Application of arbutin in improving resistance of wheat to airborne diseases
By spraying arbutin on wheat, the expression of resistance genes and the accumulation of callose in wheat are enhanced, solving the problem of chemical resistance to wheat rust and powdery mildew and achieving effective control of airborne diseases.
Patent Information
- Application Number
- CN202610015289.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-07
- Publication Date
- 2026-04-28
AI Technical Summary
Existing chemical control agents for wheat rust and powdery mildew are prone to causing resistance, and the breeding cycle for resistant varieties is long, making it difficult to continuously and effectively control airborne diseases in wheat.
Applying arbutin to wheat plants enhances callose accumulation, increases the expression of resistance genes TaPR1, TaPR2, and TaPR5, and inhibits pathogen growth and colony formation.
It significantly enhances wheat's resistance to leaf rust, stripe rust, and powdery mildew, reduces disease severity, promotes the expression of disease resistance-related genes, and inhibits pathogen growth and colony formation.
Smart Images

Figure CN121926201A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological control technology, specifically relating to the application of arbutin in improving wheat resistance to airborne diseases. Background Technology
[0002] Wheat is an important food crop. Wheat rust and powdery mildew are airborne fungal diseases that are widely distributed, spread rapidly, and damage large areas of wheat production in China. Currently, discovering disease-resistant genes and breeding disease-resistant varieties are the main methods for controlling airborne wheat diseases. However, the breeding cycle for disease-resistant varieties is long and labor-intensive, and resistance can easily be lost due to changes in dominant races. Chemical control, on the other hand, is fast-acting and has low labor costs, making it an indispensable emergency measure for controlling wheat rust.
[0003] Currently registered pesticides for controlling wheat rust and powdery mildew mainly contain triadimefon, tebuconazole, flutriafol, prothioconazole, pyrimidine nucleoside antibiotics, and Bacillus subtilis. Triazole fungicides are currently the most widely used fungicides for rust control. Their mechanism of action is to inhibit the ergosterol biosynthesis pathway in fungi, exhibiting high activity against higher fungi. However, the limited variety of pesticides hinders pesticide rotation and delays resistance development. Wheat rust and powdery mildew fungi have developed varying degrees of resistance to triazole fungicides. Compared to traditional chemical control agents, plant-derived metabolites are less likely to induce resistance and pose no pesticide residue safety risks. However, the variety of biological pesticides is limited. Therefore, exploring endogenous metabolites, finding new active ingredients, and enriching control strategies and mechanisms of action are of great value in controlling wheat rust. Summary of the Invention
[0004] To solve the above-mentioned technical problems, this invention provides the application of arbutin in improving wheat's resistance to airborne diseases, and arbutin for the prevention and control of wheat stripe rust, leaf rust and powdery mildew.
[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solution: the application of arbutin in improving the resistance of wheat to airborne diseases, specifically the application of arbutin in improving the resistance of wheat to stripe rust, leaf rust, and powdery mildew.
[0006] Furthermore, arbutin enhances the accumulation of callose in wheat, thereby increasing wheat's resistance to airborne diseases.
[0007] Furthermore, arbutin enhances resistance genes. TaPR1, TaPR2, TaPR5 Increase the expression level of [the substance] to improve wheat's resistance to airborne diseases.
[0008] Arbutin, when sprayed onto wheat plants at a concentration of 1-20 mM, helps prevent wheat rust and powdery mildew.
[0009] The arbutin was sprayed on wheat leaves at a concentration of 1-20 mM, with a spraying volume of 10 mL of arbutin solution for every 50 wheat plants. When leaf rust fungus infected susceptible wheat varieties, the release of reactive oxygen species was enhanced, mycelial development and colony formation were inhibited, and the wheat's disease resistance was enhanced.
[0010] The arbutin referred to in this invention has the English name arbutin and the chemical formula C. 12 H 16 O7, CAS number 497-76-7, molecular weight 272.25, chemical name 4-hydroxyphenyl-β-D-glucopyranoside. Arbutin is a hydroquinone glucoside found in pears, bearberry leaves, and various other plants. It belongs to the flavonoid class of compounds and possesses antioxidant, anti-inflammatory, and anticancer effects. It has wide applications in the pharmaceutical and cosmetic industries.
