Pseudo-ginseng NBS-LRR coding gene PnCNL11 as well as application and verification method thereof

By cloning and expressing the PnCNL11 gene encoding the NBS-LRR of Panax notoginseng, the problem of root rot prevention and control was solved, the resistance to root rot pathogens was enhanced, a reference for breeding disease-resistant varieties was provided, and the negative effects of chemical fungicides were avoided.

CN121950837APending Publication Date: 2026-05-01YUNNAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YUNNAN AGRICULTURAL UNIVERSITY
Filing Date
2026-02-03
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Root rot of Panax notoginseng seriously affects its yield and quality. Existing chemical fungicide control methods have problems with residual toxicity and pathogen resistance, and there is a lack of effective disease-resistant gene resources.

Method used

The PnCNL11 gene encoding the NBS-LRR of Panax notoginseng was cloned, and its heterologous expression and transient interference in plants were verified by constructing overexpression vectors and RNAi interference vectors to enhance resistance against root rot pathogens.

Benefits of technology

The study verified that the PnCNL11 gene enhances the resistance of Panax notoginseng to root rot pathogens, providing a reference for the breeding of superior disease-resistant Panax notoginseng varieties and reducing the risks associated with the use of chemical fungicides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950837A_ABST
    Figure CN121950837A_ABST
Patent Text Reader

Abstract

The invention discloses a pseudo-ginseng NBS-LRR coding gene PnCNL11 as well as application and a verification method of the pseudo-ginseng NBS-LRR coding gene PnCNL11. The nucleotide sequence of the pseudo-ginseng NBS-LRR coding gene PnCNL11 is SEQ ID NO: 1. The invention further discloses application of the NBS-LRR coding gene PnCNL11 of the pseudo-ginseng in improving the resistance of the pseudo-ginseng to pathogenic bacteria of root rot. The application verification method comprises the following steps: separating the NBS-LRR coding gene PnCNL11, verifying that the PnCNL11 has a positive regulation effect on infection of pathogenic bacteria of the root rot of the panax notoginseng by utilizing heterologous overexpression of tobacco and an RNAi interference experiment in the panax notoginseng, and enhancing the resistance of the root rot of the panax notoginseng by utilizing the NBS-LRR coding gene PnCNL11 of the panax notoginseng.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, and in particular to a Panax notoginseng NBS-LRR encoding gene PnCNL11, its application, and a method for its verification. Background Technology

[0002] Currently, Panax notoginseng (Burk.) F. H. Chen, a perennial herb belonging to the Araliaceae family and the Panax genus, possesses properties such as dispersing blood stasis, stopping bleeding, reducing swelling, and relieving pain. It has been cultivated in my country for over 400 years. With the deepening research into the medicinal value of Panax notoginseng, its market demand continues to increase. However, the expanding area of ​​artificial cultivation has led to severe disease outbreaks, coupled with the impact of continuous cropping obstacles, resulting in a significant decline in both yield and quality. Breeding disease-resistant varieties of Panax notoginseng is an effective strategy to solve the problem of root rot, and the discovery of disease-resistant genes is a crucial step in disease-resistant breeding of Panax notoginseng.

[0003] Through long-term interaction with pathogens, plants have evolved an effective self-protection mechanism to resist pathogen invasion and damage. Currently, over 300 R genes have been cloned from plants. The largest class of R genes is the NLR gene, named for its encoding of nucleotide-binding sites (NBS) and leucine-rich repeat (LRR) domains. The N-terminal domains of NLR-encoded proteins are diverse, including the Toll / interleukin-1 receptor (TIR) ​​domain, the Coiled-coil (CC) domain, and the Resistance to Powdery Mildew 8 (RPW8) domain. The LRR domain is responsible for directly or indirectly recognizing effectors; the NB-ARC region has ATG-binding activity that regulates NLR activation, acting on the transduction of resistance signals and thereby activating the plant's immune response, playing a crucial role in plant resistance against various pathogens; the N-terminal domain participates in downstream signal transduction after NLR activation.

[0004] The current prevention and control methods for root rot of Panax notoginseng mainly involve the use of fungicides. However, chemical fungicides may cause problems such as affecting the quality of Panax notoginseng and increasing the drug resistance of pathogens due to their residual toxicity. Summary of the Invention

[0005] The purpose of this invention is to provide a method for enhancing the resistance of Panax notoginseng to root rot by utilizing the Panax notoginseng NBS-LRR encoding gene PnCNL11.

