A method for increasing the content of carotenoids in fish muscle
By regulating the expression of the fish β-carotene cleavage oxygenase 2 gene and inhibiting the cleavage efficiency of carotenoids, the problem of insufficient accumulation of carotenoids in fish muscle was solved, resulting in improved meat color and increased economic value.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- QINGDAO UNIV
- Filing Date
- 2026-04-09
- Publication Date
- 2026-07-24
AI Technical Summary
Different fish species have significantly different abilities to deposit carotenoids in their muscles. Many farmed fish have a whiter flesh color due to their higher carotenoid metabolism rate or enhanced degradation, which affects their market competitiveness.
By regulating the expression of the β-carotene cleavage oxygenase 2 (Bco2) gene or its functional homologs, and using repressive methods such as double-stranded RNA, siRNA, and miRNA, the cleavage efficiency of carotenoids in fish can be reduced, thereby promoting their accumulation in muscle tissue.
It significantly increases the carotenoid content in fish muscle, improves meat color, and enhances the market competitiveness and economic value of fish.
Smart Images

Figure CN121991984B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of aquatic biology, molecular breeding and gene expression regulation technology, and specifically relates to a method for increasing the carotenoid content in fish muscle. Background Technology
[0002] Carotenoids are a class of fat-soluble pigments widely found in plants, algae, and some microorganisms. They play important physiological functions in animals, including serving as precursors to vitamin A, scavenging reactive oxygen species, enhancing immune function, and participating in reproduction and development. Since most animals, including fish, cannot synthesize carotenoids themselves, they must obtain them through diet.
[0003] In aquatic animals, carotenoids are not only essential nutrients for maintaining normal physiological functions, but also directly affect the body color and flesh color of fish, thus determining their commercial value. Fish with bright colors and rich in carotenoids are generally more favored by consumers; for example, salmon and rainbow trout rely on carotenoid accumulation to form their unique colors. However, different fish species have significant differences in their ability to deposit carotenoids in muscle. Many important farmed fish species have a whitish flesh color due to high carotenoid metabolism rates or enhanced degradation, which limits their market competitiveness. Therefore, increasing the carotenoid content in fish muscle to improve color quality is of great significance in aquaculture breeding and quality improvement.
[0004] Studies have shown that carotenoid metabolism in vertebrates is closely related to the carotenoid cleavage oxygenase (CCO) family, among which β-carotene oxygenase 2 (BCO2) can catalyze the cleavage of various carotenoids and is considered to be related to the carotenoid content in skin, feathers, or adipose tissue in some terrestrial vertebrates. It should be noted that bco2 and its homologs in fish differ significantly from those in other vertebrates in terms of gene copy number and family composition. In addition to the typical bco2 gene, bco2-like homologs with unclear functions are prevalent in the fish genome, and their expression regulation characteristics and biological functions have not been systematically elucidated. Furthermore, fish muscle tissue is not a typical metabolic or depositional tissue for carotenoids; whether bco2 and its homologs directly participate in the regulation of pigment metabolism in fish muscle still lacks systematic research and sufficient experimental evidence. Summary of the Invention
[0005] The purpose of this invention is to provide a method for increasing the carotenoid content in fish muscle.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method to increase the carotenoid content in fish muscle involves regulating the expression of the β-carotene oxygenase 2 (Bco2) gene or its functional homologs to reduce the cleavage efficiency of carotenoids in vivo, thereby promoting their accumulation in fish muscle tissue and improving muscle color and meat quality.
[0008] The bco2 gene is the nucleotide sequence shown in SEQ ID NO:1 or has at least 55% homology with SEQ ID NO:1.
[0009] The expression of the bco2 gene, including but not limited to bco2, bco2a, bco2b, and bco2-like, enhances muscle carotenoid deposition.
[0010] The regulation of the expression of the β-carotene oxygenase 2 (Bco2) gene or its functional homologs is achieved by silencing, knocking down, eliminating, or inhibiting the transcriptional level of the β-carotene oxygenase 2 (Bco2) gene or its functional homologs, inhibiting mRNA stability, blocking protein translation, or disrupting the genomic integrity of its coding sequence.
