resistance;

[0023] A3) Plant breeding;

[0024] The biological material is a nucleic acid molecule encoding the above-mentioned wAP2 protein or an expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule;

[0025] In the above applications, the nucleic acid molecule is any one of the following:

[0026] F1) The DNA molecule shown in sequence 1;

[0027] The nucleotide sequences defined by F2 and F1 have 75% or more identity and encode the DNA molecule of the wAP2 protein.

[0028] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0029] Those skilled in the art can readily mutate the nucleotide sequence encoding the wAP2 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence encoding the wAP2 protein, provided they encode the wAP2 protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0030] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0031] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0032] In the above applications, the expression cassette refers to DNA capable of expressing the wAP2 protein in host cells. This DNA may include not only promoters that initiate wAP2 transcription but also terminators that terminate wAP2 transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator.

[0033] In the above applications, the vector refers to a vector capable of carrying the above nucleic acid molecules into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage, etc.), granules (i.e., Cos plasmids), Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.).

[0034] The recombinant vector refers to a recombinant DNA molecule constructed by linking the aforementioned nucleic acid molecule to the vector in vitro. Recombinant vectors containing the wAP2 gene expression cassette can be constructed using existing plant expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. The plant expression vector may also contain the 3′ untranslated region of the exogenous gene, i.e., containing the polyadenylated signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3′ end of the mRNA precursor. Similar functions exist in the untranslated regions transcribed at the 3′ end of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nosine synthase gene) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signal and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed. This can involve adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic marker genes (such as the nptII gene for resistance to kanamycin and related antibiotics, the bar gene for resistance to the herbicide phosphinic acid, the hph gene for resistance to the antibiotic hygromycin, the dhfr gene for resistance to methotrexate, and the EPSPS gene for resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0035] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Specifically, the bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0036] The recombinant microorganisms refer to those obtained by manipulating and modifying the genes of a target microorganism, resulting in a functional change. For example, recombinant microorganisms obtained after introducing the aforementioned recombinant vector into the target microorganism. The term "recombinant microorganism" can be understood not only to a specific recombinant microorganism but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the offspring may not necessarily be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms.

[0037] In the above application, regulating plant disease resistance means enhancing plant disease resistance. This enhancement is manifested in the fact that plant disease resistance increases when the content and / or activity of the wAP2 protein in the plant increases.

[0038] Furthermore, the improvement of plant disease resistance refers to improving plant resistance to stripe rust.

[0039] Furthermore, the improvement in plant resistance to stripe rust is specifically manifested in the following way: when the expression level of the wAP2 gene in plants is increased, the number of stripe rust spores (number of spore masses per unit area) after the plant is inoculated with stripe rust fungus decreases.

[0040] In the above applications, the purpose of plant breeding is to cultivate disease-resistant plant varieties (such as stripe rust-resistant plant varieties).

[0041] To address the aforementioned technical problems, the present invention ultimately provides a method for cultivating transgenic plants with enhanced disease resistance.

[0042] The method for cultivating transgenic plants with enhanced disease resistance provided by the present invention includes the following steps: increasing the content and / or activity of the above-mentioned wAP2 protein in the target plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the target plant.

[0043] In the above method, the disease resistance refers to stripe rust resistance.

[0044] Furthermore, the higher disease resistance of the transgenic plant compared to the target plant is reflected in the fact that the number of stripe rust spores (number of spore masses per unit area) in the transgenic plant after inoculation with stripe rust fungus is lower than that in the target plant.

[0045] Furthermore, the stripe rust pathogen is stripe rust pathogen CYR32.

[0046] In the above method, the method for increasing the content and / or activity of the wAP2 protein in the target plant is to overexpress the wAP2 protein in the target plant.

[0047] Furthermore, the overexpression method involves introducing the gene encoding the wAP2 protein into the target plant.

[0048] Furthermore, the nucleotide sequence of the gene encoding the wAP2 protein is shown in Sequence 1.

[0049] In any of the above applications or methods, the transgenic plant is understood to include not only the first-generation transgenic plant obtained by transforming the wAP2 gene into a recipient plant, but also its progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plant includes seeds, callus tissue, intact plants, and cells.

[0050] In any of the above applications or methods, the stripe rust may be stripe rust caused by the stripe rust fungus CYR32.

[0051] In any of the above applications or methods, the plant may be a monocotyledonous plant or a dicotyledonous plant.

[0052] Furthermore, the monocotyledonous plant may be a grass family (Poaceae).

[0053] Furthermore, the grasses mentioned may be plants of the genus Triticum.