[0006] The above-mentioned technical objective of the present invention is achieved through the following technical solution: A Panax notoginseng NBS-LRR encoding gene, PnCNL11, has the nucleotide sequence shown in SEQ ID NO:1.

[0007] More preferably, the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2, and the protein has a CC domain, an NB-ARC domain and an LRR domain, belonging to the CNL type NLR protein.

[0008] This invention also provides the application of the Panax notoginseng NBS-LRR encoding gene PnCNL11 in improving the resistance of Panax notoginseng to root rot pathogens.

[0009] More preferably, the root rot pathogens include Fusarium oxysporum and / or Ilyonectria destructans.

[0010] This invention also provides a method for verifying the function of the Panax notoginseng NBS-LRR encoding gene PnCNL11 in improving plant resistance to root rot pathogens, characterized by comprising the following steps: (1) The PnCNL11 gene was constructed into an overexpression vector and introduced into recipient plants for heterologous overexpression; (2) Construct an RNAi interference vector targeting the PnCNL11 gene and perform transient interference expression in Panax notoginseng; (3) By inoculating the root rot pathogen, the resistance phenotypes of overexpressing plants and interfering plants were compared to verify the positive regulatory role of the gene in disease resistance.

[0011] More preferably, the overexpression vector is pCAMBIA1300 and the RNAi interference vector is pHELLSGATE2.

[0012] In summary, the present invention has the following beneficial effects: This invention cloned the NBS-LRR protein gene PnCNL11 from Panax notoginseng. RNAi interference experiments were conducted on Panax notoginseng itself, and heterologous expression resistance experiments were performed using tobacco. These experiments verified that the gene induces resistance immunity against Fusarium oxysporum, the pathogen causing root rot in Panax notoginseng. This has promising applications in the breeding of root rot-resistant varieties of Panax notoginseng and provides a reference for the discovery and development of superior disease-resistant genes in Panax notoginseng. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the PnCNL11 protein structure provided in an embodiment of the present invention; Figure 2This is a schematic diagram of the PnCNL11 gene expression structure in response to the destruction of columnar spore infection and under treatment with three different exogenous hormones, provided in an embodiment of the present invention. Figure 3 This is a schematic diagram of the analysis of PnCNL11 overexpression level in heterologous transgenic tobacco provided in the embodiments of the present invention (A: Electrophoresis results of positive identification of different overexpression transgenic lines in the T0 generation; B: Relative expression level of PnCNL11 in the four transgenic lines). Figure 4 This is a schematic diagram of the resistance identification of PnCNL11 heterologous transgenic tobacco provided in the embodiments of the present invention (A: resistance analysis of PnCNL11 transgenic tobacco inoculated with Fusarium oxysporum; B: statistical changes in leaf lesion area). Figure 5 This is a schematic diagram of the transient expression of PnCNL11-RNAi in Panax notoginseng leaves provided in the embodiments of the present invention (A: Phenotype of Panax notoginseng leaves 72 h after inoculation with Fusarium oxysporum following PnCNL11 RNAi; B: PnCNL11 expression level 24 h after interference; C: PnCNL11 expression level 72 h after inoculation with Fusarium oxysporum). Detailed Implementation

[0014] The present invention will be further described in detail below with reference to the accompanying drawings.

[0015] Example 1: A Panax notoginseng NBS-LRR encoding gene PnCNL11, which was cloned from Panax notoginseng, and the nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0016] The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2. The full-length sequence of the protein coding region PnCNL11 of the Panax notoginseng NBS-LRR encoding gene is 2556 bp, encoding 852 amino acids. The protein has a CC domain, an NB-ARC domain, and an LRR domain, and belongs to the CNL type NLR protein.

[0017] Example 2 (1) Cloning and sequence analysis of the PnCNL11 gene Total RNA was extracted from Panax notoginseng samples. The samples were ground into powder using liquid nitrogen and placed in centrifuge tubes. Total RNA was extracted using the Magen RNA Extraction Kit. Reverse transcription was performed using the PrimeScript RT reagent Kit (TAKARA RR047A) from Baosheng Biotechnology Co., Ltd. The reaction system and procedure were as follows: 1 µg of total RNA was added sequentially to 2.0 μL of 5×gDNA Eraser Buffer, 1.0 μL of gDNA Eraser, and RNase-free dH2O to 10 μL. The mixture was incubated at 42℃ for 2 min or at room temperature for 5 min. After the reaction, the mixture was placed on ice, and 1.0 μL of PrimeScript RT EnzymeMix I, 1.0 μL of RT Primer Mix, 4.0 μL of 5×PrimeScript Buffer 2 (for Real Time), and 4.0 μL of RNase-free dH2O were added. The mixture was incubated at 37℃ for 15 min, then at 85℃ for 5 s. The mixture was then stored at -20℃ for later use.

[0018] Using synthesized cDNA as a template, the target gene fragment is amplified. The upstream and downstream primers used are... SEQ ID NO:3: 5'ATGGTGGATGCTGTTGTGAC3' and SEQ ID NO:4: 5'CTAGCTCCTCTGCTCTTCCT3' were amplified by PCR under the following conditions: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 2 min, for 35 cycles; 72℃ for 5 min. After PCR, 4 µL was used for agarose gel electrophoresis to detect the specificity and size of the amplified product, and a specific fragment with a sequence length of 2556 bp was isolated.

[0019] The PCR products were TA cloned using the pGEM-T Vector System I (Promega, USA) kit. The reaction system and procedure were as follows: 1.5 μL of PCR product was added to 1 μL of pGEM-T Vector (50 ng / μL) and 2.5 μL of 2×Ligation solution I, mixed well, and incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using LB agar containing kanamycin (Kan), and several single colonies were selected for bacterial water analysis and sent to Qingke Biotechnology Co., Ltd. for sequencing. After successful sequencing, the *E. coli* plasmid pGEM-T-PnCNL11, which inserts PnCNL11, was extracted using the SanPrep column-based plasmid DNA mini-extraction kit (Tiangen). The final obtained PnCNL11 cDNA sequence was completely identical to the predicted CDS sequence, with a total length of 2556 bp. It is a complete open reading frame encoding a protein containing 851 amino acid residues with a molecular weight of 97336.25 kDa. It contains conserved CC domains (3-125 aa), NB-ARC domains (165-408 aa), and a conserved LRR domain (543-719 aa), as shown below. Figure 1 As shown.

[0020] (2) PnCNL11 expression analysis Expression analysis of the PnCNL11 gene was performed using the upstream primer SEQ ID NO:5: 5'GAGCCGAATCGTGAGCAAAT3' and the downstream primer SEQ ID NO:6: 5'TTCTCTTGAGCCTGTCTGCA3'. Novizan SYBR qPCR mix enzyme was used, and the reaction was analyzed on the QuantStudio™ Design & Analysis Software system. The reaction conditions were: pre-denaturation for 30 s, followed by cycling: 95 °C for 15 s denaturation, 60 °C for 30 s, for 40 cycles, then melting curve analysis: 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. The reaction system consisted of 1 μL cDNA, 0.5 μL forward primer, 0.5 μL reverse primer, 10 μL SYBR qPCR mix enzyme, and 8 μL ddH2O. After qRT-PCR, 2... ΔΔ Ct The relative expression level is calculated using this method.

[0021] The results showed that the PnCNL11 gene responded to *Cyclocarya oryzae* infection at 96 h and 120 h; under the three exogenous hormone treatments, PnCNL11 significantly responded to SA treatment at 24 h and 48 h, significantly responded to ETH treatment at 28 h and 72 h, but did not respond to MeJA treatment. Figure 2 As shown.

[0022] Example 3 Construction of PnCNL11 gene overexpression vector, genetic transformation and resistance identification 1. Construction of a vector overexpressing the PnCNL11 gene The PnCNL11 overexpression vector was constructed using the overexpression plasmid pCAMBIA1300. First, the overexpression vector pCAMBIA1300 was double-digested with restriction endonucleases SacI and BamHI. The digestion system was 50 µL: 5 µL pCAMBIA1300 plasmid, 2 µL SacI and BamHI restriction endonucleases, 5 µL 10× Buffer, and ddH2O to a final volume of 50 µL. Digestion was carried out at 37 ℃ for 40 min. The results were detected by 1% gel electrophoresis, and the vector fragment matching the expected size was purified and recovered. Primer sequences with SacI and BamHI restriction sites and homologous arms were designed as follows: SEQ ID NO: 7: 5' gagcttgcatgcctgcaggtcgacATGGTGGATGCTGTTGTGAC3'; SEQ ID NO: 8: 5' cgagctcggtacccggggatccCTAGCTCCTCTGCTCTTCCT3'. The pGEM-T-PnCNL11 plasmid was used as a template for sequence amplification, and the PCR products were recovered by electrophoresis. Following the homologous recombination method, the PCR products were ligated into the linearized pCAMBIA1300 vector digested with SacI and BamHI using the Novozymes ClonExpress II One Step Cloning Kit (Cat#C115) to obtain the pCAMBIA1300:PnCNL11 recombinant expression vector. The reaction system was 10 µL: 3 µL of the target fragment (10 ng·µL). 1 ), 2 µL of the enzyme-digested linear vector, 5 µL of 2×Seamless MasterMix, and ligation reaction at 50℃ for 20 min.

[0023] 5 µL of the ligation product was transformed into *E. coli* DH5α, and three positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing. After successful sequencing alignment, the target gene was confirmed to have been successfully ligated into the overexpression vector pCAMBIA1300-PnCNL11. The plasmid was extracted and transformed into *Agrobacterium* GV3101 cells. The specific procedure was as follows: 5 µL of plasmid was added to 50 µL of *Agrobacterium* GV3101 competent cells, thoroughly mixed, and placed on ice for 5 min. The cells were then transferred to liquid nitrogen for 5 min, incubated at 37 °C for 5 min, and then incubated on ice for another 5 min. Finally, 500 µL of LB broth was added, and the cells were incubated at 180 rpm for 2 h. 50 μL of activated Agrobacterium tumefaciens culture was evenly spread onto LB solid medium and incubated upside down in the dark for 48 h. Six single colonies were randomly selected for PCR detection to screen for positive clones. 1% gel electrophoresis was performed. If the electrophoretic bands of the positive control and the sample were clear and of the correct size, and the negative control had no bands, the sample could proceed to the next step.

[0024] 2. Genetic transformation and expression analysis of tobacco Tobacco was genetically transformed using Agrobacterium tumefaciens-mediated leaf disc transformation. Agrobacterium tumefaciens GV3101 plates carrying the recombinant plasmid pCAMBIA1300S-PnCNLL11 were streaked onto LB agar containing 100 mg / L Kan and 25 mg / L Rif, and incubated in the dark at 28°C for 2 days. All bacterial colonies were scraped onto MGL liquid agar using a sterile inoculation loop and incubated at 28°C and 200 rpm / min until the bacterial concentration reached an OD600 value of approximately 0.6.

[0025] In a sterile laminar flow hood, take sterile WT tobacco leaves, remove the main veins and leaf edges, and cut them into 1 cm pieces. 2 The leaves were approximately the same size. They were placed in activated Agrobacterium solution and incubated at 28°C and 120 rpm / min for 15 min. The leaves were then removed, their surfaces wiped with sterile absorbent paper, and transferred to a co-culture medium. They were then incubated in the dark at 25°C for 48 h. The tobacco leaves after co-culture were transferred to a transgenic tobacco selection medium and cultured in a clean (25°C, 2000 lx, 16 h light / 8 h dark) light chamber.

[0026] After tobacco leaves dedifferentiated to form callus tissue in the transgenic selection medium, and then redifferentiated to form young shoots, the young shoots were pinched off with sterile forceps and transferred to the transgenic tobacco rooting medium. They were then placed in a light incubator and cultured until the seedlings rooted and formed complete tobacco plants. PnCNL11 transgenic tobacco was transplanted into flowerpots containing sterile nutrient soil and placed in a plant incubator to await flowering and seed production. The seeds were collected and sown in flowerpots containing nutrient soil to obtain T2 generation transgenic tobacco. These were used for subsequent analysis.

[0027] Leaves of T0 transgenic tobacco were collected, and genomic DNA was extracted using the CTAB method. The PnCNL11 sequence inserted into the tobacco genome was amplified using PCR. The pCAMBIA1300S-PnCNLL11 recombinant plasmid was used as a positive control, and genomic DNA from WT tobacco was used as a negative control. PCR amplification products were detected by 1% agarose gel electrophoresis. Total RNA was extracted from leaves of WT and PnCNL11 transgenic tobacco lines, and the expression level of PnCNL11 in tobacco was detected by qRT-PCR using the method described above. The tobacco 18sRNA gene (Nt18S, AJ236016.1) was used as an internal reference gene, with the primers being SEQ ID NO: 9: 5'TTCCGTTAACGAACGAGACC3'; SEQ ID NO: 10: 5'TGTCGGCCAAGGCTATAAAC3'.

[0028] Twelve positive plants were obtained from the T0 generation. Gene expression levels were detected, and 12 plants were successfully transformed into the PnCNL11 transgenic tobacco line. Individual plants were then harvested for seed. Figure 3 As shown. T2 generation transgenic plants were screened, and gene expression in the transgenic lines was analyzed by qRT-PCR. Three families with high expression levels (OE6, OE16, and OE17) and one family with low expression levels (OE19) were selected for subsequent related experiments. 3. Resistance analysis of PnCNL11 transgenic tobacco Fusarium oxysporum was inoculated onto leaves of PnCNL11 transgenic tobacco, with WT tobacco as a control to observe and record the resistance of PnCNL11 transgenic tobacco. Uniformly sized leaves of WT and PnCNL11 transgenic tobacco were taken, and wounds were made at the same location on the leaves with a toothpick. Fusarium oxysporum inoculum blocks were placed on the wounds, and the disease development was observed. The area of ​​lesions was statistically analyzed. Four transgenic families (OE6, OE16, OE17, and OE19) were inoculated with Fusarium oxysporum. Seven days after inoculation, WT tobacco leaves showed obvious yellowing and rotting, while the four transgenic families showed no obvious lesion area, only slight yellowing. The lesion area of ​​WT tobacco was six times that of the four transgenic tobacco families. Figure 4 As shown in the figure. The results indicate that heterologous expression of PnCNL11 transgenic tobacco significantly enhances resistance to Fusarium oxysporum infection.

[0029] Example 4 Construction of PnCNL11-RNAi vector and resistance analysis after transient expression in Panax notoginseng 1. Construction of the PnCNL11-pHELLSGATE2 RNAi vector Primers with attB1 and attB2 adapters at both ends were designed, and the interference fragment was selected at a 400 bp position in the non-conserved region of the PnCNL11 gene. The primer sequences were SEQ ID NO: 11: 5'GGACAAGTTTGTACAAAAAAGCAGGCTCCCACCTTACTTGAAATCATG3'; SEQ ID NO: 12: 5'GGGGACCACTTTGTACAAGAAAGCTGGGTACTTCACCTCCCCTGGTTGTA3'. The PnCNL11 sequence with adapters at both ends was cloned. After gel purification of the PCR product and confirmation of correct sequencing, BP homologous recombination was performed using the Thermo Fisher Gateway BP Clonase™ II Enzyme Mix Recombinant Kit (catalog number: 11789020) to ligate PnCNL11 into the RNAi vector pHELLSGATE2. The BP recombination reaction system consisted of 10 µL of 150 ng attB-PnCNL11 product, 150 ng pHELLSGATE2 plasmid, and TE buffer (pH=8.0) to a final volume of 8 µL. After incubating at 25°C for 1 h, 1 µL of proteinase K (2 µg / µL) was added, followed by brief centrifugation and termination of the reaction at 37°C for 10 min. 5 µL of the homologous recombination product was transformed into DH10B competent cells. Positive clones were screened using LB agar containing 90 mg / L spectinomycin (Spe). Eight single colonies were selected, and bacterial water analysis was performed. The samples were then sent to Qingke Biotechnology Co., Ltd. for sequencing. After successful sequencing, plasmids were extracted from the *E. coli* culture containing the pHELLSGATE2-PnCNL11 vector. The pHELLSGATE2-PnCNL11 recombinant plasmid vector and the pHELLSGATE2 vector were then distributed and transformed into *Agrobacterium tumefaciens* EHA105 cells. Incubate in the dark at 30℃ for 48 hours, then randomly select 6 single colonies for PCR screening to identify positive clones. Once the detection bands are correct, store in 50% glycerol at -80℃ for later use.