[0011] When gene expression is expressed using a repression method, the repression method is selected from any one or a combination of double-stranded RNA (dsRNA), small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), antisense oligonucleotide (ASO), or the CRISPR / Cas gene editing system.
[0012] Specifically:
[0013] (1) Design and synthesize gene repressor molecules that target functional homologous sequences of SEQ ID NO:1 or at least 55% sequence identity thereof;
[0014] (2) The inhibitory molecule is introduced into the target fish to reduce the expression of bco2 or its homologous gene.
[0015] In step (2), the inhibitory molecule is introduced into the fish through injection, immersion, feeding, nanoparticle delivery or carrier expression.
[0016] The gene expression inhibition effect was then evaluated using methods such as qPCR, Western blot, and enzyme activity assay. Meanwhile, the changes in muscle carotenoid content were detected by spectrophotometry, HPLC, or HPLC-MS analysis, and individuals with significant carotenoid accumulation were screened for breeding or large-scale production.
[0017] The inhibitory molecule is a functional homologous sequence that targets SEQ ID NO:1 or at least 55% of its sequence identity, namely double-stranded RNA (dsRNA).
[0018] A double-stranded RNA molecule that inhibits the expression of the fish β-carotene cleavage oxygenase 2 gene, wherein the double-stranded RNA molecule has the nucleotide sequence shown in SEQ ID NO:2.
[0019] An application of the aforementioned double-stranded RNA molecule, wherein the double-stranded RNA molecule is used in the preparation of a formulation for regulating the content of carotenoids in fish muscle.
[0020] A regulatory agent for regulating the content of carotenoids in fish muscle, the regulatory agent containing the aforementioned double-stranded RNA molecule.
[0021] Advantages of this invention:
[0022] This invention is the first to verify that the bco2 gene and its homologs are key negative regulators affecting carotenoid accumulation in fish muscle. Inhibiting its expression can effectively increase the level of carotenoid deposition in muscle and significantly improve the color and texture of fish flesh. The method of this invention is applicable to a variety of economically important fish species, including but not limited to edible and ornamental fish, providing a new molecular regulatory strategy for the breeding and quality improvement of aquatic animals. Attached Figure Description
[0023] Figure 1 This is a bar chart comparing the interference effects of two candidate dsRNAs (dsRNA-1 and dsRNA-2) in Example 2. The vertical axis represents the relative mRNA expression level of the bco2l gene in fish muscle tissue, and the horizontal axis represents the control group (injected with PBS), interference segment 1 (injected with dsRNA-1), and interference segment 2 (injected with dsRNA-2), respectively. Different lowercase letters (a, b, c) indicate significant differences between groups. p <0.01).
[0024] Figure 2 This is a comparison of the overall color changes of the tongue sole in Example 3. A represents the control group (injected with PBS), and B represents the experimental group (injected with dsRNA1). The results show that the experimental group's blind side was light orange-red, while the control group maintained its original body color.
[0025] Figure 3This is a comparison of the color changes in the muscle tissue of the tongue sole in Example 3. A represents the control group (injected with PBS), and B represents the experimental group (injected with dsRNA1). The results show that the muscle color in the experimental group changed from light white to shrimp red, while the muscle color in the control group remained light white.
[0026] Figure 4 This is a bar chart showing the interference effect of qPCR on the bco2l gene in Example 4. The vertical axis represents the relative mRNA expression level of the bco2l gene in fish muscle tissue, and the horizontal axis represents the control group (injected with PBS) and the experimental group (injected with dsRNA1), respectively. "Indicates a significant difference (" p <0.05).
[0027] Figure 5 This is a bar chart showing the results of the UV-Vis spectrophotometric determination of carotenoid content in muscle tissue in Example 4. The vertical axis represents the absorbance value of the muscle tissue carotenoid extract at 450 nm, and the horizontal axis represents the control group (injected with PBS) and the experimental group (injected with dsRNA1), respectively. "Indicates a highly significant difference (" p <0.001). Detailed Implementation
[0028] The specific embodiments of the present invention will now be described with reference to the accompanying drawings. These embodiments are merely examples to further illustrate the technical solutions of the present invention and do not constitute any limitation on the scope of protection of the present invention.
[0029] Based on the above scientific evidence, this invention proposes a bco2 gene expression regulation strategy applicable to various types of fish. By reducing the function of bco2, carotenoids are efficiently deposited in the muscle, thereby improving the color quality of fish and increasing their market value. This provides important technical means and theoretical basis for aquaculture and molecular breeding.
[0030] The regulation includes, but is not limited to, silencing, knocking down, eliminating, or inhibiting the expression of any bco2 homologous gene (including but not limited to the bco2l gene) in fish to promote the accumulation of carotenoids in muscle. When using an inhibitory approach to gene regulation, the methods include, but are not limited to: RNA interference (RNAi), small interfering RNA (siRNA), microRNA regulation, CRISPR / Cas gene editing systems, antisense oligonucleotides, ribozymes, or any other technology capable of inhibiting the expression or function of a target gene.
[0031] Example 1: Design and synthesis of candidate interference molecules targeting bco2 homologous genes (taking two candidate dsRNAs targeting the bco2l gene of half-smooth tongue sole as examples)
[0032] In this embodiment, two dsRNAs targeting different interference regions were designed and synthesized for the bco2l gene of the half-smooth tongue sole, serving as candidate interference molecules for subsequent screening experiments.
[0033] a) Target selection and primer design
[0034] Based on the fundamental principles of RNA interference primer design, the RNAi target site of the half-smooth tongue sole nucleotide sequence SEQ ID NO:1 was predicted using siDirect version 2.1 (https: / / sidirect2.rnai.jp / ). Two distinct target sequences that uniquely matched in the genome were selected and named interference region 1 (SEQ ID NO:2) and interference region 2 (SEQ ID NO:3), respectively. Specific primers were designed based on the selected target sequences, and a T7 promoter sequence was introduced at the 5′ end of each primer for subsequent in vitro transcription to synthesize dsRNA.
[0035] The primer sequences used are shown in Table 1:
[0036] Table 1 Primer sequences
[0037]
[0038] Note: For other fish or other bco2 homologous genes, corresponding interference molecules (such as siRNA, sgRNA, etc.) can be designed based on their specific sequences using the same principle.
[0039] b) Preparation of template DNA
[0040] Using cDNA from the liver tissue of *Coccus semilacoide* as a template, PCR amplification was performed using the two pairs of primers mentioned above and a high-fidelity DNA polymerase (such as 2× Phanta Max Master Mix) to obtain two DNA fragments containing the T7 promoter and target sequence. After verification by agarose gel electrophoresis, the PCR products were purified using a gel extraction kit (such as the FastPure Gel DNA Extraction Mini Kit) to obtain a high-purity dsRNA transcription template.
[0041] c) In vitro transcription and purification of dsRNA
[0042] Using the two purified DNA templates, in vitro transcription was performed using the T7 RNAi Transcription Kit. The specific system was as follows: 8 μL NTP Mix, 2 μL 10× Transcription Buffer, 2 μL T7 Enzyme Mix, 1 μL DNA template, and RNase-free H2O to a final volume of 20 μL. After incubation at 37°C for 2 hours, the mixture was slowly cooled and annealed to allow the sense and antisense strands to complement each other and form double-stranded RNA, yielding dsRNA targeting interference region 1 (named dsRNA-1) and dsRNA targeting interference region 2 (named dsRNA-2), respectively.
[0043] The transcript was digested with two enzymes to remove residual template and single-stranded RNA. The two-enzyme digestion system consisted of 20 μL of transcript, 1 μL of DNase I, 2 μL of RNase T1 (10 U / μL), and RNase-free H2O to a total volume of 40 μL. The mixture was incubated at 37°C for 30 minutes.
[0044] The dsRNA obtained from in vitro transcription was purified using a phenol / chloroform extraction method. The specific procedure was as follows: 140 μL of RNase-free H2O was added to the transcription digest, bringing the total volume to 180 μL; then 20 μL of 3 M sodium acetate (pH 5.2) was added and mixed well. Next, 200 μL of a phenol / chloroform mixture (1:1, v / v) was added, and the mixture was gently inverted and centrifuged at 4°C and 12,000 × g for 5 min. The supernatant was transferred to a new RNase-free centrifuge tube and extracted once with an equal volume of chloroform solution.
[0045] After collecting the upper aqueous phase, add 2 volumes of anhydrous ethanol, gently invert to mix, and incubate at -20°C for 30 min. Centrifuge at 12,000 × g for 15 min at 4°C and discard the supernatant. Wash the RNA precipitate with 500 μL of pre-chilled 70% ethanol and centrifuge again for 10 min. Discard the supernatant, air dry in a clean bench for about 2 min, and dissolve the RNA precipitate with 20 μL of RNase-free H2O.
[0046] The quality and concentration of the obtained dsRNA were determined by 1.5% agarose gel electrophoresis and NanoDrop spectrophotometry. Finally, dsRNA-1 and dsRNA-2 were diluted to 3 μg / μL with 1× PBS (Phosphate-Buffered Saline, pH 7.4), aliquoted, and stored at -80℃ for later use.
[0047] Note: This example uses dsRNA synthesis. When other gene silencing methods (such as the CRISPR / Cas9 system) are used, sgRNA, Cas9 mRNA, or ribonucleoprotein complexes can be prepared accordingly.
[0048] Example 2: Screening of dsRNAs targeting different interference segments of the bco2l gene
[0049] To improve gene interference efficiency, the knockdown effect of the two candidate dsRNAs (dsRNA-1 and dsRNA-2) synthesized in Example 1 was evaluated through short-term interference pre-experiments, and the dsRNA with better interference efficiency was screened for subsequent long-term experiments.
[0050] Healthy, uniformly sized juvenile tongue sole were randomly divided into three groups: dsRNA-1 group, dsRNA-2 group, and control group, with 15 fish in each group. The dsRNA-1 and dsRNA-2 groups were injected into muscle tissue at a dose of 3 μg / g body weight, respectively; the control group was injected with an equal volume of 1× PBS. Forty-eight hours after injection, muscle tissue from each group was harvested, flash-frozen in liquid nitrogen, and stored at -80℃. The relative mRNA expression level of the bco2l gene in the muscle tissue of each group was detected using qPCR, following the same procedure as in Example 4a). The results were normalized using the control group as a baseline, and one-way ANOVA and Tukey's multiple comparison test were performed.
[0051] The results show that ( Figure 1 Compared with the control group, the mRNA levels of the bco2l gene in both the dsRNA-1 group and the dsRNA-2 group were significantly decreased. p <0.01), with the knockdown efficiency of the dsRNA-1 group (59.58%) being significantly higher than that of the dsRNA-2 group (32.03%). p The value <0.01 indicates that the dsRNA targeting interference segment 1 (dsRNA-1) has a better interference effect. Therefore, dsRNA-1 was selected for subsequent long-term interference experiments.
[0052] Example 3: dsRNA injection to interfere with bco2l gene expression
[0053] After 7 days of normal domestication, half-smooth tongue soles were introduced into the experimental phase and randomly divided into an interference group and a control group, with approximately 30 fish in each group. During the experiment, both groups of fish were fed a formulated feed containing 100 mg / kg astaxanthin (purchased from Shandong Jinjing Biotechnology Co., Ltd.), fed twice daily at 08:00 and 20:00, with a feed amount of 3% of body weight. The interference group received an injection of bco2l-specific dsRNA (i.e., dsRNA-1) identified in Example 2 into the muscle tissue at a dose of 3 μg / g of body weight; the control group received an equal volume of 1× PBS. Injections were performed every 7 days for a total of 5 injections, with a total experimental period of 30 days.
[0054] After the experiment, muscle tissue from both groups of fish was collected, flash-frozen in liquid nitrogen, and stored at -80℃ for subsequent RNA extraction, qPCR analysis, and carotenoid content determination. Overall color changes showed that the experimental group's blind side was light orange-red. Figure 2 The muscle color change showed that the experimental group's muscle color changed from light white to shrimp red. Figure 3 ).
[0055] Note: The application of this invention is not limited to tongue sole or intramuscular injection, but also applicable to other fish and to the introduction of gene silencing agents (such as siRNA, CRISPR components, etc.) through other delivery methods such as feeding, soaking, electroporation, etc.
[0056] Example 4: Interference Effect Detection
[0057] a) qPCR detection of bco2l gene interference effect
[0058] Total RNA was extracted from the muscle tissue of *Cocculus semismoothie* in each group of the above-mentioned Example 2 using RNA Isolater Total RNA Extraction Reagent (Vazyme, China). 1 μg of RNA was reverse transcribed to synthesize cDNA, which was then reacted using the HiScript IIIRT SuperMix for qPCR (+gDNA Wiper) Kit (Vazyme, China). The synthesized cDNA was diluted 10-fold before qPCR detection.
[0059] 18S rRNA was used as an internal control gene, and real-time quantitative PCR was performed using a ChamQ Blue Universal SYBR qPCR MasterMix (Vazyme, China) on a QuantStudio 1 Plus Real-Time PCR System (Thermo Fisher Scientific, USA). Three biological replicates and three technical replicates were set up for each sample. Experimental data were analyzed using 2... -ΔΔCtThe relative expression levels were calculated, and the results were normalized using the control group as a baseline. The primer sequences used for qPCR are shown in Table 2.
[0060] Table 2 Primer sequences used for qPCR
[0061]
[0062] The test results showed that, compared with the control group, the mRNA expression level of the bco2l gene in the experimental group (injected with dsRNA-1) was significantly reduced. p <0.05%, and the knockdown efficiency was approximately 75.34%, indicating that the designed dsRNA could effectively inhibit the expression of the target gene, and the interference experiment was successful. Figure 4 ).
[0063] b) Extraction and Quantitative Determination of Carotenoids
[0064] Muscle tissue samples from two groups of fish were freeze-dried for 24 h and then ground into a uniform powder. Approximately 0.05 g of sample was weighed and placed in a 2 mL centrifuge tube. 1 mL of methanol solution containing 0.1% butylated hydroxytoluene (BHT) was added, and the mixture was thoroughly vortexed and sonicated for 5 min. Subsequently, the mixture was centrifuged at 4 °C and 12,000 × g for 10 min, and the supernatant was collected. This extraction process was repeated three times, and all supernatants were combined for later use.
[0065] The combined extracts were filtered through a 0.22 μm polytetrafluoroethylene (PTFE) membrane, and the absorbance was measured at 450 nm using a UV-Vis spectrophotometer. The entire extraction and detection process was conducted under low temperature and light-protected conditions to prevent carotenoid degradation.
[0066] The results showed that, compared with the control group, the absorbance of the muscle carotenoid extract in the experimental group was significantly higher at a wavelength of 450 nm. p <0.05 indicates that inhibiting bco2l gene expression can promote the accumulation of carotenoids in muscle. Figure 5 ).
[0067] Note: This method is applicable to evaluating the accumulation of carotenoids in tissues of any fish after silencing the bco2 homologous gene.