[0054] Furthermore, the wheat species mentioned may be wheat.

[0055] In an embodiment of the present invention, the wheat is wild-type wheat, Kronos.

[0056] This invention obtains wAP2 transgenic wheat by overexpressing wAP2 in wild-type wheat Kronos. Through stripe rust inoculation experiments on the transgenic wAP2 wheat, it was found that overexpression of wAP2 can improve wheat resistance to stripe rust. This invention is the first to discover that the wAP2 protein and related biological materials can regulate wheat disease resistance, and will play an important role in the breeding of disease-resistant wheat varieties. Attached Figure Description

[0057] Figure 1 The effect of overexpression of wAP2 on resistance to wheat stripe rust was investigated. A represents the expression level of wAP2 in wild-type wheat Kronos and T0 generation transgenic plants. B represents the phenotype of wAP2 transgenic wheat and wild-type wheat Kronos 14 days after inoculation with stripe rust. C represents the microcolony index statistics of wAP2 transgenic wheat and wild-type wheat Kronos after inoculation with stripe rust. The P-value in the figure indicates the significance level. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0059] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0060] The Escherichia coli strain DH5α and Agrobacterium strain GV3101 in the following examples are both products of Shanghai Weidi Biotechnology Co., Ltd.

[0061] The wild-type wheat Kronos described in the following examples is described in the literature "Krasileva, KV, et al. (2017). Uncovering hidden variation in polyploid wheat. Proceedings of the National Academy of Sciences 114(6):E913-E921."

[0062] The stripe rust fungus CYR32 in the following examples is described in the literature "Yan, Y., et al. (2023). Phosphorylation of KAT-2B by WKS1 / Yr36 redirects the lipid flux to jasmonates to enhance resistance against wheat stripe rust. Journal of Genetics and Genomics 50:872-882."

[0063] The amino acid sequence of the wAP2 protein in Example 1 below is shown in Sequence 2 of the sequence listing, and its encoding gene sequence is shown in Sequence 1 of the sequence listing.

[0064] Example 1: Obtaining wAP2 transgenic wheat and detecting its resistance

[0065] I. Obtaining WAP2 wheat

[0066] 1. Construction of the recombinant vector pGWB18-Ubi::Myc-wAP2

[0067] The wAP2 cDNA sequence shown in Sequence 1 was ligated into the pDONR / zeo vector (Invitrogen, Cat. No. 12535035) using the Gateway method to obtain the recombinant vector pDONR / zeo-wAP2, which was then sequenced for verification. Sequencing results showed that the wAP2 gene did not contain any point mutations.

[0068] The recombinant vector pDONR / zeo-wAP2 and vector Pro were used. Ubi ::Myc-AttR-T NOS (Pro Ubi ::Myc-AttR-T NOS The nucleotide sequence of the DNA molecule (composed of the DNA molecule shown in Sequence 4 and the DNA molecule shown in Sequence 5) was mixed with recombinase (Invitrogen, Cat. No. 11791) and reacted at 25°C for 1 hour to recombine the cDNA sequence shown in Sequence 1 into the vector Pro. Ubi ::Myc-AttR-T NOS Between the attR1 site (acaagtttgtacaaaaaagc) and the attR2 site (tttcttgtacaaagtgg), the recombinant vector pGWB18-Ubi::Myc-wAP2 was obtained. The recombinant vector pGWB18-Ubi::Myc-wAP2 expresses the wAP2 protein tagged with Myc.

[0069] 2. Obtaining recombinant bacteria

[0070] The recombinant vector pGWB18-Ubi::Myc-wAP2 was transformed into Agrobacterium EHA105 (Weidi Biotechnology, Cat.No.AC1010) to obtain the recombinant strain pGWB18-Ubi::Myc-wAP2 / EHA105.

[0071] 3. Obtaining WAP2 wheat

[0072] Wild-type wheat Kronos with good growth status was selected as the recipient. Immature embryos about 15 days after pollination were subjected to Agrobacterium pGWB18-Ubi::Myc-wAP2 / EHA105-mediated genetic transformation to obtain the wAP2 wheat line.

[0073] 4. Detection of expression levels at the transcriptional level

[0074] RNA was extracted from the wAP2 transgenic wheat material and wild-type wheat Kronos, and cDNA was obtained using a reverse transcription kit (YEASEN, Cat. No. 11141ES60). Then, using the cDNA as a template, real-time quantitative PCR was performed using primers wAP2-qRT-F and wAP2-qRT-R. The primer sequences are as follows:

[0075] wAP2-qRT-F: 5'-CATCACGCCTGGAGTGCTATGC-3';

[0076] wAP2-qRT-R: 5'-TGACATCTACCTCTCGCCACACC-3'.

