SSR (Simple Sequence Repeat) core primer combination for identifying high saikosaponin content in radix bupleuri variety, kit and application
By using SSR core primer combinations and real-time PCR technology, the problems of long detection time and high cost of "high saikosaponin" in Bupleurum chinense varieties have been solved, enabling rapid and accurate variety identification and differentiation, which is applicable to the management and cultivation of Bupleurum chinense varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUANGGANG NORMAL UNIV
- Filing Date
- 2026-02-14
- Publication Date
- 2026-05-05
AI Technical Summary
The current technology for detecting the content of "high saikosaponin" in Bupleurum chinense varieties relies on liquid chromatography, which requires high-end equipment, takes a long time, and is not cost-effective in terms of both economic and time costs. There is a lack of rapid and effective methods for variety identification.
Using an SSR core primer set containing CHSSR1F and CHSSR1R primers, a specific amplification of the "high-purine saponin" variety was designed. Combined with quantitative real-time PCR, a characteristic band of 136 bp was amplified, and the product was identified using a kit.
It enables rapid and accurate identification and differentiation of "high saikosaponin" varieties, reduces testing costs, improves testing efficiency, simplifies the operation process, and is suitable for growers.
Smart Images
Figure CN121975973A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of identification of varietal resources and germplasm innovation technology, and in particular relates to an SSR core primer combination, kit and application for identifying "high saikosaponin" in Bupleurum chinense varieties.
[0002] Preferably, the fluorescent reporter group is FAM, HEX, TAMRA, Sybr, or ROX. Background Technology
[0003] Saikosaponins are derived from Bupleurum chinense, a plant in the Apiaceae family. Bupleurum chinense is a traditional and commonly used Chinese medicine. Saikosaponins are the core active ingredients that enable it to exert its effects of relieving exterior syndromes and reducing fever, as well as soothing the liver and relieving depression. The content of saikosaponins varies in different varieties and origins of Bupleurum chinense. The identification results provide quantitative and qualitative references for the quality standards of designated Bupleurum chinense medicinal materials and related preparations, ensuring the stability and safety of clinical medication.
[0004] Currently, the detection of Bupleurum chinense with high saikosaponin content is performed using liquid chromatography. This method is highly dependent on equipment and takes too long, making it economically and time-consuming for growers. Therefore, in order to better manage and guide the cultivation of Bupleurum varieties with high levels of saikosaponins, establishing a rapid and effective method for identifying Bupleurum variety resources has become an urgent technical problem for those skilled in the art.
[0005] Molecular marker technology, due to its high polymorphism, short testing cycle, and insensitivity to environmental factors, has become a future direction for variety identification and protection. Therefore, SSR molecular markers have promising applications in variety specificity evaluation and protection. Summary of the Invention
[0006] To overcome the aforementioned defects and shortcomings in the existing technology, this invention provides an SSR core primer combination, kit, and application for identifying the Bupleurum chinense variety "high-purine saponin".
[0007] To achieve the above objectives, the present invention provides the following technical solution: In the first aspect, the present invention provides an SSR core primer combination for identifying varieties of Bupleurum chinense with "high content of saikosaponins". The SSR core primer combination contains a core primer pair with nucleotide sequences CHSSR1F and CHSSR1R, and its specific amplified target sequence is the CHSSR1 core sequence. Primer sequence for CHSSR1F: TGCCCACCAAAGAAAATCAAA (SEQ ID NO: 1); Primer sequence for CHSSR1R: TGAGGAGGGGCCACAAAAT (SEQ ID NO: 2); The core sequence of CHSSR1 is: TGCCCACCAAAGAAAATCAAAGTAGCACTGAAATGCTAATAAGTGCTAACTTTATACAACTTGATATAATAATAATAAAGACACATACTTCCCGTACGAAGTGTCGGCATCCTAATGATTTTGTGGCCCCTCCTCA (SEQ ID NO: 3). Here, the SSR core primers refer to primers designed based on the SSR core sequence.
[0008] Preferably, the 5' end of the primers shown in the nucleotide sequences CHSSR1F and / or CHSSR1R is labeled with a fluorescent reporter group.
[0009] Secondly, the present invention provides the application of the above-mentioned SSR core primer combination in the preparation of products for identifying varieties of Bupleurum chinense with "high content of saikosaponins".
[0010] Thirdly, this invention provides the application of a product containing the aforementioned SSR core primer combination in identifying "high saikosaponin" varieties of Bupleurum chinense. When a characteristic band of 136 bp is amplified using primers based on the SSR core sequences shown in CHSSR1F and CHSSR1R, it indicates that the tested Bupleurum chinense sample is "high in saikosaponin"; the appearance of other bands or the absence of a characteristic band indicates that the tested Bupleurum chinense sample has a low content of "saikosaponin".
