Hybrid reaction liquid and application thereof
By using hybridization reaction solutions and kits with specific compositions, combined with magnetic beads and probes, efficient DNA targeted library construction and capture were achieved, solving the problems of time and redundant data in whole genome sequencing and improving detection sensitivity and capture efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JIYINJIA BIOMEDICAL TECHNOLOGY (SHAOXING) CO LTD
- Filing Date
- 2025-12-26
- Publication Date
- 2026-05-08
AI Technical Summary
Existing whole-genome sequencing technologies are time-consuming, labor-intensive, and generate redundant data. Targeted hybridization capture sequencing requires efficient capture reagents to improve detection sensitivity and reduce data analysis workload.
A hybridization reaction solution containing betaine, tetramethylammonium chloride, Mg2+, and Triton X-100, as well as a hybridization reaction solution containing formamide and N-methylpyrrolidone, is provided for hybridization capture kits and DNA targeted library construction. Combined with magnetic bead suspension, capture probes, washing solution, and amplification reagents, it enables nucleic acid capture and library construction in specific regions.
It improves hybridization capture efficiency, is compatible with capture panels of different sizes and hybridization durations, ensures stable capture efficiency within 1-20 hours, and is suitable for simultaneous operation of multiple products.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of library construction technology, specifically relating to hybridization reaction solutions and their applications. Background Technology
[0002] Next-generation sequencing (NGS) technology, with its advantages of high throughput, high accuracy, and rich information content, is widely used in basic research, prenatal diagnosis, genetic disease diagnosis, tumor diagnosis, and precision medicine. However, performing whole-genome sequencing is not only time-consuming and labor-intensive, but also generates a lot of redundant and clinically worthless data. Therefore, capturing specific regions for detection is currently the mainstream approach in clinical applications.
[0003] Compared to whole-genome sequencing, targeted hybridization capture sequencing can isolate and enrich specific regions, offering not only high detection sensitivity but also significantly reducing subsequent data analysis workload. Therefore, efficient capture reagents are crucial. Summary of the Invention
[0004] The first aspect of the present invention is to provide a hybridization reaction solution.
[0005] A second aspect of the present invention is to provide a hybridization capture kit.
[0006] The third aspect of this invention is to provide a DNA targeted library construction kit.
[0007] The fourth aspect of this invention is to provide a hybridization method.
[0008] The fifth aspect of this invention aims to provide a hybridization capture method.
[0009] The sixth aspect of this invention aims to provide a method for constructing a DNA-targeting library.
[0010] The seventh aspect of this invention aims to provide a DNA targeting library.
[0011] The object of the eighth aspect of this invention is to provide a sequencing method.
[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a hybridization reaction solution comprising: hybridization reaction solution 1 and hybridization reaction solution 2; wherein hybridization reaction solution 1 comprises: betaine, tetramethylammonium chloride, and Mg 2+ The hybridization reaction solution 2 contains: formamide and N-methylpyrrolidone.
[0013] In some embodiments, the hybridization reaction solution 1 and the hybridization reaction solution 2 exist independently or in combination; more specifically, they exist independently.
[0014] In some embodiments, the Mg 2+ The concentration in hybridization reaction solution 1 is 1-100 mM; further, 10-100 mM; even further, 20-40 mM; and still further, 25-35 mM.
[0015] In some embodiments, the magnesium ions are derived from magnesium acetate.
[0016] In some embodiments, the concentration of betaine in the hybridization reaction solution 1 is 1-10 M; further, 2-5 M; and even further, 2.5-3.5 M.
[0017] In some embodiments, the concentration of the tetramethylammonium chloride in the hybridization reaction solution 1 is 1-10 M; further, 1-3 M; and even further, 1.5-2.5 M.
[0018] In some embodiments, the concentration of Triton X-100 in the hybridization reaction solution 1 is 0.01%-1% by volume; further, 0.01%-0.1%; and even further, 0.01%-0.02%.
[0019] In some embodiments, the concentration of formamide in the hybridization reaction solution 2 is 50%-90% by volume; further, 60%-80%; and even further, 75%-80%.
