Insect-resistant and antibacterial pyrrole alkaloid compound and biosynthetic gene cluster thereof

Abstract

The invention discloses an insect-resistant and antibacterial pyrrole alkaloid compound and a biosynthetic gene cluster thereof. The structure of the pyrrole alkaloid compound is shown as a formula (I), wherein compounds 2, 3, 4, 14 and 15 are new compounds. The gene cluster of the pyrrole alkaloid compound is disclosed for the first time, and each gene function is confirmed for the first time. PasA and PasD act together to form a pyrrolidone skeleton intermediate 8, and then the compound 8 is converted into a final product 1 by PasB. The invention discloses the inhibitory activity of the compounds on chitinase, lepidoptera pests, namely plutella xylostella and agricultural pathogenic fungi, and a biosynthetic pathway of a lead compound 1 for the first time. The fatality rate of the compound 1 on lepidoptera pest plutella xylostella reaches 100%, the effect of the compound 1 is better than that of DFB, and the compound 1 also has good inhibition potential on agricultural pathogenic fungi. The invention provides a new alternative compound for pesticide development, and lays a solid foundation for realizing green and efficient synthesis of the compound 1.

Description

Technical Field

[0001] This invention belongs to the field of natural product synthetic biology, specifically involving a class of insect- and antibacterial pyrrole alkaloids with chitinase inhibitory activity and their biosynthetic gene clusters. Background Technology

[0002] Pyrrole alkaloids are an important class of bioactive natural products, widely found in plants, animals, and microorganisms. Their core structural units include nitrogen-containing heterocycles such as pyrrole, pyrrolidine (dihydropyrrole), pyrrolidine (tetrahydropyrrole), and pyrrolizidine (di-fused pyrrolidine), forming the key pharmacodynamic skeleton of many pesticide molecules, such as nicotine, tetraflufenicol, methoxypiperidine ethyl ester, and chlorfenapyr. In 1999, Eduardo Primo Yúfera et al. first discovered pyrrole alkaloids in... Penicillium brevicompactum Pyrrololine alkaloids (compound 1) isolated from Dierckx have shown potential as lead drugs due to their significant insecticidal and antibacterial activities, and their total chemical synthesis has been attempted. However, chemical synthesis methods are cumbersome and uneconomical, thus biosynthesis is considered a more feasible alternative. However, the biosynthetic gene cluster of this compound has not yet been reported. Summary of the Invention

[0003] To address the aforementioned problems, this invention provides 15 pyrrole alkaloid compounds with chitinase inhibitory activity and their biosynthetic gene clusters. These pyrrole alkaloid gene clusters are the first of their kind, and are of great significance for bioenzyme engineering. Furthermore, these pyrrole alkaloid compounds provide new candidate compounds for pesticide development and are of great importance for forestry breeding and seedling cultivation in bio-agriculture.

[0004] The first object of this invention is to provide pyrrole alkaloids or pharmaceutical salts with structures as shown in any of formula (I): ; Equation (Ⅰ).

[0005] The second objective of this invention is to provide a biosynthetic gene cluster for synthesizing the aforementioned pyrrole alkaloids, comprising the following three genes: pass The gene and nucleic acid sequence are shown in SEQ ID NO.1; pasB The gene and nucleic acid sequence are shown in SEQ ID NO.2; pasD The gene and its nucleic acid sequence are shown in SEQ ID NO.3.

[0006] The gene cluster originates from Penicillium citrinumSCSIO DF147, held at the South China Sea Institute of Oceanology, Chinese Academy of Sciences (SCSIO), catalog number SCSIO SXWST21.003, is publicly available at https: / / www.ncbi.nlm.nih.gov / nuccore / 2817189410.

[0007] A third object of the present invention is to provide a protease for synthesizing the above-mentioned pyrrole alkaloid compounds, namely proteases PasA, PasB and / or PasD, wherein the amino acid sequence of PasA is shown in SEQ ID NO.4, the amino acid sequence of PasB is shown in SEQ ID NO.5, and the amino acid sequence of PasD is shown in SEQ ID NO.6.

[0008] A fourth object of the present invention is to provide the application of the above-mentioned biosynthetic gene cluster or the above-mentioned protease in the preparation of the above-mentioned pyrrole alkaloid compounds.

[0009] The fifth object of the present invention is to provide a method for preparing the above-mentioned pyrrole alkaloid compounds, comprising the following steps: from Penicillium citrinum SCSIO DF147 or its mutant strain Penicillium citrinum It was prepared and isolated from the fermentation broth of SCSIODF147 / ΔpasB. Penicillium citrinum Compounds 1-13 were isolated from the fermentation broth of SCSIO DF147. Penicillium citrinum Compounds 6, 8, 13, 14, and 15 were prepared and isolated from the fermentation broth of SCSIO DF147 / ΔpasB.

[0010] The inventors, through research on fungi derived from sandworms Penicillium citrinum SCSIO DF147 and its mutant strains were subjected to scale-up fermentation, extraction, separation, and purification to obtain 15 pyrrole alkaloid compounds 1-15. Using (+)-HR-ESIMS, 1D and 2D NMR, and X-ray single-crystal diffraction techniques, the 15 compounds were identified as containing different pyrrolins, pyrrolidines, pyrroles, pyrrolizidines, and linear amides. Their specific structures are shown in formula (I).

[0011] The sixth object of the present invention is to provide pass Genes and pasD The application of gene combination or pasA protein and pasD protein combination in the preparation of compound 8 mentioned above. pass The nucleic acid sequence of the gene is shown in SEQ ID NO.1. pasD The nucleic acid sequence of the gene is shown in SEQ ID NO.3, the amino acid sequence of the pasA protein is shown in SEQ ID NO.4, and the amino acid sequence of the pasD protein is shown in SEQ ID NO.6.