[0011] Fourthly, the present invention provides a kit for identifying "high saikosaponin" varieties of Bupleurum chinense, comprising the above-mentioned SSR core primer combination.
[0012] Preferably, the kit further comprises HSTAq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.
[0013] Fifthly, the present invention provides a method for identifying "high saikosaponin" varieties of Bupleurum chinense. The method utilizes the aforementioned SSR core primer combination or the aforementioned kit. When primers designed with the SSR core sequences shown in CHSSR1F and CHSSR1R amplify a characteristic band of 136 bp, it indicates that the tested Bupleurum chinense sample is "high in saikosaponin." The presence of other bands or the absence of any bands indicates that the tested Bupleurum chinense sample is not "high in saikosaponin."
[0014] Preferably: A method for identifying "high saikosaponin" varieties among Bupleurum chinense varieties, comprising the following steps: S1. Extract genomic DNA from the Bupleurum chinense sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using the above-mentioned SSR core primer combination; S3. The PCR amplification products obtained in step S2 are genotyped, and the genotype results are analyzed by band discrimination: If a characteristic band of 136 bp is amplified by primers designed based on the SSR core sequence shown in CHSSR1F and CHSSR1R, it indicates that the sample of Bupleurum chinense to be tested is "high in saikosaponins"; the appearance of other bands or the absence of bands indicates that the sample of Bupleurum chinense to be tested is not "high in saikosaponins".
[0015] S4. Perform fluorescence quantification on the amplification products obtained in step S2 to analyze the expression levels.
[0016] Preferably, the typing method described in step S3 above is quantitative PCR amplification; the total reaction volume is 20 μL, including: 10 μL of 2×Sybr Green qPCR Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, 0.1 μL of DNA, and ddH2O to make up to 20 μL; the PCR amplification reaction conditions are: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s; 40 cycles of 48℃ (fluorescence reading) annealing for 30 s; 72℃ extension for 30 s; and finally 72℃ extension for 30 min.
[0017] Compared with the prior art, the beneficial effects of the present invention are: This invention discloses an SSR core primer combination, kit, and application for identifying "high saikosaponin" varieties among Bupleurum chinense cultivars. Utilizing microsatellite molecular marker development technology, this invention screens and designs primers based on a pair of SSR core sequences. These primers can rapidly identify and detect "high saikosaponin" varieties from other Bupleurum chinense cultivars. Specifically, the primer combination based on the SSR core sequences disclosed in this invention can specifically amplify a 136bp characteristic band in "high saikosaponin" Bupleurum chinense varieties, thereby rapidly and accurately identifying and distinguishing them from other Bupleurum chinense varieties. This method overcomes the high reliance on equipment and excessively long detection times, which are economically and time-consuming for growers. The results are reliable, intuitive, highly efficient, and easy to operate, while also facilitating the promotion, utilization, and protection of "high saikosaponin" varieties. Attached Figure Description
[0018] Figure 1 The results are forward sequencing results of the specific SSR core primers CHSSR1F and CHSSR1R in Example 1.
[0019] Figure 2 The reverse sequencing results are those of the specific SSR core primers CHSSR1F and CHSSR1R from Example 1.
[0020] Figure 3 The specific SSR core primers CHSSR1F and CHSSR1R used in Example 1 amplified the 8% PAGE silver staining electrophoresis bands of four Bupleurum varieties. Detailed Implementation
[0021] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise stated, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.
[0022] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0023] Example 1: Screening and obtaining specific primer sequences for "high saikosaponin" I. Experimental Methods 1. Microsatellite molecular marker development technology DNA was extracted from high-Saussurea saponin varieties (such as Red Bupleurum) that had been detected by liquid chromatography. The genome was digested with Mse I restriction enzyme. After digestion, Mse I adapters were added with T4 ligase. The ligation products were amplified using a single primer with an Mse I adapter. The amplified products were hybridized with a (AAT)6 biotin-labeled probe. Microsatellite sequences containing (AAT)6 were retrieved. The hybridization products were purified and eluted with magnetic beads containing streptocyanin. The eluted products were amplified using a single primer with an Mse I adapter. After purification, the amplified products were TA cloned and sequenced. 25 pairs of primers were designed based on the sequencing results. The primers and sequencing were completed by General Biotechnology (Anhui) Co., Ltd.
[0024] 2. Extraction of DNA from Bupleurum chinense varieties DNA was extracted from the leaves of four commonly grown varieties: "Red Bupleurum," "Black Bupleurum," "Japanese Bupleurum," and "Northern Bupleurum." The saponin content of these four varieties, as determined by liquid chromatography, is shown in Table 1.