[0020] In some embodiments, the concentration of the N-methylpyrrolidone in the hybridization reaction solution 2 is 10%-50% by volume; further, 20%-40%; and even further, 20%-25%.
[0021] In some embodiments, when the hybridization reaction solution 1 and hybridization reaction solution 2 are present in a mixture, the volume ratio of the hybridization reaction solution 1 to the hybridization reaction solution 2 is (1-10):1; further, (2-5):1; further, (3-4):1.
[0022] A second aspect of the present invention provides a hybridization capture kit comprising the hybridization reaction solution of the first aspect of the present invention.
[0023] In some embodiments, the hybridization capture kit further comprises a magnetic bead suspension.
[0024] In some embodiments, the magnetic bead suspension comprises hybridization reaction solution 1 and hybridization reaction solution 2 from the first aspect of the present invention.
[0025] In some embodiments, the volume ratio of hybridization reaction solution 1 to hybridization reaction solution 2 is (2-4):1.
[0026] In some embodiments, the hybridization capture kit further comprises: a library blocking solution.
[0027] In some embodiments, the library blocking solution comprises: Human Cot DNA or Salmon Sperm DNA; and Blocker (preferably a general-purpose Blocker).
[0028] Human Cot DNA is genomic DNA extracted from the human placenta. It consists of highly repetitive sequences of approximately 50 to 300 bp in length found in the human genome. It can conveniently and effectively block repetitive sequences in the nucleic acid sequences of probes or samples to be tested, shielding these sequences and thus avoiding interference from non-specific hybridization signals during nucleic acid hybridization. This enhances the effectiveness of nucleic acid hybridization and ultimately achieves effective capture of nucleic acid sequences in the sample being tested, playing a "blocking" role. Specifically, Human Cot-1 DNA can be used to block high-copy / low-sequence-complexity regions of the human genome.
[0029] Salmon Sperm DNA can effectively block repetitive sequences in the nucleic acid sequences of probes or samples from other species to be tested, thus shielding repetitive sequences.
[0030] In some embodiments, the hybridization capture kit further comprises a capture probe.
[0031] In some embodiments, the capture probe comprises at least one of a DNA probe and an RNA probe.
[0032] In some embodiments, the hybridization capture kit further comprises a washing solution combination.
[0033] In some embodiments, the cleaning solution combination includes magnetic bead cleaning solution, elution reaction solution I, elution reaction solution S, elution reaction solution II, and elution reaction solution III.
[0034] In some embodiments, the magnetic bead cleaning solution comprises: Tris-HCl, EDTA, NaCl, and Tween 20; and further comprises: 4-6 mM Tris-HCl, 0.4-0.6 mM EDTA, 0.8-1.2 M NaCl, and 0.05%-0.15% (v / v) Tween 20.
[0035] In some embodiments, the elution reaction solution I comprises SSC buffer and SDS; further comprising 0.8-1.2× SSC buffer and 0.005%-0.015% (v / v) SDS.
[0036] In some embodiments, the elution reaction solution S comprises SSC buffer and Tween 20; further comprising 0.8-1.2× SSC buffer and 0.08%-0.12% (v / v) Tween 20.
[0037] In some embodiments, the elution reaction solution II comprises SSC buffer and Tween 20; further comprising 0.4-0.6× SSC buffer and 0.08%-0.12% (v / v) Tween 20.
[0038] In some embodiments, the elution reaction solution III contains SSC buffer; further comprising 0.1-0.3×SSC buffer.
[0039] In some embodiments, the hybridization capture kit further comprises a combination of reagents for capturing library amplification.
[0040] In some embodiments, the reagent combination for capturing library amplification comprises: amplification primers and DNA polymerase reaction solution.
[0041] In some embodiments, the DNA polymerase reaction solution comprises: DNA polymerase, buffer solution, magnesium ions, and dNTPs.
[0042] In some embodiments, the hybridization capture kit further comprises magnetic beads for capturing and purifying the capture library.
[0043] A third aspect of the present invention provides a DNA targeted library construction kit comprising the hybridization capture kit of the second aspect of the present invention.
[0044] In some embodiments, the DNA targeted library construction kit further comprises a combination of DNA library (preferably genomic DNA library) construction reagents.