[0012] The seventh object of the present invention is to provide pass Gene, pasB Genes and pasD The application of gene combination or the combination of pasA protein, pasB protein and pasD protein in the preparation of the above-mentioned compound 8 and compound 1. pass The nucleic acid sequence of the gene is shown in SEQ ID NO.1. pasB The nucleic acid sequence of the gene is shown in SEQ ID NO.2. pasD The nucleic acid sequence of the gene is shown in SEQ ID NO.3, the amino acid sequence of the pasA protein is shown in SEQ ID NO.4, the amino acid sequence of the pasB protein is shown in SEQ ID NO.5, and the amino acid sequence of the pasD protein is shown in SEQ ID NO.6.

[0013] Polyketide synthase-nonribosomal polypeptide synthase PasA and enoyl reductase PasD work together to form pyrrolidone backbone intermediate 8, which is then converted to compound 1 by P450 protease PasB. The functions of each gene and the preparation process are as follows: Figure 14 As shown.

[0014] An eighth object of the present invention is to provide the use of protein PasB in converting compound 8 described above into compound 1 described above, the amino acid sequence of PasB being shown in SEQ ID NO.5.

[0015] Preferably, the genes in the above-mentioned biosynthetic gene cluster are combined and expressed in a foreign host to prepare compound 8 and compound 1; or the genes in the above-mentioned biosynthetic gene cluster are combined and expressed to obtain compound 8 and compound 1; or the genes in the above-mentioned biosynthetic gene cluster are combined and expressed in a foreign host to obtain compound 8 and compound 1. pasB Genes were combined and expressed in a foreign host, induced and prepared into microsomal proteins, and compound 1 was prepared using compound 8 as a substrate and NADPH as a cofactor.

[0016] Preferably, the exogenous host is Escherichia coli, yeast, or Aspergillus nidulans.

[0017] The ninth object of this invention is to provide the application of the above-mentioned pyrrole alkaloid compounds in the preparation of chitinase inhibitors, inhibitors of the lepidopteran pest diamondback moth, and / or inhibitors of plant pathogenic fungi, wherein the chitinase is Asian corn borer chitinase II (OfChtII) and / or Asian corn borer chitinase h (OfChi-h), and the plant pathogenic fungus is *Citrus aurantium*. Penicillium digitatum PD01 and / or tomato gray mold Botrytis cinerea pers. PC01.

[0018] The tenth object of the present invention is to provide a biological agent comprising the above-mentioned pyrrole alkaloid compounds 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14 and / or 15, or pharmaceutical salts thereof, and a pharmaceutically acceptable carrier.

[0019] This invention evaluates the chitinase inhibitory activity of compounds 1-15 and finds that they inhibit chitinase... Of ChtII and Of Both Chi-h exhibit good inhibitory activity and have the potential to develop chitinase inhibitor pesticide lead compounds.

[0020] The compounds of the present invention containing different pyrrolidones, pyrrolidines, pyrroles, pyrrolizidines, and linear amides all exhibit activity against chitinase. Of ChtII and Of All chitinase inhibitors exhibited good inhibitory activity. Compounds 2, 3, 4, 14, and 15 are novel compounds. These compounds have the potential to be developed into lead compounds for chitinase inhibitor pesticides.

[0021] Advantages of this invention:

[0022] The invention discloses for the first time the effect of this type of compound on chitinase. Of ChtII and Of The invention discloses the inhibitory activity of Chi-h and the biosynthetic pathway of lead compound 1. The gene cluster of the pyrrole alkaloid compounds in this invention is discovered for the first time, and the functions of each gene are also confirmed for the first time. Proteases PasA and PasD work together to form pyrrolidone backbone intermediate 8, which is then converted into final product 1 by protease PasB. Therefore, this invention provides new candidate compounds for pesticide development and lays a solid foundation for the green and efficient synthesis of compound 1, which is of great significance for the development of drugs of this class.

[0023] This patent is based on marine-derived fungi. Penicillium citrinum Compound 1 and its analogues were isolated from the fermentation extracts of SCSIO DF147 and its mutants, and their biosynthetic gene clusters were identified, enabling heterologous expression of these compounds. For the first time, it was revealed that these compounds exhibit significant inhibitory activity against chitinase. Further studies showed that compound 1 achieved a 100% mortality rate against diamondback moth after 5 days of application at a concentration of 5 mM, demonstrating better efficacy than the positive control Diflubenzuron (DFB). It also showed efficacy against *Agromycetes citrus*. Penicillium digitatum PD01 and tomato gray mold Botrytis cinerea PersBC01 exhibits good inhibitory potential. This discovery lays the foundation for its further development as a lead compound for insecticidal and antibacterial pesticides.

[0024] Penicillium citrinumSCSIO DF147 (hereinafter referred to as strain SCSIO DF147), a sandworm-derived fungus, is deposited at the South China Sea Institute of Oceanology, Chinese Academy of Sciences (SCSIO), with the accession number SCSIO SXWST21.003, and is publicly available at https: / / www.ncbi.nlm.nih.gov / nuccore / 2817189410. The applicant also holds this fungus and guarantees to make it available to the public within 20 years from the date of this application. Attached Figure Description

[0025] Figure 1 It is compound 2. 1 ¹H NMR (500 MHz) spectrum, solvent: deuterated methanol.

[0026] Figure 2 It is compound 2. 13 C10 NMR (125 MHz) spectrum, solvent: deuterated methanol.

[0027] Figure 3 It is compound 3. 1 ¹H NMR (500 MHz) spectrum, solvent: deuterated methanol.

[0028] Figure 4 It is compound 3. 13 C10 NMR (125 MHz) spectrum, solvent: deuterated methanol.

[0029] Figure 5 It is compound 4. 1 ¹H NMR (500 MHz) spectrum, solvent: deuterated methanol.

[0030] Figure 6 It is compound 4. 13 C10 NMR (125 MHz) spectrum, solvent: deuterated methanol.

[0031] Figure 7 It is compound 14. 1 ¹H NMR (500 MHz) spectrum, solvent: deuterated methanol.