[0025] Table 1. Four Bupleurum chinense varieties used in the preliminary screening and their saponin content results detected by liquid chromatography.
[0026] DNA was extracted from the four Bupleurum varieties / lines used for preliminary screening (Table 1). The specific steps for DNA extraction are as follows: a) Take fresh Bupleurum leaves, add liquid nitrogen and grind them thoroughly. Weigh out about 50mg of the ground powder.
[0027] b) Quickly add 700 μL of CTAB plant extract to the ground powder, along with 10 μL of RNase A and 10 μL of proteinase K. Vortex quickly to mix, then place the centrifuge tube in a 65°C water bath for 30 minutes. Invert the centrifuge tube several times during the water bath to mix the sample.
[0028] c) Add 700 μL of phenol:chloroform:isoamyl alcohol (25:24:1), mix by inverting, centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new tube, add 700 μL of guanidine thiocyanate binding solution and mix well, add the liquid to the adsorption column, then centrifuge at 12000 rpm for 1 min and discard the filtrate.
[0029] d) Add 700 μL of 80% anhydrous ethanol, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.
[0030] e) Add 600 μL of 80% anhydrous ethanol, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.
[0031] f) Centrifuge the adsorption column at 12000 rpm for 2 min and discard the filtrate.
[0032] g) Place the adsorption column into a new centrifuge tube and let it stand at room temperature for 5 minutes to allow the remaining wash solution to evaporate.
[0033] h) Add 50 μL of elution buffer to the adsorption column, maintain the temperature of the elution buffer at 65℃, incubate at room temperature for 1 min, centrifuge at 13000 rpm for 2 min, and collect the solution into a centrifuge tube. This yields Bupleurum genomic DNA.
[0034] i) Add the elution buffer back into the adsorption column, put it back into the centrifuge tube, and centrifuge at 13000 rpm for 2 min to obtain Bupleurum genomic DNA.
[0035] j) Perform micro-DNA determination of Bupleurum genomic DNA, record the concentration, dilute the working concentration to 30 ng / ul, and store at -20℃ for later use.
[0036] 3. PCR amplification Using the Bupleurum genomic DNA extracted in step 2 above as a template, PCR amplification was performed using the designed SSR primers.
[0037] The PCR amplification reaction consisted of a total volume of 20 μL, including: 10 μL of 2× PCR Buffer I, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, 1 μL of 30 ng / μL DNA, and ddH2O to make up the total volume of 20 μL.
[0038] The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s; 48℃ annealing for 30 s for 35 cycles; 72℃ extension for 30 s; and final extension at 72℃ for 10 min.
[0039] 4. Subtype detection 8% PAGE electrophoresis detection: Add product to the sample well and perform electrophoresis at 100U for 2 hours.
[0040] 5. Perform fluorescence quantification on the amplification products and analyze the expression levels.
[0041] 6. Data Analysis Band analysis was performed based on the electrophoresis results.
[0042] II. Experimental Results 1. One pair of specific SSR core primers was selected from 25 pairs of SSR primers. The primer sequences of CHSSR1F and CHSSR1R are shown in Table 2.
[0043] Table 2. Specific SSR core primer sequences
[0044] 2. The results of fluorescence quantitative amplification of four Bupleurum varieties using the specific SSR core primers CHSSR1F and CHSSR1R are shown in Table 3.
[0045] Table 3
[0046] 3. Sequencing results of the specific SSR core primers CHSSR1F and CHSSR1R are as follows: Figure 1 and Figure 2 As shown.
[0047] 4. Specific SSR core primers CHSSR1F and CHSSR1R amplified the bands of four Bupleurum chinense varieties using 8% PAGE silver-stained electrophoresis, as shown below. Figure 3 As shown.
[0048] Primers designed based on this pair of specific SSR core sequences amplified the 8% PAGE results of four Bupleurum chinense varieties. Figure 3 As shown, the results indicate that "high saikosaponin" exhibits a characteristic band, specifically: (1) Determination of specific amplification results: The specific SSR core primers CHSSR1F and CHSSR1R amplified a characteristic band of 136bp; that is, the target sequence CHSSR1 core sequence was specifically amplified by the CHSSR1F and CHSSR1R core primer pairs. CHSSR1 core sequence: TGCCCACCAAAGAAAATCAAAGTAGCACTGAAATGCTAATAAGTGCTAACTTTATACAACTTGATATAATAATAATAAAAGACACATACTTCCCGTACGAAGTGTCGGCATCCTAATGATTTTGTGGCCCCTCCTCA (SEQ ID NO: 3).
[0049] The above results indicate (see) Figure 3 One pair of specific SSR core primers can specifically amplify characteristic bands for Bupleurum varieties with "high saikosaponin" (such as red Bupleurum, Japanese Bupleurum, and northern Bupleurum), thus distinguishing "high saikosaponin" from other Bupleurum varieties with low saikosaponin (such as black Bupleurum).