[0045] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent combination comprises at least one of: a reagent combination for adapter ligation, a reagent combination for end repair and adding "A", a reagent combination for library amplification, a substance for DNA fragmentation, and a nucleic acid extraction reagent combination; further comprising a reagent combination for adapter ligation, a reagent combination for end repair and adding "A", a reagent combination for library amplification, a substance for DNA fragmentation, and a nucleic acid extraction reagent combination.
[0046] In some embodiments, the reagent combination for connector ligation includes: a connector ligation reaction solution, a ligase, and a connector.
[0047] In some embodiments, the reagent combination for end repair and adding "A" comprises: end repair reaction solution and end repair enzyme.
[0048] In some embodiments, the reagent combination for library amplification includes: library preparation primers and DNA polymerase reaction solution.
[0049] In some embodiments, the DNA-breaking substance is selected from one or more of the following methods: chemical breaking methods (e.g., acid hydrolysis, metal ion catalysis), biological breaking methods (e.g., enzyme digestion), and physical breaking methods (e.g., ultrasonic disruption, high-pressure homogenization).
[0050] In some embodiments, the nucleic acid extraction reagent combination or kit is a nucleic acid extraction reagent combination selected from any of the following methods: alkaline lysis, phenol-chloroform extraction, chelating resin method, centrifugal column membrane adsorption method, and magnetic bead method; further, it is a nucleic acid extraction reagent combination for the magnetic bead method.
[0051] In some embodiments, the DNA is derived from biological samples such as cells, fresh tissues, fresh organs, decaying tissues, formalin-fixed tissues, paraffin-embedded tissues, forensic samples, paleontological fossils, and biological materials containing cfDNA or RNA.
[0052] In some embodiments, the biological material includes, but is not limited to: peripheral blood, plasma, serum, urine, feces, saliva, cerebrospinal fluid, lymph, bronchoalveolar lavage fluid, amniotic fluid, blastocyst cavity fluid, cell culture medium, embryo culture medium, microbial culture medium, soil leachate, and bone meal leachate.
[0053] More specifically, The DNA can be isolated from a biological sample obtained from an individual (e.g., a test individual). The individual can be any living or non-living organism, including but not limited to humans, non-human animals, plants, bacteria, fungi, protozoa, or pathogens.
[0054] DNA can be isolated or obtained from any type of suitable biological sample. Nucleic acids can be isolated or obtained from single cells, multiple cells (e.g., cultured cells), cell culture media, conditioned media, tissues, organs, or organisms (e.g., bacteria, yeast, etc.).
[0055] In some cases, DNA can be obtained as part of forensic analysis. In some implementations, the kits described herein are applied to forensic samples or specimens. Forensic samples or specimens may include any biological material containing DNA. For example, forensic samples or specimens may include blood, semen, hair, skin, sweat, saliva, decomposed tissue, bone, nail scraps, licked stamps / envelopes, sluff, contact DNA, razor residue, etc. Specimens may be formalin-fixed tissue and / or paraffin-embedded tissue.
[0056] Biological samples can be any sample isolated from or obtained from an individual or a part thereof (e.g., a human individual, a pregnant female, a cancer patient, a patient with an infection or infectious disease, a transplant recipient, a fetus, a tumor, an infected organ or tissue, a transplanted organ or tissue, or a microbiome). In some embodiments, the biological sample is a cervical swab from an individual. Liquid or tissue samples from which nucleic acids are extracted can be cell-free (e.g., cell-free). In some embodiments, the biological sample may contain cellular components or cellular remnants. In some embodiments, the biological sample may include fetal cells or cancer cells.
[0057] Biological samples can be liquid samples. Liquid samples may contain extracellular nucleic acids (e.g., circulating cell-free DNA). Examples of liquid samples include, but are not limited to, blood or blood products (e.g., serum, plasma, etc.), urine, cerebrospinal fluid, saliva, sputum, biopsy samples (e.g., liquid biopsies for cancer detection), the above liquid samples, analogues, or combinations thereof. In some embodiments, a biological sample is a liquid biopsy, which generally refers to an assessment of a liquid sample from an individual regarding the presence, absence, progression, or remission of a disease (e.g., cancer). Liquid biopsies may be used in conjunction with commercially available biopsies (e.g., tumor biopsies) or as a substitute for them. In some cases, extracellular nucleic acids are analyzed in liquid biopsies.
[0058] Biological samples can be tumor nucleic acid samples (i.e. nucleic acid samples isolated from tumors).
[0059] A fourth aspect of the present invention provides a hybridization method comprising the step of using a hybridization reaction solution from the first aspect of the present invention.
[0060] In some embodiments, the method includes the following steps: mixing a DNA library (preferably a genomic DNA library), a hybridization reaction solution, a capture probe (preferably the capture probe in the second aspect of the invention), and a library blocking solution, and then reacting.
[0061] In some embodiments, the mixing of the DNA library (preferably a genomic DNA library), hybridization reaction solution, capture probe, and library blocking solution can be: A mixture of a DNA library (preferably a genomic DNA library) and hybridization reaction solution, a capture probe, and a dried library blocking solution is mixed, wherein the mixture is obtained by eluting the DNA library (preferably a genomic DNA library) with the hybridization reaction solution (evaporation-free); or The dried mixture, the capture probe, and the hybridization reaction solution are mixed, wherein the mixture contains a DNA library (preferably a genomic DNA library) and a library blocking solution (evaporated to dryness).
[0062] In some embodiments, the Mg 2+ The concentration in the reaction system is 0.5-50 mM; further, 15-50 mM; even further, 10-20 mM; and still further, 12.5-17.5 mM.
[0063] In some embodiments, the concentration of betaine in the reaction system is 0.5-5 M; further, 1-2.5 M; and even further, 1.25-1.75 M.
[0064] In some embodiments, the concentration of the tetramethylammonium chloride in the reaction system is 0.5-5 M; further, 0.5-1.5 M; and even further, 0.75-1.25 M.
[0065] In some embodiments, the concentration of Triton X-100 in the reaction system is 0.005%-0.5% by volume; further, 0.005%-0.05%; and even further, 0.005%-0.01%.
[0066] In some embodiments, the concentration of formamide in the reaction system is 5%-20% by volume; further, 10%-15%; and even further, 11%-13%.
[0067] In some embodiments, the concentration of the N-methylpyrrolidone in the reaction system is 1%-10% by volume; further, 2%-5%; and even further, 3%-5%.
[0068] In some embodiments, the reaction time is 1-20 hours; more specifically, 2-16 hours.
[0069] In some embodiments, the reaction temperature is 55-75°C; more specifically, it is 60-70°C.
[0070] In some embodiments, the reaction procedure is 90-100°C for 20-40 seconds; 55-75°C (preferably 60-70°C) for 1-20 hours (preferably 2-16 hours).
[0071] In some embodiments, the library blocking solution is the library blocking solution of the second aspect of the present invention.
[0072] A fifth aspect of the present invention provides a hybridization capture method comprising the steps of using a hybridization capture kit according to a second aspect of the present invention.
[0073] In some implementations, the method includes the following steps: b1) Hybridization; b2) Capture; b3) Elution; b4) Capture library amplification; The hybridization method described herein is the method of the fourth aspect of this invention.
[0074] In some embodiments, the capture method is as follows: mixing magnetic beads (preferably the magnetic beads in the second aspect of the invention) with the product of b1), and reacting.
[0075] In some embodiments, the magnetic beads are obtained by incubation with a magnetic bead suspension (preferably the magnetic bead suspension in the second aspect of the invention) before mixing.
[0076] In some embodiments, the incubation conditions are 60-70°C for 3-7 minutes.
[0077] In some embodiments, the reaction time is 10-60 min; more specifically, 12-18 min.
[0078] In some embodiments, the reaction temperature is 60-70°C.
[0079] In some embodiments, the elution includes hot elution and room temperature elution (preferably hot elution and room temperature elution in sequence).
[0080] In some embodiments, the thermal elution includes elution with elution reaction solution I (preferably elution reaction solution I in the second aspect of the invention) and elution with elution reaction solution S (preferably elution reaction solution S in the second aspect of the invention).
[0081] In some embodiments, the thermal elution sequentially comprises elution with elution reaction solution I (preferably elution reaction solution I in the second aspect of the invention) and elution with elution reaction solution S (preferably elution reaction solution S in the second aspect of the invention).