[0032] Figure 8 It is compound 14. 13 C10 NMR (125 MHz) spectrum, solvent: deuterated methanol.

[0033] Figure 9 It is compound 15. 1 ¹H NMR (500 MHz) spectrum, solvent: deuterated methanol.

[0034] Figure 10 It is compound 15. 13C10 NMR (125 MHz) spectrum, solvent: deuterated methanol.

[0035] Figure 11 It's a gene. pasABD Functional verification, i) A. nidulans Heterologous expression in A1145 pasAD ii) Generate target compound 8; pasABD Target compounds 8 and 1 were produced.

[0036] Figure 12 It's a gene. pasB Functional verification, heterogeneous expression pasB It reacts with substrate compound 8 to produce target compound 1.

[0037] Figure 13 This is a functional verification of protein PasB. The microsomal membrane protein PasB reacts with substrate compound 8 to produce target compound 1.

[0038] Figure 14 It is a gene cluster for the biosynthesis of pyrrole alkaloids and a biosynthetic route map for pyrrole alkaloids.

[0039] Figure 15 This is a structural diagram of pyrrole alkaloids.

[0040] Figure 16 Compounds 1, 8, and 13 are pairs of diamondback moths. P. xylostella Lethal effect at a concentration of 5 mM.

[0041] Figure 17 Compounds 1-3, 5-9, and 12-15 are effective against *Vibrio vulnificus*, the pathogen of citrus green mold. Penicillium digitatum The inhibitory effect of PD01.

[0042] Figure 18 Compounds 1-3, 5-9, and 12-15 are effective against tomato gray mold. Botrytis cinerea pers. The inhibitory effect of PC01. Detailed Implementation

[0043] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0044] Example 1: Preparation and structural identification of compounds 1-15 as shown in formula (I)

[0045] I. Compounds 1-15 as shown in formula (I) Figure 15 Preparation of )

[0046] 1. Seed culture:

[0047] (1) Seed culture medium formula: by mass fraction 100%, including 0.3% yeast extract, 1% glucose, 3.3% sea salt, 0.1% corn steep liquor, 2% mannitol, 2% maltose, 1% monosodium glutamate, 0.03% MgSO4·7H2O, 0.05% KH2PO4, pH 7.5, with the balance being water. Dissolve and mix the weighed substances according to the formula, dispense 50 mL into 250 mL Erlenmeyer flasks, and sterilize at 115℃ for 30 minutes to obtain the seed culture medium.

[0048] (2) Seed culture: the strain Penicillium citrinum SCSIO DF147 and its mutant strains Penicillium citrinum SCSIO DF147 / Δ pasB Mycelia or spores were inoculated into the above seed culture medium and cultured on a shaker at 200 rpm and 28°C for 1.5 days to obtain the seed culture solution. Mutant strain Penicillium citrinum SCSIO DF147 / Δ pasB The construction method is referenced in "Characterization of the depsidone gene cluster reveals etherification, decarboxylation and multiple halogenations astailoring steps in depsidone assembly" (Acta Pharmaceutica Sinica B 2023;13(9):3919e3929) and "Development of the CRISPR-Cas9 System for the Marine-Derived Fungi". Spiromastix sp. SCSIO F190 and Aspergillus sp. SCSIO SX7S7 (J. Fungi2022, 8, 715. https: / / doi.org / 10.3390 / jof8070715), its knockout primer sequence is as follows:

[0049] 2. Scale-up fermentation culture:

[0050] (1) Formula for scale-up fermentation medium: consistent with the seed culture medium. Dissolve and mix the weighed substances according to the formula to prepare a total volume of about 20 L. Then dispense 200 mL into 1000 mL Erlenmeyer flasks and sterilize at 115℃ for 30 minutes to prepare the scale-up fermentation medium.

[0051] (2) Fermentation culture:

[0052] Under aseptic conditions, the prepared seed culture (approximately 15 mL) was inoculated into scale-up fermentation medium, with each 1000 mL Erlenmeyer flask containing approximately 200 mL of scale-up fermentation medium. The culture was carried out on a shaker at 28°C for 7 days at a speed of 200 rpm to obtain the bacterial strain. Penicillium citrinum SCSIO DF147 and its mutant strains Penicillium citrinum SCSIODF147 / Δ pasB Fermentation products.

[0053] 3. Extraction and separation:

[0054] The strain that will end fermentation Penicillium citrinum SCSIO DF147 or its mutant strain Penicillium lemon SCSIO DF147 / Δ pasB The fermentation product was centrifuged at 3600 rpm for 10 min to obtain the supernatant fermentation broth and precipitated mycelium. The supernatant fermentation broth was extracted three times with 10 L of butanone, and the butanone extract was concentrated under reduced pressure at 40℃ to obtain a fermentation broth extract; the precipitated mycelium was extracted three times with 2 L of acetone, and the acetone extract was concentrated under reduced pressure at 40℃ to obtain a mycelial extract; after HPLC-DAD analysis, it was found to contain acetonitrile / water with a volume fraction of 0.1% acetic acid. v / v Gradient elution: 0-20.0 min, 5-80% acetonitrile; 20.0-23.0 min, 80-100% acetonitrile; 23.0-27.0 min, 100% acetonitrile; 27.0-27.5 min, 100-5% acetonitrile; 27.5-30.0 min, 5% acetonitrile, flow rate 1 mL / min, injection 10 μL, analysis and detection at 254 nm, ZORBAX SB-C18 column 150 mm × 4.6 mm, 5 mm, Agilent), combining fermentation broth extract and cell extract.