[0011] The results of this invention show that arbutin can significantly enhance wheat's resistance to leaf rust, stripe rust, and powdery mildew. Real-time quantitative PCR revealed that after exogenous application of arbutin, the expression levels of disease defense response genes in wheat significantly increased, indicating that arbutin is a potential metabolite that enhances wheat immunity and can be used to control wheat rust and powdery mildew. Attached Figure Description
[0012] Figure 1 Phenotypic and severity statistics of wheat leaves treated with different concentrations of arbutin and inoculated with wheat leaf rust 12 days later; Figure A shows the wheat leaf phenotype; Figure B shows the severity statistics. Figure 2 The phenotypes and uredinia of wheat stripe rust and powdery mildew after treatment of wheat leaves with 20mM arbutin were statistically analyzed. In the figure: A and B are the phenotypes and statistical results of wheat leaves with stripe rust, respectively; C and D are the phenotypes and statistical results of wheat leaves with powdery mildew, respectively. Figure 3 The figure shows the number of callose deposits in wheat leaves after treatment with 20 mM arbutin. In the figure: A shows the callose deposition of wheat leaves after treatment with aniline blue staining and statistical analysis using fluorescence microscopy, scale bar = 1000 μm; B shows the statistical data of callose deposition. Figure 4 Plant pathogenesis-related protein genes were identified after wheat leaves were treated with 20 mM arbutin at 3, 6, 9, 12, and 24 hours. TaPR1 , TaPR2 and TaPR5 The relative expression levels; A and C in the figure represent the expression levels of the two groups, respectively. PR1 , PR2 , PR5 The relative expression level of genes; Figure 5Wheat leaves were treated with 20 mM arbutin and then inoculated with wheat leaf rust fungus. In the figure: A and B are microscopic images and statistical data of H2O2 accumulation 48 hours after inoculation with wheat leaf rust fungus; C and D are images and statistical data of mycelial colony area 72 hours after inoculation with wheat leaf rust fungus; E and F are statistical data of colony morphology and colony area 120 hours after inoculation with wheat leaf rust fungus; CK is the control group, Arb is the group treated with 20 mM arbutin, S is spore, GT is germ tube, AP is appressorium, SV is hypostomatal sac, IH is infecting hyphae, and H is haustorium. Detailed Implementation
[0013] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and all materials publicly cited herein and cited by them are incorporated herein by reference.
[0015] Equivalent technologies of the specific embodiments described herein that are readily apparent to those skilled in the art through routine experimentation are included in this application.
[0016] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0017] I. Experimental materials: Arbutin, purchased from Aladdin, CAS number 497-76-7, product number A106856, dissolved in water before use.
[0018] Wheat material: Mingxian 169 (MX169) is highly susceptible to various physiological races of rust fungus and powdery mildew.
[0019] Pathogens: Physiological races THTT of leaf rust, CYR34 of stripe rust, and E09 of powdery mildew. Spores were added to sterile water to prepare spore suspensions for later use.
[0020] II. Experimental Methods 1. Wheat plants with uniform growth at the one-leaf-one-heart stage were selected and divided into two groups. The first group was sprayed with 1, 2, 5, 10, and 20 mM arbutin, respectively, with a spray volume of 10 mL solution per 50 wheat plants. The second group served as a blank control group, which was sprayed with water, with a spray volume of 10 mL solution per 50 wheat plants. Twelve hours after spraying, wheat leaf rust was inoculated using 3 mg of urediniospores mixed with 10 mL of 0.1% Tween-80 spore suspension. Phenotypic development and disease severity were observed 12 days after inoculation. The experimental results are shown in Table 1.
[0021] Table 1: Disease severity 12 days after inoculation with leaf rust fungus following treatment with different concentrations of arbutin Wheat plants with uniform growth at the one-leaf-one-heart stage were selected. The control group was sprayed with water, while the treatment group was sprayed with 20mM arbutin, with 10mL of solution applied to 50 wheat plants. Twelve hours after spraying, wheat stripe rust or wheat powdery mildew was inoculated. The inoculation amount was the same as for leaf rust. The powdery mildew phenotype was observed 7 days after inoculation, and the lesion area was recorded. The stripe rust phenotype was observed 14 days after inoculation, and the lesion area was recorded. The experimental results are shown in Table 2.
[0022] Table 2: Lesion area after inoculation with stripe rust and powdery mildew in the treatment and control groups. 2. Wheat leaf callose accumulation experiment: The control group was sprayed with water, while the treatment group was treated with 20 mM arbutin by foliar spraying. Twelve hours later, wheat callose was stained with aniline blue, and callose deposition was observed using a fluorescence microscope. The number of callose deposits per unit area was counted. The experimental results are shown in Table 3.
[0023] Table 3: Per 1.52mm for different treatments 2 Area of callosity accumulation p < 0.05 3. Analysis of plant disease resistance-related protein gene expression: After foliar spraying with 20 mM arbutin, leaves were collected at 3, 6, 9, 12, and 24 hours, and RNA was extracted and reverse transcribed into cDNA. The relative expression levels of TaPR1, TaPR2, and TaPR5 were detected using real-time quantitative PCR. The expression level of each gene was calculated using the wheat GADPH gene as an internal reference. Each reaction was performed in triplicate. The qRT-PCR reaction system was as follows: 2.0 μL cDNA template, 10 μL 2×qPCR SYBR MIX, 0.5 μL 10 μmol / L forward primer, 20 μmol / L... L-1Add 0.5 μL of reverse primer and water to a total volume of 20 μL. PCR program: 95℃ for 3 minutes; 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 30 seconds, 40 cycles, add melting curve. TaPR1 , TaPR2 , TaPR5 The expression level is represented by 2 CT values. -△△CT The primers were obtained through a specific process. The specific primer sequences are as follows: TaGADPH-F (SEQ ID NO.1): CTGCATCATACGATGACATC; TaGADPH-R (SEQ ID NO.2): TGTCACCGACAAAGTCAGTG; TaPR1-F (SEQ ID NO.3): GAGAATGCAGACGCCCAAGC; TaPR1-R (SEQ ID NO.4): CTGGAGCTTGCAGTCGTTGATC; TaPR2-F (SEQ ID NO.3) NO.5): AGGATGTTGCTTCCATGTTTGCCG; TaPR2-R (SEQ ID NO.6): AAGTAGATGCGCATGCCGTTGATG; TaPR5-F (SEQ ID NO.7): ACAGCTACGCCAAGGACGAC; TaPR5-R (SEQ ID NO.8): CGCGTCCTAATCTAAGGGCAG.