[0082] In some embodiments, the room temperature elution includes elution with elution reaction solution I (preferably elution reaction solution I in the second aspect of the invention), elution with elution reaction solution II (preferably elution reaction solution S in the second aspect of the invention), and elution with elution reaction solution III (preferably elution reaction solution III in the second aspect of the invention).
[0083] In some embodiments, the room temperature elution sequentially includes elution with elution reaction solution I (preferably elution reaction solution I in the second aspect of the invention), elution with elution reaction solution II (preferably elution reaction solution S in the second aspect of the invention), and elution with elution reaction solution III (preferably elution reaction solution III in the second aspect of the invention).
[0084] In some embodiments, the method for capturing library amplification is as follows: the product obtained in b3) (DNA suspension containing magnetic beads) and the reagent combination for capturing library amplification (preferably the reagent combination for capturing library amplification in the second aspect of the present invention) are mixed and a PCR reaction is performed.
[0085] A sixth aspect of the present invention provides a method for constructing a DNA-targeted library, comprising the steps of using a DNA-targeted library construction kit according to a third aspect of the present invention.
[0086] In some implementations, the method includes the following steps: 1) Construction of DNA libraries (preferably genomic DNA libraries); 2) Hybrid capture; The hybridization capture method is the method of the fifth aspect of the present invention.
[0087] In some embodiments, the method for constructing the DNA library (preferably a genomic DNA library) includes the step of using a DNA library (preferably a genomic DNA library) construction reagent combination as described in the third aspect of the present invention.
[0088] A seventh aspect of the present invention provides a DNA targeting library obtained by the method of the sixth aspect of the present invention.
[0089] An eighth aspect of the present invention provides a sequencing method for sequencing a DNA-targeting library according to the seventh aspect of the present invention.
[0090] The beneficial effects of this invention are: This invention provides a hybridization reaction solution with a capture efficiency superior to existing hybridization reaction solutions, and is compatible with panels of different sizes and different hybridization durations; even small panels can achieve high and relatively stable capture efficiency, hybridization time is selectable from 1 to 20 hours, fast and slow hybridization reagents are uniform, which is convenient for production and simultaneous operation of multiple products. Attached Figure Description
[0091] Figure 1 The capture efficiency of Examples 1-3 and Comparative Example 1 is shown, and 0.5 mean is given.
[0092] Figure 2 The capture efficiency of Examples 4, 14, and Comparative Example 2 and 0.5 mean are shown.
[0093] Figure 3 The capture efficiency and 0.5 mean of Examples 1-3 and 5-13 are shown. Detailed Implementation
[0094] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.
[0095] The present invention will be further described in detail below through specific embodiments.
[0096] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0097] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.
[0098] The preparation methods of FFPE DNA samples in the following examples / comparative examples are as follows: paraffin-embedded tumor tissue samples were collected from lung cancer patients, and FFPE DNA samples were extracted using a tissue paraffin section DNA extraction kit (Fanzhi, FG1103D-02).
[0099] The preparation methods for cfDNA samples in the following examples / comparative examples are as follows: 10 mL of whole blood was collected from lung cancer patients. The sample was collected using a cfDNA sample preservation tube (Kangwei Century, CW2815M). After centrifugation at 1600g for 10 min, the supernatant was collected, followed by centrifugation at 16000g for 10 min, and the supernatant was collected again to obtain a plasma sample. The separated plasma was then used to extract cfDNA samples using a nucleic acid extraction or purification kit (GenePlus, 120011304).
[0100] Example 1: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA-targeting library includes the following steps: 1. DNA Fragmentation: Add 200 ng FFPE DNA sample to the fragmentation tube of the DNA fragmentation instrument, and use TE to bring the volume to 55 μL; use the fragmentation instrument (Bioruptor Pico) for fragmentation with the parameters 30s on / 30s off, 30 cycles; use a biological fragment analyzer (Guangding Biotech Qsep100) to control the fragment size. If the main peak of the fragment is too large, repeat the fragmentation until the main peak size is between 100-400 bp. 2. End-stage repair and adding "A" Prepare the reaction system in the PCR tubes according to Table 1. Place the PCR tubes in the PCR instrument and run the program as shown in Table 2.
[0101] Table 1. End-stage repair and "A" addition system
[0102] Note: The end-of-life repair reaction solution consists of the following components: 428mM Tris-HCl (pH 8), 85mM MgCl2, 85mM M KCl, 17mM TCEP, 7mM ATP, 10mM dNTP, and 0.1% Tween 20 (volume percentage). The terminal repair enzyme consists of four enzymes: T4 DNA polymerase (400 ng / μL, Novizan, T4 DNA polymerase, N101-01), T4 polynucleotide kinase (27 ng / μL, Novizan, T4 Polynucleotide Kinase, N102-01), Klenow enzyme (167 ng / μL, Novizan, DNA polymerase I Klenow fragment, N104-01), and Taq DNA polymerase (2 ng / μL, Takara, TaKaRa Taq). ™ (R001A).
[0103] Table 2. End-stage repair and "A" addition procedures
[0104] 3. Connector connection Prepare the reaction system in the PCR tubes according to Table 3. Place the PCR tubes in the PCR instrument and run the following program: without heat cap; 20℃ for 15 min; 4℃ Hold.
[0105] Table 3 Connector Connection System
[0106] Note: The connector is the connector in Table 2 of patent document CN 114317528 A; The ligation reaction solution consists of the following components: 133mM Tris-HCl (pH 7.6), 10mM MgCl2, 13mM TCEP, 1.67mM ATP, and 60% propylene glycol (volume percentage).
[0107] 4. Purification after adapter connection 4.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.
[0108] 4.2 Pipette 120 µL of magnetic bead A into a PCR tube containing the adapter ligation product, vortex for 10 s to mix, and incubate at room temperature for 10 min.
[0109] 4.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.
[0110] 4.4 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rotate the tube wall 180 degrees and let it stand for 2 min, then carefully remove the supernatant.
[0111] 4.5 Repeat step 4.4 once.
[0112] 4.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.
[0113] 4.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.
[0114] 4.8 Remove the PCR tube from the magnetic rack, add 22 µL of enzyme-free water to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.
[0115] 4.9 After briefly centrifuging the PCR tube, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then, carefully transfer 20 μL of the supernatant into a new PCR tube.
[0116] 5. Library amplification Prepare the reaction system in the PCR tubes according to Table 4. Place the PCR tubes in the PCR instrument and run the program as shown in Table 5.
[0117] Table 4 Library amplification system
[0118] Note: The primers used for library construction are those used in Example 3 of patent document CN 114317528 A.
[0119] Table 5 Library amplification procedures
[0120] 6. Library purification 6.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.
[0121] 6.2 Pipette 45 µL of magnetic bead A into a PCR tube containing the amplification product, vortex for 10 s to mix, and incubate at room temperature for 10 min.
[0122] 6.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.
[0123] 6.4 Keep the PCR tube fixed on the magnetic rack, add 200 µL of freshly prepared 80% ethanol, rotate the tube wall 180 degrees and let it stand for 2 min, then carefully remove the supernatant.
[0124] 6.5 Repeat step 6.4 once.
[0125] 6.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.
[0126] 6.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.
[0127] 6.8 Remove the PCR tube from the magnetic rack, add 15 µL of the library return solution shown in Table 6 to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.
[0128] Table 6 Library Return Solution
[0129] Note: Hybridization reaction solution 1 (hyb#1) contains: betaine (3M), tetramethylammonium chloride (2M), Mg 2+ (Magnesium acetate, 30mM), Triton X-100 (0.01%, volume percentage); Hybridization reaction solution 2 (hyb#2) contains: formamide (77.78%, volume percentage) and N-methylpyrrolidone (22.22%, volume percentage).
[0130] 6.9 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 13 μL of supernatant into a new 1.5 mL centrifuge tube.
[0131] 7. Hybridization Prepare the library blocking mixture in 1.5 mL centrifuge tubes according to Table 7. Open the tube cap and place it in a vacuum concentrator. Concentrate and dry at 60°C. After the liquid is completely evaporated, remove it and centrifuge briefly. Do not over-dry.