[0055] For strains Penicillium citrinum The combined extracts of SCSIO DF147 were separated using 100-200 mesh silica gel. After mixing and dry packing, the extracts were analyzed using a chloroform-methanol system (100 / 0, 98 / 2, 96 / 4, 94 / 6, 92 / 8, 9 / 1, 8 / 2, 7 / 3, 5 / 5). v / vNine fractions, Frs.A1-A9, were obtained sequentially. Fr.A1 and Fr.A2 were separated by 200-300 mesh silica gel and eluted with a petroleum ether-ethyl acetate-methanol system (100 / 0 / 0, 95 / 5 / 0, 90 / 10 / 0, 85 / 15 / 0, 80 / 20 / 0, 70 / 30 / 0, 50 / 50 / 0, 20 / 80 / 0, 0 / 100 / 0, 0 / 99 / 1, 0 / 95 / 5, v / v / v), yielding eleven fractions, Frs.B1-B11 and Frs.C1-C11, respectively. The Fr.B5 and Fr.C2 fractions were combined, separated by 200-300 mesh silica gel, and eluted with a petroleum ether-ethyl acetate system (100 / 0, 99.5 / 0.5, 99 / 1, 98.5 / 1.5, 98 / 2, 97 / 3, 96 / 4, 95 / 5, 90 / 10, v / v) to obtain nine fractions Frs.D1-D9. Fraction Fr.D3 was subjected to SP-HPLC semi-preparative analysis (ODS-A column 250 × 10 mm, 5 μm, YMC; H2O-CH3CN, v / v ratio 50:50, isocratic elution for 35 min, flow rate 2.5 mL / min, detection wavelengths 220 and 275 nm) to obtain compound 12 (4.6 mg, t). R = 13.3 min), compound 2 (11.2 mg, t R = 15 min), Compound 1 (200.1 mg, t R = 16min), compound 7 (6.2 mg, t R = 19 min), compound 11 (5.2 mg, t R = 23 min). Frs.A3-A6 fractions were combined and eluted with a medium-pressure reversed-phase ODS (40-63 µm, YMC) using a CH3CN-H2O system (A phase: H2O, B phase: CH3CN, 0-7 min 5% B; 7-25 min 5%-70% B; 25-30 min 70%-100% B; 30-40 min 100% B) gradient for 40 min at a flow rate of 30 mL / min and detection wavelengths of 250 and 300 nm, yielding 10 fractions Frs.E1-E10. Fraction Fr.E7 was subjected to SP-HPLC semi-preparative analysis (ODS-A column 250 × 10 mm, 5 μm, YMC; H2O-CH3CN, volume ratio 60:40 isocratic elution for 32 min at a flow rate of 2.5 mL / min and detection wavelengths of 220 and 275 nm) to obtain compound 4 (11.0 mg, t R = 8 min), compound 3 (15.1 mg, t R = 9 min), compound 13 (7.8 mg, tR = 12 min), compound 9 (56.1 mg, t R = 15 min), compound 5 (21.7 mg, t R = 18 min), compound 10 (72.2 mg, t R = 23 min), compound 8 (52.2 mg, t R = 26 min). Fraction Fr.E4 was subjected to SP-HPLC semi-preparative analysis (ODS-A column 250 × 10 mm, 5 μm, YMC; H2O-CH3CN, isocratic elution 65:35 v / v for 40 min, flow rate 2.5 mL / min, detection wavelengths 220 and 275 nm) to obtain compound 6 (9.2 mg, t). R = 32 min).

[0056] For strains Penicillium citrinum SCSIO DF147 / Δ pasB The combined extracts were separated using 100-200 mesh silica gel. After mixing and dry packing, the fractions were sequentially eluted using a chloroform-methanol system (100 / 0, 98 / 2, 96 / 4, 94 / 6, 92 / 8, 9 / 1, 8 / 2, 7 / 3, 5 / 5, v / v) to obtain nine fractions, Frs.A1-A9. Fractions Fr.A2 and Fr.A3 were combined, separated using 200-300 mesh silica gel, and eluted using a petroleum ether-ethyl acetate-methanol system (98 / 2 / 0, 95 / 5 / 0, 93 / 7 / 0, 90 / 10 / 0, 85 / 15 / 0, 80 / 20 / 0, 70 / 30 / 0, 0 / 100 / 0, 0 / 95 / 5, v / v / v) to obtain nine fractions, Frs.B1-B9. Fraction Fr.B3 was subjected to SP-HPLC semi-preparative analysis (ODS-A column 250 × 10 mm, 5 μm, YMC; H2O-CH3CN, v / v ratio 40:60, isocratic elution for 25 min, flow rate 2.5 mL / min, detection wavelengths 220 and 275 nm) to obtain compound 8 (182.2 mg, t R = 10.4 min), compound 14 (17.0 mg, t R = 19.3 min) and compound 6 (17.7 mg, t R = 22.3 min). The Fr.B5 and Fr.B6 fractions were combined and subjected to SP-HPLC semi-preparative analysis (ODS-A column 250 × 10 mm, 5 μm, YMC; H2O-CH3CN, volume ratio 50:50, isocratic elution for 30 min, flow rate 2.5 mL / min, detection wavelengths 220 and 275 nm) to obtain compound 13 (71.5 mg, t).R = 27.5 min) and compound 15 (7.9 mg, t R = 20.1 min).

[0057] II. Physicochemical data of compounds 2, 3, 4, 14, and 15

[0058] Compound 2: Colorless oil; 1 H and 13 The C NMR spectrum is shown in Figure 1-2 HR-ESI-MS (+): m / z [M+H] + 250.1807 (Calc. for C) 15 H 24 NO2, 250.1802).

[0059] Compound 3: Colorless oil; 1 H and 13 The C NMR spectrum is shown in Figure 3-4 HR-ESI-MS (+): m / z [M+H] + 296.1859 (Calc. for C) 16 H 26 NO4, 296.1856).

[0060] Compound 4: Colorless oil; [α] 25 D = 6.2 (c = 0.14, MeOH); 1 H and 13 The C NMR spectrum is shown in Figure 5-6 HR-ESI-MS (+): m / z [M+H] + 288.2171 (Calc. for C) 15 H 30 NO4, 288.2169).

[0061] Compound 14: White amorphous powder; [α] 25 D = -14.7 (c = 0.18, MeOH); 1 H and 13 The C NMR spectrum is shown in Figure 7-8 HR-ESI-MS (+): m / z [M+H] + 284.2225 (Calc. for C) 16 H 30 NO3, 284.2220).

[0062] Compound 15: White amorphous powder; [α] 25D = -21.4 (c = 0.20, MeOH); 1 H and 13 The C NMR spectrum is shown in Figure 9-10 HR-ESI-MS (+): m / z [M+H] + 282.2069 (Calc. for C) 16 H 28 NO3, 282.2064).

[0063] Based on the above physicochemical data analysis, the structures of compounds 2, 3, 4, 14, and 15 are as shown in formula (Ⅳ). ; Equation (Ⅳ)

[0064] Example 2: Inhibitory activity of compounds 1-15 against chitinases ofChtII and ofChi-h

[0065] The effects of compounds 1-15, containing different pyrrolidines, pyrrolidines, pyrrolizidines, and linear amides obtained in Example 1, on chitinase were determined. Of ChtII and Of Inhibitory activity of Chi-h.

[0066] Positive controls: Three parallel positive controls were set up. Under the conditions of a reaction temperature of 30℃ and a reaction system of 100 µL, 2 nmol / L chitinase (OfChtII or OfChi-h, preparation method reference) was used. J. Agric. Food Chem. 20 µM MU-(GlcNAc)2 and 20 µM MU-(GlcNAc)2 were incubated in 20 mmol / L pH 6.0 phosphate buffer for 30 min. The reaction was then terminated by adding 100 µL 0.5 mol / L sodium carbonate solution. The reaction solution was excited with excitation light at a wavelength of 360 nm and the absorbance value at a wavelength of 450 nm was measured.

[0067] Experimental group: Three parallel experimental groups were set up. Under the conditions of reaction temperature of 30℃ and 100 µL reaction system, 2 nmol / L chitinase (OfChtII or OfChi-h), 10 µM of the compound obtained in Example 1, and 20 µM MU-(GlcNAc)2 were incubated in 20 mmol / L pH 6.0 phosphate buffer for 30 min. Then, 100 µL of 0.5 mol / L sodium carbonate solution was added to terminate the reaction. The reaction solution was excited with excitation light at a wavelength of 360 nm and the absorbance value at a wavelength of 450 nm was measured.

[0068] The inhibitory activity is calculated using the following formula.

[0069] Inhibition percentage = (Control group - Experimental group) / Control group * 100

[0070] The results are shown in Table 1, with values ​​representing inhibition rates. The results indicate that compounds 2, 7, 9, 11, and 13 inhibit chitinase. Of ChtII and Of Chi-h all have inhibitory activity; compounds 3 and 6 have inhibitory activity. Of ChtII has inhibitory activity; compounds 1, 4, 8, 12, 14, and 15 have inhibitory effects. Of Chi-h has inhibitory activity.

[0071] Table 1

[0072] " / ": Not tested

[0073] Example 3: Construction, heterologous expression, and in vivo feeding experiments of heterologous expression plasmids of pyrrole alkaloids.

[0074] 1. PCR amplification of target gene clusters

[0075] Production strain of the target compound Penicillium citrinum Using the SCSIO DF147 genome as a template, the target gene was amplified by PCR using the high-fidelity enzyme FastPfu. pass (SEQ ID NO.1) pasB (SEQ ID NO.2) pasD (SEQ ID NO.3), the PCR reaction system is as follows: Template 10-20 ng, Forward primer (10 μM) 1 μL, Reverse primer (10 μM) 1 μL, 5 x FastPfu Buffer 10 μL, dNTPs 5 μL, DMSO 2.5 μL, FastPfu DNA polymerase 1 μL, dd H2O up to 50 μL.

[0076] The primer sequences are as follows:

[0077] PasA-pYTU-recomb-F1:tgagcttcatccccagcatcattacacctcagcatgaatacttcacctgaaccaatcg

[0078] PasA-pYTU-recomb-R1:gccgttgagtaatattcatcgagtaga

[0079] PasA-pYTU-recomb-F2:tttggaagatgtcatcgcgtcg

[0080] PasA-pYTU-recomb-R2:ctgattgctgttggttcgaaaagt

[0081] PasA-pYTU-recomb-F3:aggccgagctcattcgtgaata

[0082] PasA-pYTU-recomb-R3: acttcaacacagtggaggacatacccgtaattttctgcaatcttcgccagacacctta

[0083] PasB-pYTR-recomb-F: ctaaccattaccccgccacatagacacatctaaacaatggctaacccaactatggccg

[0084] PasB-pYTR-recomb-R:ctgctaaagggtatcatcgaaagggagtcatccaatttgggtgttgtcgattcctgg

[0085] PasD-pYTP-recomb-F:tcccttctctgaacaataaaccccacagaaggcatttatgattctcccaaaggaacg

[0086] PasD-pYTP-recomb-R: taggagtgatgagacccaacaaccatgataccaggggagactgagataggcgtatgg

[0087] Reaction conditions: Pre-denaturation 95℃, 2 min; denaturation 95℃, 20 s; annealing 56℃, 20 s; extension 72℃, 1 kb / min, 35 cycles; extension 72℃, 5 min; store at 16℃.

[0088] 2. Construction of heterologous expression plasmids

[0089] The PCR-amplified gene fragment was ligated into the host yeast using the Frozen-EZ Yeast Transformation II Kit and the ZYMORESEARCH kit (Cat. No: T2001, Lot No: 212042). The target gene was then ligated with the vector plasmids pYTU, pYTR, and pYTP (reference: D. Yee, T. Kakule, W. Cheng, M. Chen, C. Chong, Y. Hai, L. Hang, Y. Hung, N. Liu, M. Ohashi, I. Okorafor, Y. Song, M. Tang, Z. Zhang, Y. Tang. Genome Mining of Alkaloidal Terpenoids from a Hybrid Terpene and Nonribosomal Peptide Biosynthetic Pathway. J. Am. Chem. Soc. 2020, 142, 710-714. The applicant also holds these plasmids and guarantees that they will be made available to the public from the date of this application). Saccharomyces cerevisiae JHY 686 competent cells (Reference: BOND CM, TANG Y. Engineering) Saccharomyces cerevisiae For the production of simvastatin[J]. Metab Eng, 2019, 51: 1-8. (The applicant also holds this patent, and guarantees that it will be made available to the public from the date of this application). Specifically: a. Remove the EP tube containing 30 µL of JHY686 competent yeast cells from the -80°C freezer and thaw at room temperature.

[0090] b. Add 2.5 µL of linearized pYTU / pYTP / pYTR restriction plasmids (restriction sites) to each EP tube. PshA I / Not I. See reference J. Am. Chem. Soc. 2020, 142, 710-714.), 2.5 µL of the target gene fragment, and 300 µL of Frozen-EZ Solution III (kit Cat. No: T2001, Lot No: 212042), mix with a cut yellow pipette tip and incubate in a 30°C water bath for 1 h, mixing once every 15 min.

[0091] c. Spread the incubated competent yeast cells onto uracil-deficient agar plates (formulation reference J. Am. Chem. Soc. 2020, 142, 710-714.) and incubate at 30°C for 2 days. After single colonies have grown, select single colonies and transfer them to new uracil-deficient agar plates and incubate at 30°C inverted mode for 1-2 days.

[0092] 3. Transformation and amplification of heterologous expression plasmids

[0093] 1) Use the Zymoprep™ Yeast Plasmid Miniprep I kit to extract host yeast. Saccharomyces cerevisiae JHY 686 plasmid.

[0094] 2) The extracted plasmid was transformed and amplified into E. coli DH5α competent cells.

[0095] a. Remove the EP tube containing E. coli DH5α from the -80°C freezer, thaw it on ice, and then extract the host yeast. Saccharomyces cerevisiae Plasmid 686 was placed on ice for pre-cooling.

[0096] b. Transfer 30 µL of Escherichia coli DH5α competent cells into an EP tube containing 10 µL of yeast plasmid and mix well.

[0097] c. After an ice bath for 30 minutes, heat shock in a 42°C water bath for 90 seconds, then immediately place on ice for 3 minutes.

[0098] d. Add 500 µL of antibiotic-free LB liquid medium, mix well, and incubate at 37°C and 200 rpm for 1 h.

[0099] e. Spread on LB resistant plates (add 50 µM carbenicillin to the final concentration, blow dry, and incubate overnight at 37°C upside down until single colonies grow).

[0100] f. Verify the colonies by colony PCR using EasyTaq DNA polymerase. PCR primers are the same as in step 1. Reaction conditions: pre-denaturation 95℃, 2 min; denaturation 95℃, 20 s, annealing 56℃, 20 s, extension 72℃, 1 kb / min, 35 cycles; extension 72℃, 5 min; store at 16℃.

[0101] g. PCR verification of the correct clone, transfer to a new 4 mL LB liquid tube (add 50 µM final concentration of carbenicillin, incubate overnight at 37°C for amplification).

[0102] h. For the amplified resistant bacteria, use Omega Bio-Tek EZNA® The Plasmid Mini Kit I is used to extract the target plasmid.

[0103] i. The extracted plasmids are sequenced and verified using verification primers to obtain plasmids pYTU-PasA, pYTR-PasB, and pYTP-PasD.

[0104] 4. Heterologous expression of correctly sequenced plasmids

[0105] a. Using heterologous expression strains of Aspergillus nidulans Aspergillus nidulans The s A1145 protoplasts were removed from the -80°C freezer and thawed on ice.

[0106] b. Add plasmids to 60 µL of Aspergillus nidulans competent cells in the following combinations: 2.5 µL each of pYTU-PasA, pYTR-PasB, and pYTP-PasD; 2.5 µL each of pYTU-PasA, pYTR-PasB, and empty vector pYTP; 2.5 µL each of pYTU-PasA, pYTP-PasD, and empty vector pYTR; 2.5 µL each of pYTR-PasB, pYTP-PasD, and empty vector pYTU; for control, transform the empty circular plasmid pYTU / P / R into Aspergillus nidulans, mix well, and incubate on ice for 1 h.

[0107] c. Add 600 µL of polyethylene glycol solution, gently blow it evenly with a cut nozzle, and let it stand at room temperature for 20 minutes.

[0108] d. Spread the plating onto CDS plates and incubate at 37°C for 1-2 days until single clones emerge.

[0109] e. Pick single clones, transfer them to CD solid plates, and incubate at 28°C for 2-3 days.

[0110] f. Preserve the bacteria with 25% (v / v) glycerol and transfer to 30 mL of CD-ST liquid medium. Incubate at 28°C on a shaker for 3 days. Harvest the bacteria and extract with an equal volume of ethyl acetate using ultrasound. Reduce the extract to dryness and concentrate to a paste. Make up to 1 mL with methanol. Centrifuge the crude extract at 1200 rpm for 2 min. Take 100 µL of the supernatant and load 5 µL for LC-MS analysis (Waters ACQUITY UPLC® BEH C18, 1.7 µm, 2.1 × 100 mm column): 0–2.0 min, 5% acetonitrile (v / v); 2.0–41.0 min, 5–55% acetonitrile (v / v); 41.0–41.1 min, 55–100% acetonitrile (v / v); 41.1–47.0 min, 100% acetonitrile (v / v); 47.0–47.1 47.1-50.0 min, 95% acetonitrile (v / v); 5% acetonitrile (v / v), flow rate 0.3 mL / min. Compound 8 was produced for heterologous expression strains containing pasAD. pasABD The heterologous expression strains produced compounds 8 and 1, such as Figure 11 .

[0111] 5. In vivo feeding experiment

[0112] a. Dissolve compound 8 in DMSO to a concentration of 200 mM and use it as a substrate.

[0113] b. pasB Heterologous expression strains A.nidulans A1145 / feed B (import method is the same as step 4 in Example 3) was transferred to 20 mL of CD-ST liquid culture medium and cultured on a shaker at 28°C and 200 rpm for 2 days.

[0114] c. Add the substrate stock solution to the culture medium to a final concentration of 200 µM. Use DMSO as the control instead of the substrate.

[0115] d. Depending on the experimental requirements, samples can be taken at 4 h, 8 h, 12 h, 24 h and 48 h after feeding the substrate.

[0116] e. The extraction and analysis methods were consistent with those described above (Example 3, Heterologous Expression of Correctly Sequencing Plasmids, f). For heterologous expression strains containing pasB, compound 8 was fed, and sampling and detection began 4 h later, yielding compound 1, as shown in the image. Figure 12 .

[0117] CDS medium formulation: 10 g glucose, 218.6 g sorbitol, 50 mL 20× Nitrate salts, 1 mL Trace Elements, 20 g agar, add water to a final volume of 1 L, pH 6.5, autoclave at 121℃ for 15 min.

[0118] CD medium formula: 10 g glucose, 50 mL 20× Nitrate salts, 1 mL Trace Elements, 20 g agar, add water to a final volume of 1 L, pH 6.5, autoclave at 121℃ for 15 min.

[0119] CD-ST liquid culture medium formula: 20 g soluble starch, 20 g casein acid hydrodysate (vitamin free), 50 mL 20× Nitrate salts, 1 mL Trace Elements, add water to a final volume of 1 L, pH 6.5, autoclave at 121℃ for 15 min.

[0120] 20× Nitrate salts: 120 g NaNO3, 10.4 g KCl, 10.4 g MgSO4•7H2O, 30.4 g KH2PO4 were diluted to 1000 mL with distilled water.

[0121] Trace Elements: 2.20 g ZnSO4·7H2O, 1.10 g H3BO3, 0.50 g MnCl2·4H2O, 0.16 gFeSO4·7H2O, 0.16 g CoCl2·5H2O, 0.16 g CuSO4·5H2O, 0.11 g (NH4)6Mo7O 24 • 4H2O, adjust pH to 6.5, add double-distilled water to bring the volume to 100 mL.

[0122] Example 4: Microsomal assay to determine the function of protein pasB

[0123] a. Gene pasB The encoded protein (SEQ ID NO.5) is a membrane protein. Referring to step 4 of Example 3, the constructed recombinant strain A. nidulans A1145 / pasB was transferred to 30 mL of CD-ST liquid medium and cultured in a shaker at 28°C and 200 rpm for 2.5 days.

[0124] b. After centrifugation at 12000 rpm for 5 min, remove the culture medium and grind the bacterial cells into powder using liquid nitrogen.

[0125] c. Transfer the bacterial cell powder to a 15 mL centrifuge tube, add 10 mL of Buffer A (0.6 M sorbitol, 0.1 M KCl, 1.0 mM EDTA, 1.0 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 50 mM Tris-HCl, pH 7.5), and mix well.

[0126] d. Dispense into 1.5 mL centrifuge tubes, adding 1 mL of sample suspension to each EP tube.

[0127] e. 15000 rpm, 4℃, 10 min, transfer the supernatant to a new EP tube.

[0128] f. 15000 rpm, 4℃, 8 h, discard the supernatant, and slowly aspirate the remaining liquid with a pipette tip.

[0129] g. The prepared microsomes were collected into a 1.5 mL centrifuge tube using 400 µL of Buffer B (volume ratio of 20% glycerol, 1.0 mM EDTA, 1.0 mM MTT, 50 mM Tris-HCl, pH 7.5) for in vitro reaction and subsequent storage.

[0130] h. Prepare the enzyme reaction system: 100 µL microsomes, 200 µM NADH, 200 µM NADPH, 200 µM FAD, 200 µM FMN, 40 µM substrate compound 8 (with DMSO as a control).

[0131] i. Incubate at 30℃ and 300 rpm for 12 h.

[0132] j. Add 100 µL of methanol to stop the reaction, vortex, centrifuge at 12000 rpm for 5 min, and analyze the sample (method is the same as in Example 3, heterologous expression of the correctly sequenced plasmid, f).

[0133] The results are as follows Figure 13 The protease PasB converts compound 8 into the final product 1.

[0134] Example 5: Insect-resistant and antibacterial effects of pyrrole alkaloids

[0135] 1. The effect of the compound on the diamondback moth, a lepidopteran pest.

[0136] Based on previously reported methods ( J. Agric. Food. Chem. 2025, 73 (21), 12563-12569.), evaluating compounds 1, 8 and 13 against the diamondback moth, a lepidopteran pest. P. xylostella The lethal activity of the compound was determined. Specifically, diamondback moth larvae were cultured in an artificial diet environment at 26°C, 70% relative humidity, and 16 h light / 8 h dark. Starting from the first day of the second instar, larvae were fed a diet containing 5 mM of the compound. The test compound was dissolved in ethanol and mixed with the artificial diet to obtain a diet containing 5 mM of the compound. The negative control group (NC) was fed the ethanol-treated artificial diet, and the positive control group (PC) was fed a diet containing 5 mM diflubenzuron (DFB). Ten larvae were included in each group. Development and mortality were recorded daily until the control group larvae molted to the final instar.

[0137] The results showed that compound 1 had the most significant lethal effect on diamondback moths, with all moths dying by day 5 of feeding; compound 8 had an effect comparable to the positive control DFB, with all moths dying by day 6; compound 13 showed some effect, with a mortality rate of up to 60% by day 6. Figure 16 .

[0138] 2. The effect of the compound against plant pathogenic fungi

[0139] The inhibitory effects of compounds on plant pathogenic fungi were assessed using the filter paper disc method and the two-fold dilution method (CLSI, Methods for dilution antimicrobial susceptibility tests for bacteria that growaerobically; approved standard — ninth edition. CLSI document M07-A9. Wayne, PA: Clinical and Laboratory Standards Institute. 2012.). First, the sensitivity of plant pathogens to the tested compound was tested using the filter paper disc method. Each filter paper disc contained 10 μg of the compound and was placed on potato dextrose agar (PDA) plates inoculated with the pathogenic fungus. After incubation at 28°C for 48 h, the inhibition zone was observed to determine the sensitivity of the strain to the tested compound. Sensitive strains were selected, and the minimum inhibitory concentration of the compound was further tested by two-fold dilution in 96-well plates. Nystatin was used as a positive control for antimicrobial activity.

[0140] The results showed that among the tested compounds (1-3, 5-9, 12-15), compound 1 exhibited the best inhibitory activity, and it was effective against *Citrus aurantium*. Penicillium digitatum PD01 and tomato gray mold Botrytis cinerea pers PC01 is quite sensitive to it. Further testing of inhibitory activity using the two-fold dilution method showed that, in addition to compound 1 achieving an inhibition rate of 60% at 8 μg / mL, compounds 2 and 7 also showed some inhibitory effects, such as... Figure 17 and Figure 18 .

[0141] In summary, this invention provides a biosynthetic gene cluster of pyrrole alkaloids with chitinase inhibitory activity and a method for preparing derivatized compounds using synthetic biology methods through heterologous expression, in vivo feeding experiments, and microsomal reactions. This is of great significance for the in-depth development of this active lead compound.

[0142] The sequences SEQ ID NO.1-6 of this invention are shown in the sequence list. SEQ ID NO.2 corresponds to sequence number [ID]2 in the sequence list, SEQ ID NO.3 corresponds to sequence number [ID]3 in the sequence list, SEQ ID NO.4 corresponds to sequence number [ID]4 in the sequence list, SEQ ID NO.5 corresponds to sequence number [ID]5 in the sequence list, and SEQ ID NO.6 corresponds to sequence number [ID]6 in the sequence list. Because SEQ ID NO.1 is too long to upload, the applicant split it into two sequences for upload. The complete sequence is sequence number [ID]1 (4702 bp) and [ID]7 (6998 bp) in the sequence list connected in sequence, totaling 11700 bp.

Claims

1. Pyrrole alkaloids or medicinal salts with structures as shown in any of formula (Ⅰ): ； Equation (Ⅰ).

2. The biosynthetic gene cluster for synthesizing the pyrrole alkaloids of claim 1, characterized in that, It includes the following three genes, namely: pasA The gene and nucleic acid sequence are shown in SEQ ID NO.1; pasB The gene and nucleic acid sequence are shown in SEQ ID NO. 2; pasD The gene and its nucleic acid sequence are shown in SEQ ID NO.

3.

3. A protease for synthesizing the pyrrole alkaloid compound of claim 1, characterized in that, The amino acid sequences are proteases PasA, PasB, and / or PasD, wherein the amino acid sequence of PasA is shown in SEQ ID NO.4, the amino acid sequence of PasB is shown in SEQ ID NO.5, and the amino acid sequence of PasD is shown in SEQ ID NO.

6.

4. The use of the biosynthetic gene cluster of claim 2 or the protease of claim 3 in the preparation of the pyrrole alkaloid compound of claim 1.

5. The method for preparing the pyrrole alkaloid compound according to claim 1, characterized in that, Includes the following steps: From Penicillium citrinum SCSIO DF147 or its mutant strain Penicillium citrinum It was prepared and isolated from the fermentation broth of SCSIO DF147 / ΔpasB. Penicillium citrinum Compounds 1-13 were isolated from the fermentation broth of SCSIO DF147. Penicillium citrinum Compounds 6, 8, 13, 14, and 15 were prepared and isolated from the fermentation broth of SCSIO DF147 / ΔpasB.

6. pasA Genes and pasD The use of gene combination or the combination of pasA protein and pasD protein in the preparation of compound 8 of claim 1. pasA The nucleic acid sequence of the gene is shown in SEQ ID NO.

1. pasD The nucleic acid sequence of the gene is shown in SEQ ID NO.3, the amino acid sequence of the pasA protein is shown in SEQ ID NO.4, and the amino acid sequence of the pasD protein is shown in SEQ ID NO.

6.

7. pasA Gene, pasB Genes and pasD The use of gene combination or the combination of pasA protein, pasB protein, and pasD protein in the preparation of compound 8 and compound 1 of claim 1. pasA The nucleic acid sequence of the gene is shown in SEQ ID NO.

1. pasB The nucleic acid sequence of the gene is shown in SEQ ID NO.

2. pasD The nucleic acid sequence of the gene is shown in SEQ ID NO.3, the amino acid sequence of the pasA protein is shown in SEQ ID NO.4, the amino acid sequence of the pasB protein is shown in SEQ ID NO.5, and the amino acid sequence of the pasD protein is shown in SEQ ID NO.

6.

8. Use of protein PasB in converting compound 8 of claim 1 into compound 1 of claim 1, the amino acid sequence of PasB being shown in SEQ ID NO.

5.

9. The use of the pyrrole alkaloid compound of claim 1 in the preparation of chitinase inhibitors, inhibitors of the lepidopteran pest diamondback moth, and / or inhibitors of plant pathogenic fungi, wherein the chitinase is Asian corn borer chitinase II (OfChtII) and / or Asian corn borer chitinase h (OfChi-h), and the plant pathogenic fungus is *Citrus aurantium*. Penicillium digitatum PD01 and / or tomato gray mold Botrytis cinerea pers PC01.

10. A biological agent, characterized in that, This includes pyrrole alkaloids 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14 and / or 15 as described in claim 1, or their pharmaceutical salts.

Images