[0068] In summary, this invention reduces the efficiency of carotenoid cleavage in muscle tissue by inhibiting the expression of β-carotene oxygenase 2 (Bco2) or its homologous genes, thereby promoting carotenoid deposition in muscle and improving meat color. When using the inhibition method to suppress gene expression, the inhibition can be achieved through RNA interference (RNAi), including but not limited to the use of double-stranded RNA (dsRNA), small interfering RNA (siRNA), or microRNA (miRNA). The interference molecule can be introduced into the fish through injection or feed administration to achieve specific silencing of the target gene. This invention provides a dsRNA molecule for inhibiting the expression of bco2-like (bco2l) gene family members; through this technology, the expression level of the bco2l gene can be significantly reduced, promoting an increase in carotenoid content in muscle and improving the meat color quality and economic value of the tongue sole. The method of this invention is simple, efficient, and has good scalability and breeding application prospects.
[0069] SEQ ID NO:1
[0070]
[0071] SEQ ID NO:2
[0072] AUGCCUGAUCCCUGCAAGAACAUCUUUGCCCGCUUCUUUUCACGCUUUCAGAUUCCAAAAGCCACAGAUAAUGCCAGCGUGAACUUUGUAAAGUACAAAGGAGACUAUUAUGUCAGUACAGAGACCAACUACAUGAGACGUGUAGAUCCUCAAAGUCUGGAGACAAAGGAGAAGGUGGACUGGACCCAAUACAUUGCUGUCAACUCAGCCACAGCUCAUCCACACUACGAUCGAGAGGGGGCCUCGUACAACAUGGGAAACUCCUACGGGAAAAAUGGCUUCUUUUACUCCAUCAUCCGUGUACCUCCACCUGAGGUCAAUGCGGUAAAGGCGGACAGCGCAGACCUAAGUGGAGCCAAGGUGAUCUGCUCCAUCCGUGCAGCAGAACCUAGAAAACCCUCAUACUAUCACAGCUUUGUCAUGUCAGAAAACUAC。
[0073] SEQ ID NO:3
[0074] AUGGUCCUGGAAAUUUGAAUUUGGAAAAGACAGAUACUCUCAUUGGUUGCACCGGGUUCCACCGGUUCCACCGUUAGGCCAGGUUCACGUGAAGGCCGCUUUCUGCGCAGAAGAACCGUAUCGUGGUCAGAGUUUGGGACCAUGGCCGAUGCCGUGUCCCUGCAAGAACAUCUUGCCCGCUUUCUUUCACGCUUUCAGAUUCCAAAAGCCACAGAUAAUGCCAGCGUGACUUUGUAAAGUCAAAGGAGACUAUAUUGUCACGUAGACCAACUACAUACAUAGCAGAGAGACGGUGAGUGACUCUCAAAGUGUAGGACUGGACCCAAUACAUACAUAUUGCUCUCAACUAGCUACAUCACUACAUCACUACUACGAUCGAGGGGGCCUCGUCAACAACUAGGACAACGGGGGCCUCGUCAACAACUAGGACAACGGGAAACUCCUACGGAAAAUGCUUUUUCUCCAUCCUACGUUCCUCU.
Claims
1. A method for increasing the carotenoid content in the muscle of the tongue sole, characterized in that, (1) Design and synthesize a gene repressor molecule targeting bco2, the nucleotide sequence of bco2 is shown in SEQ ID NO:1; (2) The inhibitory molecule was introduced into the target fish to reduce the expression of bco2; The inhibitory molecule is a double-stranded RNA molecule that targets SEQ ID NO:1; The nucleotide sequence of the double-stranded RNA molecule is shown in SEQ ID NO:
2.
2. A double-stranded RNA molecule that inhibits the expression of the β-carotene cleavage oxygenase 2 gene in the tongue sole, characterized in that, The nucleotide sequence of the double-stranded RNA molecule is shown in SEQ ID NO:
2.
3. An application of the double-stranded RNA molecule according to claim 2, characterized in that, The application of the double-stranded RNA molecule in the preparation of a formulation for regulating the carotenoid content in the muscle of half-smooth tongue sole.
4. A regulatory agent for controlling the carotenoid content in the muscle of the tongue sole, characterized in that: The regulatory agent contains the double-stranded RNA molecule as described in claim 2.