[0024] 4. DAB staining: The control group was sprayed with water, while the treatment group was sprayed with 20 mM arbutin on the leaves. The leaves were then immersed in DAB solution (1 mg / mL, pH approximately 3.8) and placed under strong light for 6 hours until all leaves were stained. The leaves were cut into approximately 2 cm pieces and placed in a decolorizing solution, which was then replaced with a saturated chloral hydrate solution. The area was statistically analyzed using a bright-field microscope. The mycelia of leaf rust fungi on wheat leaves were stained using a WGA-Alexa488 microscope, and the growth and development of the mycelia were observed under a fluorescence microscope.
[0025] III. Experimental Results 1. Statistical results of leaf rust incidence: The severity of disease under different treatment methods is as follows: Figure 1 As shown in the figure, foliar application of arbutin can inhibit the growth of wheat leaf rust. Compared with the control, the 1 mmol / L concentration treatment significantly reduced the number of sporulations, while the 20 mmol / L concentration treatment completely inhibited sporulation. With increasing arbutin concentration, the severity of wheat leaf rust significantly decreased.
[0026] 2. Statistical results of wheat stripe rust and powdery mildew incidence: After foliar spraying with 20 mM arbutin, inoculation with wheat stripe rust and powdery mildew resulted in... Figure 2As shown, compared with the control, the proportion of leaf rust and powdery mildew spores in the leaves was significantly reduced, and the severity of the disease was reduced.
[0027] 3. Statistics on callose accumulation in wheat: After foliar spraying with 20 mM arbutin, the amount of callose accumulation in wheat leaves was significantly higher than that in the control, indicating that the inhibitory effect of arbutin on various wheat diseases may be through promoting callose deposition.
[0028] 4. Expression results of the PR gene: wheat PR The expression levels of genes after arbutin treatment are shown in Table 4. The results showed that, in both the control and treatment groups, the expression levels of disease resistance-related genes were significantly induced at 3h, 6h, 9h, 12h, and 24h after foliar spraying of 20mM arbutin, and at least 12 hours before spraying. PR1 and PR2 The expression of the gene continuously increased 3-12 hours after spraying arbutin, with the highest expression level 12 hours after spraying and decreasing 24 hours after spraying. PR5 The gene expression was upregulated at 6, 9 and 12 hours after spraying arbutin, with the highest expression level at 6 hours after spraying. This indicates that arbutin can enhance wheat's resistance to diseases and can be applied to the prevention and control of airborne diseases in wheat.
[0029] Table 4: Wheat PR Gene expression level after arbutin treatment 5. Results of reactive oxygen species emergence and mycelial development in wheat: Table 5 shows the results of reactive oxygen species accumulation in leaves and mycelial area after inoculation with leaf rust. The results show that 48 hours after foliar spraying with 20 mM arbutin, hydrogen peroxide accumulation was counted in both the control and treatment. After inoculation of Mingxian 169 with leaf rust THTT, almost no reactive oxygen species were produced around the stomata of wheat. However, after spraying with 20 mM arbutin and inoculating with THTT, H2O2 accumulation in wheat leaves increased significantly 48 hours later, and mycelial growth and development were inhibited, as evidenced by a significant decrease in mycelial length and colony area.
[0030] Table 5: Reactive oxygen accumulation and leaf rust colony area after inoculation with leaf rust fungus Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of arbutin in improving wheat resistance to airborne diseases, characterized by: The application of arbutin in improving wheat resistance to stripe rust, leaf rust and powdery mildew.
2. The application according to claim 1, characterized in that: Arbutin enhances the accumulation of callose in wheat, thereby increasing wheat's resistance to airborne diseases.
3. The application according to claim 1, characterized in that: Arbutin enhances resistance genes TaPR1 , TaPR2 , TaPR5 Increase the expression level of [the substance] to improve wheat's resistance to airborne diseases.
4. The application according to any one of claims 1-3, characterized in that: Arbutin, when sprayed onto wheat plants at a concentration of 1-20 mM, helps prevent wheat rust and powdery mildew.
5. The application according to any one of claims 1-3, characterized in that: The arbutin was sprayed on wheat leaves at a concentration of 1-20 mM, with a spraying volume of 10 mL of arbutin solution for every 50 wheat plants. When leaf rust fungus infected susceptible wheat varieties, the release of reactive oxygen species was enhanced, mycelial development and colony formation were inhibited, and the wheat's disease resistance was enhanced.