[0030] 2. Transient expression analysis of RNAi vector in Panax notoginseng leaves Agrobacterium EHA105 containing the recombinant plasmid pHELLSGATE2-PnCNL11 and the empty vector pHELLSGATE2 was streaked and activated in LB solid medium (containing 90 mg / L Spe, 25 mg / L Rif). After incubation at 28°C in the dark for 48 h, the bacterial growth was scraped into MGL medium (containing 90 mg / L Spe, 50 mg / L AS) and cultured at 28°C with shaking at 200 rpm for 5-6 h until the OD600 value reached 0.6-0.8. Two-year-old Panax notoginseng leaves with uniform growth and no disease were selected. Small holes were punctured at the same location using a sterile syringe. 100 µL of the recombinant vector containing pHELLSGATE2-PnCNL11 and the empty vector Agrobacterium tumefaciens were inoculated onto the leaves as experimental and control groups, respectively. Two control groups and two laboratory samples were set up for each group. After 24 h, samples were taken from both the first control group and the treatment group, with five biological replicates. These samples were used for pre-inoculation analysis to determine whether RNAi interference silencing had occurred. RNA was extracted, and the expression level of the PnCNL11 gene was detected using qRT-PCR. The primer sequence was SEQ ID NO:5: 5' GAGCCGAATCGTGAGCAAAT3', and the downstream primer was SEQ ID NO:6: 5' TTCTCTTGAGCCTGTCTGCA3'. Analysis of the qRT-PCR results showed that, compared with the control group, the gene expression level in leaves infected with the RNAi vector containing pHELLSGATE2-PnCNL11 was significantly downregulated, reaching half that of the empty vector control group. Figure 5 As shown in B, this indicates that the RNA interference vector was successfully constructed and PnCNL11 expression was inhibited; thus, further resistance analysis can be performed.

[0031] 3. Analysis of resistance to Fusarium oxysporum after transient expression of RNAi vector in Panax notoginseng leaves. In the above experiment, Agrobacterium tumefaciens containing the recombinant vector pHELLSGATE2-PnCNL11 and an empty vector were inoculated onto Panax notoginseng leaves. Samples were taken 24 h later to verify the success of RNAi interference. For the second treatment group and the experimental group, the Agrobacterium tumefaciens solution was aspirated from the wounds with sterile filter paper after 24 h, and Fusarium oxysporum blocks were inoculated. The leaves were then cultured in a light incubator, and the degree of leaf decay was observed. After 72 h, the lesion area phenotype was observed, and the affected area of ​​the leaves was calculated using Photoshop software. Samples were flash-frozen at -80℃, and five biological replicates were set up. The expression level of PnCNL11 in leaves after RNAi inoculation with Fusarium oxysporum was analyzed by qRT-PCR. The results showed that 72 h after inoculation with Fusarium oxysporum, the decay area of ​​Panax notoginseng leaves after PnCNL11-RNAi was significantly aggravated compared to the empty vector, with the lesion area being approximately 2.7 times that of the empty vector. Figure 5 As shown in A and D in the figure. qRT-PCR results showed that 72 h after inoculation with Fusarium oxysporum, the expression level of PnCNL11-RNAi was significantly downregulated, only 25% of that in the control group, as shown in Figure 1. Figure 5 As shown in C. In summary, the expression of the PnCNL11-RNAi vector significantly reduced the expression level of PnCNL11 in Panax notoginseng leaves, and the reduced PnCNL11 expression level increased susceptibility to Fusarium oxysporum. This indicates that PnCNL11 has a positive regulatory effect on resistance to Fusarium oxysporum, a root rot pathogen.

[0032] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A Panax notoginseng NBS-LRR encoding gene PnCNL11, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The Panax notoginseng NBS-LRR encoding gene PnCNL11 according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2. The protein has a CC domain, an NB-ARC domain, and an LRR domain, and belongs to the CNL type NLR protein.

3. The application of the Panax notoginseng NBS-LRR encoding gene PnCNL11 according to any one of claims 1 or 2 in improving the resistance of Panax notoginseng to root rot pathogens.

4. The application according to claim 3, characterized in that, The root rot pathogens include Fusarium oxysporum and / or Ilyonectria destructans.

5. A method for verifying the function of the Panax notoginseng NBS-LRR encoding gene PnCNL11 in improving plant resistance to root rot pathogens, characterized in that, Includes the following steps: (1) The PnCNL11 gene was constructed into an overexpression vector and introduced into recipient plants for heterologous overexpression; (2) Construct an RNAi interference vector targeting the PnCNL11 gene and perform transient interference expression in Panax notoginseng; (3) By inoculating the root rot pathogen, the resistance phenotypes of overexpressing plants and interfering plants were compared to verify the positive regulatory role of the gene in disease resistance.

6. The method according to claim 5, characterized in that: The overexpression vector is pCAMBIA1300, and the RNAi interference vector is pHELLSGATE2.