[0050] (2) Real-time PCR-assisted screening analysis: As shown in Table 3, the real-time PCR detection of four varieties with different saikosaponin contents revealed that the CT value was significantly correlated with the specific amplification results of the varieties.
[0051] In a reaction system where the DNA template concentration was uniformly diluted to 30 ng / µL: The high-saucenoside group (Red Bupleurum, Japanese Bupleurum, and Northern Bupleurum): all showed relatively early CT values, ranging from 22.49 to 27.79, with an average CT value of 25.25. Combined with electrophoretic patterns ( Figure 3 Analysis showed that these varieties could all amplify a characteristic band of 136bp, indicating that low CT values correspond to specific and efficient amplification of the target sequence.
[0052] Low saikosaponin group (black Bupleurum): showed a very late CT value, with an average CT value of 29.49.
[0053] Based on these data distribution characteristics, this invention proposes a rapid initial screening method using quantitative real-time PCR: a CT value ≤ 28.0 is set as the initial screening threshold. When the CT value of a sample is ≤ 28.0, it suggests that the sample is highly likely to be a high-saikosaponin variety; when the CT value is > 29.0, it suggests that the sample may be a low-saikosaponin variety. The final variety identification result should be based on whether a 136bp characteristic band appears in electrophoresis.
[0054] (3) The target sequence CHSSR1 core sequence specifically amplified by this pair of CHSSR1F and CHSSR1R primers was unknown when compared with the sequence on NCBI.
[0055] The embodiments described above are merely illustrative of specific implementations of the present invention, and while the descriptions are detailed, they should not be construed as limiting the scope of protection of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. An SSR core primer combination for identifying the content of "high saikosaponins" in Bupleurum chinense varieties, characterized in that, The SSR core primer combination contains a core primer pair with nucleotide sequences CHSSR1F and CHSSR1R, and its specific amplification target sequence is the CHSSR1 core sequence. The primer sequence for CHSSR1F is: TGCCCACCAAAGAAAATCAAA, as shown in SEQ ID NO: 1; The primer sequence for CHSSR1R is: TGAGGAGGGGCCACAAAAT, as shown in SEQ ID NO: 2; The core sequence of CHSSR1 is: TGCCCACCAAAGAAAATCAAAGTAGCACTGAAATGCTAATAAGTGCTAACTTTATACAACTTGATATAATAATAATAAAGACACATACTTCCCGTACGAAGTGTCGGCATCCTAATGATTTTGTGGCCCCTCCTCA, as shown in SEQ ID NO:
3.
2. The SSR core primer combination according to claim 1, characterized in that, The primers shown in the nucleotide sequences CHSSR1F and / or CHSSR1R are labeled with a fluorescent reporter group at their 5' ends.
3. The SSR core primer combination according to claim 2, characterized in that, The fluorescent reporter group is FAM, HEX, TAMRA, Sybr, or ROX.
4. The application of the SSR core primer combination according to any one of claims 1 to 3 in the preparation of products for identifying varieties of Bupleurum chinense with high content of "saikosaponins".
5. The application of a product containing any one of the SSR core primer combinations described in claims 1 to 3 in the identification of the Bupleurum chinense variety "high-purpuric acid saponins", characterized in that, If the SSR core primers with nucleotide sequences CHSSR1F and CHSSR1R amplify a characteristic band of 136 bp, it indicates that the tested Bupleurum sample is "high in saikosaponins"; the appearance of other bands or the absence of a characteristic band indicates that the tested Bupleurum sample has a low content of "saikosaponins".
6. A kit for identifying "high saikosaponin" in the Bupleurum chinense variety, characterized in that, It includes the SSR core primer combination as described in any one of claims 1 to 3.
7. The reagent kit according to claim 6, characterized in that, The kit also contains HSTAq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.
8. A method for identifying the "high saikosaponin" variety of Bupleurum chinense, characterized in that, Identification was performed using the SSR core primer combination described in any of claims 1 to 3 or the kit described in any of claims 6 to 7. If the SSR core primers with nucleotide sequences CHSSR1F and CHSSR1R amplified a characteristic band of 136 bp, it indicated that the sample to be tested was "high in saikosaponins"; if other bands appeared or did not appear, it indicated that the sample to be tested was not "high in saikosaponins".
9. The method according to claim 8, characterized in that, Includes the following steps: S1. Extract genomic DNA from the Bupleurum chinense sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using any of the SSR core primer combinations described in claims 1 to 3; S3. The PCR amplification products obtained in step S2 are genotyped, and the genotype results are analyzed for band discrimination.