[0077] The results are as follows Figure 1 As shown in Figure A, the results indicate that the expression level of wAP2 was significantly increased in the wAP2 transgenic wheat lines 3# and 4# compared to the wild-type wheat Kronos. The wAP2 transgenic wheat lines 3# and 4# were selected for the following disease resistance analysis experiments.

[0078] II. Disease Resistance Analysis of WAP2 Transgenic Wheat

[0079] Test materials: wild-type wheat Kronos, T2 generation transgenic wAP2 wheat lines 3 and 4.

[0080] Experimental method: Wheat seeds were placed in petri dishes for hydroponics to ensure uniform germination. After germination, the wheat seeds were cultured in a light incubator with a photoperiod of 16 hours of light / 8 hours of darkness at a temperature of 20°C. When the wheat seedlings reached the two-leaf-one-heart stage, they were inoculated with stripe rust fungus CYR32 spores, and the incidence of stripe rust was detected after inoculation. The above-mentioned stripe rust fungus inoculation and stripe rust disease detection steps were in accordance with the method in the literature "Wang, S., et al. (2019). YR36 / WKS1-mediated phosphorylation of PsbO, an extrinsic member of photosystem II, inhibits photosynthesis and confers stripe rust resistance in wheat. Molecular plant 12(12):1639-1650.", specifically including the following steps: First, use a pin to dip an appropriate amount of fresh stripe rust spores and gently apply them to the middle position (about 5 cm) of the second leaf, applying them back and forth several times to ensure that the spores are evenly distributed throughout the inoculation area. After inoculation, the plants were incubated in the dark at 16℃ for 24 hours, followed by continued incubation at 16℃ with a 16-hour light / 8-hour dark light cycle. Fourteen days after inoculation, healthy wheat plants were selected, and leaves from the inoculated areas were cut off and scanned. The scanned wheat leaves were used to identify the development of stripe rust colonies, and the spore density (i.e., the number of spores per unit area) was calculated based on the ratio of the number of spore masses that developed microcolonies to the tested leaf area.

[0081] The results are as follows Figure 1 B and Figure 1As shown in Figure C, the results indicate that compared with the wild-type wheat Kronos control, the stripe rust disease of the wAP2 wheat transgenic wheat was less severe, and the number of spore masses per unit leaf area was significantly reduced. Specifically, the average number of spore masses per unit area of ​​wild-type wheat Kronos and T2 generation wAP2 wheat lines 3# and 4# were 388±20, 198±61, and 199±20, respectively.

[0082] The results in summary indicate that overexpression of wAP2 can improve resistance to wheat stripe rust.

[0083] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of wAP2 protein in any of the following A1)-A3): A1) Regulates plant disease resistance; A2) Develop transgenic plants with enhanced disease resistance; A3) Plant breeding; The wAP2 protein is any one of the following B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

2. Application of wAP2 protein-related biomaterials in any of the following A1)-A3): A1) Regulates plant disease resistance; A2) Develop transgenic plants with enhanced disease resistance; A3) Plant breeding; The biological material is a nucleic acid molecule encoding the wAP2 protein or an expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule; The wAP2 protein is any one of the following B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

3. The application according to claim 2, characterized in that: The nucleic acid molecule is any one of the following: F1) The DNA molecule shown in sequence 1; The nucleotide sequences defined by F2 and F1 have 75% or more identity and encode the DNA molecule of the wAP2 protein.

4. The application according to any one of claims 1-3, characterized in that: The regulation of plant disease resistance aims to improve plant disease resistance.

5. The application according to any one of claims 1-4, characterized in that: The disease resistance mentioned refers to resistance to stripe rust.

6. A method for cultivating transgenic plants with enhanced disease resistance, comprising the following steps: increasing the content and / or activity of wAP2 protein in a target plant to obtain a transgenic plant; wherein the transgenic plant has higher disease resistance than the target plant.

7. The method according to claim 6, characterized in that: The disease resistance mentioned refers to resistance to stripe rust.

8. The method according to claim 6 or 7, characterized in that: The method for increasing the content and / or activity of wAP2 protein in the target plant is to overexpress wAP2 protein in the target plant.

9. The method according to claims 6-8, characterized in that: The overexpression method involves introducing the gene encoding the wAP2 protein into the target plant; Alternatively, the nucleotide sequence of the gene encoding the wAP2 protein is shown in Sequence 1.

10. The application according to any one of claims 1-5 or the method according to any one of claims 6-9, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant.