Engineering saccharomycetes for synthesizing plasmalogen as well as construction method and application of engineering saccharomycetes

Abstract

The invention relates to engineering saccharomycetes for synthesizing plasmalogen as well as a construction method and application thereof, and belongs to the technical field of microbial engineering, chassis cells of the engineering saccharomycetes are yarrowia lipolytica, and CarF genes of aldolase are integrated at URA sites of yarrowia lipolytica genes. The nucleotide sequence of the gene CarF is shown as SEQ ID NO: 1 or a degenerate sequence of the SEQ ID NO: 1, or a base sequence having more than 80% of sequence identity with the SEQ ID NO: 1 and a corresponding amino acid sequence of the base sequence. According to the engineering saccharomycetes PG01, the yield of plasmalogen is 0.21 mg / g protein and is increased by one time compared with the yield of wild saccharomycetes.

Description

An engineered yeast strain for synthesizing acetal phospholipids, its construction method, and its applications. Technical Field

[0001] This invention belongs to the field of microbial engineering technology, specifically relating to an engineered yeast strain for synthesizing acetal phospholipids, its construction method, and its applications. Background Technology

[0002] Plasmalogens are a special class of glycerophospholipids that link a fatty alcohol at the sn-1 position via a vinyl ether bond, rather than a traditional acyl bond. This unique chemical structure endows them with important biological functions. Plasmalogens are abundant in various mammalian tissues, particularly in the brain, heart, kidneys, and immune cells. They play a crucial role in the structure and function of cell membranes, influencing not only membrane fluidity and permeability but also acting as endogenous antioxidants to protect cells from oxidative stress damage. Furthermore, phosphatologens are closely related to a variety of physiological processes, including cell signaling, membrane fusion, and lipid raft formation.

[0003] Abnormal changes in phosphatidylcholine levels are associated with the occurrence and development of various diseases. For example, in neurodegenerative diseases such as Alzheimer's and Parkinson's, phosphatidylcholine levels in the brains of patients are significantly reduced. Similarly, cardiovascular diseases, inflammatory bowel disease, and certain types of cancer are also related to phosphatidylcholine metabolic disorders. Therefore, supplementing or regulating phosphatidylcholine levels in the body can improve these conditions to some extent, potentially providing a new approach for the treatment and prevention of these diseases.

[0004] Extracting phospholipids from natural sources (such as shellfish, fish oil, and animal offal) is currently a widely used method. However, this method has drawbacks such as low purity, high cost, limited yield, and susceptibility to environmental pollution. Furthermore, phospholipids from natural sources are often mixtures of multiple structures, making it difficult to obtain a single, high-purity specific phospholipid.

[0005] To overcome the limitations of natural sources, researchers have developed various synthetic methods to prepare acetals. These methods aim to achieve large-scale, controlled, and high-purity production. Chemical synthesis can yield acetals with well-defined structures and high purity. However, chemical synthesis processes typically require multiple steps, harsh conditions, involve toxic reagents, and have low yields. Furthermore, chemical synthesis is difficult to scale up in the laboratory, limiting its industrial application. In recent years, the use of microorganisms, particularly yeast, as "cell factories" for acetal synthesis has attracted widespread attention. Yeast, as a model microorganism, has advantages such as simple genetic manipulation, rapid growth, low cost, and ease of large-scale fermentation. By modifying the lipid metabolism pathways of yeast through genetic engineering, the targeted synthesis of specific acetals can be achieved. Summary of the Invention

[0006] The purpose of this patent is to provide an efficient, economical, and environmentally friendly method for synthesizing phospholipids from yeast. By systematically modifying the metabolic activity of yeast host cells, the key enzyme activities for phospholipid synthesis are introduced or enhanced, achieving high-level accumulation of specific phospholipids. This overcomes the problems of high extraction costs, complex chemical synthesis, and low yields in existing technologies, providing a feasible technical route for the industrial production of phospholipids.

[0007] The technical solution of the present invention is summarized as follows: an engineered yeast strain for synthesizing acetal phospholipids, wherein the chassis cells are Yersinia lipolytica, and the CarF gene of acetalase is integrated into the URA site of the Yersinia lipolytica gene.

[0008] The engineered strain described above is characterized by the introduction of the acetalase CarF into the strain.

[0009] Preferably, the nucleotide sequence of the gene CarF is as shown in SEQ ID NO:1 or its degenerate sequence, or the base sequence and its corresponding amino acid sequence having more than 80% sequence identity with SEQ ID NO:1.

[0010] The present invention also provides a method for constructing the engineered yeast strain that synthesizes acetal phospholipids, wherein the method involves using Yersinia lipolyticis as the chassis cell and integrating the CarF gene of acetalase into the URA site of the Yersinia lipolyticis gene to obtain the engineered yeast strain.

[0011] Furthermore, gene integration is achieved by utilizing the cell transposition system to express the CarF gene module.

[0012] Furthermore, the gene expression promoter that can be used in the above gene expression module is TEF1in.

[0013] Furthermore, the gene expression terminator that can be used in the above gene expression module is CYC1.

[0014] Preferably, the base sequence of the gene CarF is as shown in SEQ ID NO:1 or its degenerate sequence, or the base sequence and its corresponding amino acid sequence having more than 80% sequence identity with SEQ ID NO:1.

[0015] Furthermore, an expression module for the CarF gene is prepared, which contains a promoter and a terminator. Then, competent cells are prepared from the CarF gene expression module using the lithium acetate method, electroporation method, or protoplast method.

[0016] The present invention also provides the application of the engineered yeast strain in the preparation of phospholipid acetal.

[0017] The present invention also improves a composition of acetal phospholipids, said composition comprising acetal phospholipids prepared using the engineered yeast.

[0018] The beneficial effects of this invention compared with the prior art are as follows: the phospholipid yield of the engineered yeast strain PG01 described in this invention is 0.21 mg / g protein, which is 1 times higher than that of the wild type. Attached Figure Description

[0019] Figure 1 shows the yield of acetal phospholipids in the fermentation broth. WT is the wild-type Yersinia lipolytica strain, and PG01 is the modified engineered yeast strain. Detailed Implementation

[0020] The technical solution of the present invention will be further studied through the following embodiments, but the scope of protection of the present invention is not limited in any way by the embodiments.

[0021] Example 1: An engineered yeast strain for synthesizing acetal phospholipids, with chassis cells being *Yersinia lipolytica* (Shanghai Preservation Microbial Co., Ltd., SMHCC D25204), and the exogenous acetalase CarF gene integrated into the URA site of the *Yersinia lipolytica* gene.

[0022] As described above, the engineered strain was knocked into the strain with the acetalase CarF.

[0023] Preferably, the base sequence of the gene CarF is as shown in SEQ ID NO:1 or its degenerate sequence.

[0024] Specifically, the gene encoding the (acetalase) protein has a nucleotide sequence shown in SEQ ID NO.1, or a nucleotide sequence having more than 80% sequence identity with the nucleotide sequence shown in SEQ ID NO.1, that encodes a protein with acetal phospholipid synthesis activity.

[0025] When the gene encoding the protein (acetalase) according to this embodiment contains a nucleotide sequence that has more than 80% sequence identity with respect to the base sequence shown in SEQ ID NO. 1, as long as the protein has the above-mentioned acetal phospholipid synthesis activity, in addition to having an amino acid sequence for improving translation efficiency, it may also have an amino acid sequence for purifying the protein and an amino acid sequence for improving the expression efficiency of molecular chaperones, etc.

[0026] Amino acid sequences used for protein (acetalase) purification, such as histidine tags, SUMO tags, glutathione S-transferases, and maltose-binding proteins, are added to at least one side of the N-terminus and C-terminus to improve translation efficiency, improve purification efficiency, and improve expression efficiency.

[0027] Next, the preparation method for knocking in the acetalase gene according to this embodiment will be described. Proteins can be chemically synthesized using known methods such as solid-phase and liquid-phase methods based on their amino acid sequence. As shown below, the protein is preferably prepared using methods of genetic engineering and molecular biology.

[0028] First, the base sequence of the polynucleotide encoding the protein is determined. The base sequence is determined by codons corresponding to amino acids. Based on the correspondence between amino acids and codons, a number of base sequences encoding that amino acid sequence are determined from a single amino acid sequence. Considering factors such as the frequency of codon usage in the chassis cell used to express the gene encoding that amino acid sequence, a suitable base sequence encoding the protein can be determined. The polynucleotide can be synthesized based on the base sequence using known methods.

[0029] Next, a knock-in vector comprising a polynucleotide encoding a protein is constructed. There are no particular restrictions on the expression vector as long as it can knock the polynucleotide into the host genome. Preferably, the knock-in vector includes an RNA polymerase-binding promoter sequence for expressing the added polynucleotide, a ribosome binding site (RBS), a nutrient selection tag, etc. In the expression vector, the aforementioned polynucleotide can be configured under the control of the promoter sequence. Known promoter sequences such as the TEF1in strong promoter are used as promoter sequences. If necessary, restriction enzyme sites for cloning can be added to the 5' and 3' ends of the polynucleotide encoding the protein, or base sequences encoding histidine tags, SUMO tags, etc., can be added to the 5' end of the polynucleotide encoding the protein. When using restriction enzymes, the base sequences of the restriction enzyme sites contained in the polynucleotide encoding the protein can be synonymously substituted. Known terminator sequences such as the CYC1 terminator are used as terminator sequences.

[0030] The above expression vector was introduced into Yersinia lipophila, a host yeast capable of expressing RNA polymerase that binds to the above promoter sequence.

[0031] Next, transformants are prepared by introducing the expression vector prepared above into chassis cells. There are no particular limitations on the method for introducing the knock-in vector into chassis cells, including using competent cells prepared by lithium acetate method, electroporation method, and protoplast method.

[0032] Regarding the culture method of chassis cells, when using Yersinia lipophila as chassis cells, they can be cultured, for example, in YPD agar medium or YPD liquid medium.

[0033] Example 2: Acetal phospholipids belong to a specific subclass of glycerophospholipids, possessing a vinyl ether bond at the sn1 position and an ester bond at the sn2 position of the glycerol backbone. In this example, there are no particular limitations as long as the acetal phospholipid is a glycerophospholipid commonly classified as an acetal phospholipid. Examples of acetal phospholipids include ethanolamine-type acetal phospholipids (Pls), choline-type acetal phospholipids (PlsCho), inositol-type acetal phospholipids, and serine-type acetal phospholipids. Furthermore, Pls has a CH2CH bonded to the oxygen atom bonded to phosphorus at the sn3 position of the glycerol backbone. 22 The structure of NH2. PlsCho has a structure in which CH2CH2N(CH3)3 is bonded to the oxygen atom bonded to phosphorus at the sn3 position of the glycerol backbone. The acetal phospholipids synthesized according to the transformant of this embodiment have a wide variety of carbon atoms constituting the carbon chain bonded to the oxygen atom at the sn1 position, including acetal phospholipids with a number of carbon atoms not found in mammals, in addition to those found in mammals.

[0034] The engineered bacteria with the knock-in acetalase gene can be separated into precipitates by centrifugation of the culture medium.

[0035] Processed products of bacterial cells include, for example, freeze-dried bacterial cells, bacterial cells dried with acetone, extracts obtained by solvent extraction of bacterial cells, and fragments obtained by pulverizing or drying bacterial cells using ultrasonic methods, bacterial cells obtained through some treatment, and compositions derived from or including a portion of bacterial cells. As solvents for solvent extraction, water, organic solvents, and mixtures thereof can be used. Examples of organic solvents include diethyl ether, chloroform, benzene, hexane, methanol, ethanol, isopropanol, and mixed solutions thereof. Extracts obtained using extraction solvents can be used as is, or concentrated or diluted, and used in liquid, gel, or paste form. Furthermore, dried products can also be used. Drying can be carried out using known methods such as spray drying, freeze drying, vacuum drying, and fluidized bed drying.

[0036] The composition containing phosphatidylcholine according to this embodiment contains phosphatidylcholine synthesized by engineered yeast. Therefore, the composition containing phosphatidylcholine is suitable for externally supplementing phosphatidylcholine in organisms. For example, the composition containing phosphatidylcholine is used to treat and prevent diseases caused by a reduction in phosphatidylcholine. Examples of such diseases include inflammatory diseases, inflammatory diseases of the central nervous system, dementia, Parkinson's disease, depression, schizophrenia, diabetes, metabolic syndrome, ischemic heart disease, infectious diseases, and immune abnormalities.

[0037] Example 3: Strain construction was carried out using a gene-deficient strain of Yersinia lipophila as the starting strain and the modified pINA1312 as the knock-in plasmid.

[0038] Using the pINA1312 empty plasmid backbone as the basic vector, the plasmid was linearized using p13hzetab-F, p13hzetab-R, p13hzetah-F, and p13hzetah-R. The linearized amplified products were successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0039] Based on the URA region sequence of *Yarrowia lipolyticis*, homologous recombination primers, YliURAHRp13b-F, YliURAHRp13b-R, YliURAHRp13h-F, and YliURAHRp13h-R, were designed (primer sequences are shown in Table 3), and PCR amplification was performed. The amplified product of the insert fragment was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The target fragment with upstream and downstream homologous arms was obtained.

[0040] The ligation reaction was performed using the purchased ClonExpress® Ultra One Step Cloning Kit V2. The ligation system was prepared according to the kit instructions. The PCR-linearized plasmid and product were mixed thoroughly, and the mixture was placed in the PCR instrument. The temperature was set to 50°C and the reaction time was 20 min.

[0041] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 minutes. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 seconds, and immediately cool on ice for 2 minutes. Add 500 μl of LB liquid medium to the tube and incubate at 37°C and 220 rpm for 1 hour. Finally, plate the mixture onto LB agar plates containing kanamycin and incubate overnight at 37°C.

[0042] Using the purchased plasmid extraction kit, the successfully constructed plasmid was extracted following the instructions in the kit's manual. The plasmid pINA1312-u was obtained.

[0043] Table 1 shows the primers for pINA1312 modification. .

[0044] The plasmid pINA1312-u was digested with BamH Ⅰ endonuclease. The digestion system consisted of 1 μg of pINA1312-u plasmid, 5 μl of 10×NE Buffer, 2 μl of BamH Ⅰ, and ddH2O. The mixture was then suspended and incubated overnight in a water bath at 37°C.

[0045] Based on the CDS sequence of CarF, homologous recombination primers were designed for PCR amplification. The amplified product of the insert fragment was successfully obtained by PCR. The PCR reaction program was: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The target fragment, along with its upstream and downstream homologous arms, was obtained.

[0046] The ligation reaction was performed using the ClonExpress® Ultra One Step Cloning Kit V2. Following the ligation system described in the kit instructions, the linearized plasmid digested with BamH I restriction enzyme was mixed with the product. The mixture was then placed in a PCR instrument at 50°C for 20 min.

[0047] Gently mix 10 μl of the ligation product with 100 μl of DH5α competent cells in a pre-chilled 1.5 ml centrifuge tube and incubate on ice for 30 min. Then, transfer the centrifuge tube to a 42°C water bath for heat shock for 45 s, and immediately cool on ice for 2 min. Add 500 μl of LB liquid medium to the tube and incubate at 37°C, 220 rpm for 1 h. Finally, plate the mixture onto LB agar plates containing kanamycin and incubate overnight at 37°C.

[0048] The specific experimental steps for transforming the vector plasmid pINA1312-u-CarF into *Yarrowia lipolytica* strain using the lithium acetate conversion method are as follows: 1. In 20 ml of YPD liquid medium, a single colony of *Yarrowia lipolytica* was cultured overnight in a shaker at 30°C; 2. 200 μl of the bacterial culture was transferred to another 20 ml of YPD liquid medium and incubated in a shaker at 30°C for 4-5 h until OD (digestion occurred). 600 Approximately 0.6~0.8; 3. Collect bacterial cells using a 1.5 ml centrifuge tube, add 1 ml of 100mM LiAc to suspend the bacterial cells, centrifuge at 8000 rpm for 15 s, and aspirate the supernatant; 4. Add reagents to the tube in the following order and volume: 240 μl 50% PEG3350, 36 μl 1M LiAC, 25 μl ssDNA, 10 μl linearized plasmid, and ddH2O to make up to 360 μl. Vortex to mix well and incubate at 30℃ for 30 min; 5. Place the sample in a 42℃ water bath for 30 min of heat shock treatment, followed by centrifugation at 8000 rpm for 30 s, and discard the supernatant. Resuspend the bacterial cells in 1 ml of YPD medium and incubate at 28℃ in a shaker for 2 h. After resuscitation, the bacterial culture was centrifuged at 8000 rpm for 1 min; 6. 200 μl of ddH2O was used to suspend the bacterial cells and spread them on uracil-deficient medium and incubated upside down for 2 to 3 days.

[0049] Single clones were selected from plates from strains grown after screening on uracil-deficient media and cultured in 300 μl of YPD liquid medium to obtain engineered yeast PG01.

[0050] Example 4: Fermentation of the strain. The engineered yeast obtained in Example 3 was inoculated into 5 ml of YPD liquid medium and cultured at 30℃ and 250 rpm / min for 18 h to prepare a primary seed culture; at the same time, the wild strain Yersinia lipolyticis was set up as a control group.

[0051] In a preferred embodiment, the prepared primary seed culture is inoculated into 50 ml of YPD liquid medium at an inoculation ratio of 1%, and cultured at 30°C and 250 rpm / min for 18 h to prepare a secondary seed culture. In another preferred embodiment, the prepared secondary seed culture is inoculated into a container containing 3 l of YPD liquid medium, and the initial OD of the fermentation suspension is controlled. 600 =0.1, and then cultured at 30℃ and 250 rpm / min for 48 h to obtain fermentation broth.

[0052] Example 5: Determination of Phospholipid Acetal 10 ml of the fermentation broth prepared in Example 4 was taken and lyophilized. The total weight of the thawed cells was measured. 1 ml of water was added to the cells and mixed, followed by 3.75 ml of chloroform / methanol (1:2, v / v) and mixed. The mixture was sonicated for 10 min and then placed at room temperature for 30 min. 1.25 ml of chloroform was added, followed by 1.25 ml of water. The mixture was centrifuged, and the chloroform layer was transferred to a glass tube. The remaining aqueous layer was extracted with 2 ml of chloroform. The combined chloroform layers were dried under nitrogen and resuspended in hexane / isopropanol (3:2, v / v) until the cell concentration reached 120 mg / ml. The mixture was then filtered through a 0.45 μm filter. 10 μl of the cell suspension was injected into a high-performance liquid chromatograph (HPLC) and detected using an evaporative light scattering detector (ELSD).

[0053] As a lipid standard, phosphatidylcholine was dried under nitrogen, and 1 ml of isopropanol / chloroform (2:1, v / v) was added and mixed. The sample was dissolved by sonication and stored at 20°C as a lipid stock. The lipid stock was serially diluted with HIP (hexane / isopropanol (3:2, v / v)) to prepare a lipid standard solution. The lipid standard solution was passed through a 0.45 μm microporous filter, and 10 μl was taken as the sample for HPLC.

[0054] The HPLC conditions are as follows.

[0055] Column: Lichrosphere DIOL (250 × 3 mm, 5 μm, prepared by Merck); Mobile phase A: hexane / isopropanol / acetic acid (82:17:1) containing 0.08% triethylamine; Mobile phase B: isopropanol / water / acetic acid (85:14:1) containing 0.08% triethylamine; Flow rate: 0.8 ml / min; Column temperature: 50℃; Gradient: 0 min Mobile phase A 96% Mobile phase B 4%; 21 min Mobile phase A 63% Mobile phase B 37%; 25 min Mobile phase A 15% Mobile phase B 85%; 26 min Mobile phase A 15% Mobile phase B 85%; 29 min Mobile phase A 96% Mobile phase B 4%; 34 min Mobile phase A 96% Mobile phase B 4%; ELSD conditions are as follows: evaporator temperature: 60℃; atomizer temperature: 30℃; nitrogen flow rate: 1.00SL.

[0056] The results are shown in Figure 1. The phospholipid content was 0.21 mg / g protein.

[0057] SEQ ID NO.1 CarF:atgcgttcccagtcccgaaagaacctcgtgctgcagtcccagggctctatgctggaggaggacatgaacggcaacaacgagaacaccctctcttccaagccccgatggggccctaacaccaagggcgccaagaccctgaagcagctgtacacccctggcaagcgaatccaggagcttatcaccttctacctctgtaacgtgctgatcgtctggcacatctactacatcatccgacacgtcgagtgcggttctattgtctccaccttctctgccctgttcctcggtattctgtccgccgacttcgcctccggtttcgttcactgggccgctgactcctggggctccgtccagctgcccgtcgtcggcaaggccttcatccgacccttccgagagcaccatatcgaccccaccgctattacccgacacgacatgatcgagactaacgccgacaacttcatgctggccatcctgcccatctccctgtgcatctaccttttctacacccgacccgacgaggtttcctctttctacaacttctccgtgtacgtctggttcttcatggttttcgtctgtctcaccaaccagatccacaagtggtctcacacctacttcggcctcccttcctgggtcaccgtgctccagaagctgcacctcatcctccccaagcagcaccaccgaatccaccacatcgctccccacgagacctacttctgtatcaccaccggatggctgaactggcccctggagaagctgcagttctggtccaccctcgagaactgcattaccgtcgtgaccggtgtcaagccccgaaccgacgacctgaagtgggctaagggtggtgccatgtaa。

Claims

1. An engineered yeast strain for synthesizing acetal phospholipids, characterized in that, The chassis cells of the engineered yeast are *Yersinia lipolytica*, and the CarF gene of the acetalase is integrated into the URA site of the *Yersinia lipolytica* gene.

2. The engineered yeast according to claim 1, characterized in that, The nucleotide sequence of the gene CarF is as shown in SEQ ID NO:1 or its degenerate sequence, or the base sequence and its corresponding amino acid sequence that have more than 80% sequence identity with SEQ ID NO:

1.

3. The method for constructing the engineered yeast according to claim 1 or 2, characterized in that, The method involves using *Yersinia lipolytica* as the chassis cell and integrating the CarF gene of acetalase into the URA site of the *Yersinia lipolytica* gene to obtain the engineered yeast.

4. The method according to claim 3, characterized in that, Gene integration is achieved by using homologous recombination of the CarF gene expression module.

5. The method according to claim 3, characterized in that... An expression module for the CarF gene was prepared, the expression module containing a promoter and a terminator, and then competent cells were prepared from the CarF gene expression module by lithium acetate method, electroporation method or protoplast method.

6. The method according to claim 5, characterized in that, The gene expression module uses TEF1in as the gene expression promoter.

7. The method according to claim 5, characterized in that, The gene expression module uses CYC1 as the gene expression terminator.

8. The use of the engineered yeast of claim 1 or 2 in the preparation of phospholipid acetal.

9. A composition of acetal phospholipids, said composition comprising acetal phospholipids prepared using the engineered yeast of claim 1 or 2.

Images