[0132] Table 7 Library Blocking Mixture
[0133] Add 13 µL of supernatant and 4 µL of 188 probe (GenePlus, catalog number: M0163) from step 6 to the bottom of a pre-vacuum concentrated and dried centrifuge tube, vortex to mix, briefly centrifuge, and incubate at room temperature for 10 min. Vortex the incubated product and briefly centrifuge. Add 17 µL of the product (Mg) from the centrifuge tube to the bottom of the tube. 2+ The magnesium acetate (magnesium acetate) concentration in the product was 15 mM. All of the product was transferred to a new 0.2 mL PCR tube and briefly centrifuged. The PCR tube was then placed in a PCR instrument, and the program shown in Table 8 was run.
[0134] Table 8 Hybridization Procedure
[0135] 8. Washing the magnetic beads 8.1 Remove magnetic bead B (Invitrogen part number: 35302) in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 minutes. Vortex thoroughly again before use.
[0136] 8.2 Pipette 10 μL of magnetic bead B into a new 1.5 mL centrifuge tube. The three magnetic beads (30 μL) from the capture reaction can be resuspended simultaneously in a 1.5 mL centrifuge tube.
[0137] 8.3 Add 100 μL of magnetic bead cleaning solution to the centrifuge tube (300 μL for 3 capture reactions), vortex for 15 s, centrifuge briefly, place on a magnetic rack for 1 min, and wait until the liquid is completely clear. Carefully discard the supernatant, being careful not to aspirate the magnetic beads. Remove the centrifuge tube from the magnetic rack. The magnetic bead cleaning solution contains: 5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, and 0.1% (v / v) Tween 20.
[0138] 8.4 Repeat step 8.3 twice.
[0139] 8.5 After briefly centrifuging the centrifuge tubes, place them on a magnetic rack and remove any residual liquid using a 10 µL pipette tip.
[0140] 8.6 Add 17 μL of magnetic bead suspension to each centrifuge tube (51 μL for 3 capture reactions), vortex for 15 s, and transfer all magnetic bead suspension to a new 0.2 mL PCR tube, 17 μL / tube. The magnetic bead suspension contains 8.5 μL of hybridization reaction solution 1 (hyb#1), 2.7 μL of hybridization reaction solution 2 (hyb#2), and 5.8 μL of enzyme-free water.
[0141] 8.7 Place the PCR tube containing the magnetic bead suspension into the PCR instrument and incubate at 65°C for 5 min.
[0142] 9. Capture 9.1 Immediately after the hybridization reaction is complete, add the preheated magnetic bead B (product of step 8) to the hybridization system (product of step 7), vortex for 3 seconds to mix thoroughly, and place in a PCR instrument to start the hybridization capture program as follows: heated cap 70℃; reaction conditions: 65℃ for 15 min; 65℃ Hold. Vortex rapidly for 3 seconds at 7.5 min intervals to ensure complete resuspension of the magnetic beads and avoid liquid splashing onto the tube cap as much as possible.
[0143] 10. Washing 10.1 Hot washing 10.1.1 After the sample and magnetic beads have been incubated, add 100 μL of preheated elution reaction solution I (1×SSC, 0.01% (v / v) SDS) to the PCR tube containing magnetic beads B and hybridization products from step 9, and mix thoroughly by pipetting twice.
[0144] 10.1.2 Place the PCR tube on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.
[0145] 10.1.3 Transfer the PCR tube from the magnetic rack to a 65°C constant temperature mixer, add 150 μL of preheated elution reaction solution S (1×SSC, 0.1% (v / v) Tween20), and incubate at 1200 rpm for 5 min.
[0146] 10.1.4 After briefly centrifuging the PCR tube, place it on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.
[0147] 10.1.5 Repeat the above steps, adding 150 μL of preheated elution reaction solution S to wash once.
[0148] 10.2 Elution at room temperature 10.2.1 Set the constant temperature mixer to 1200 rpm and 25℃; 10.2.2 Add 150 μL of room temperature elution reaction solution I, place it on a constant temperature mixer and mix at 1200 rpm and 25°C for 2 min (vortex for 30 s, let stand for 30 s). After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.
[0149] 10.2.3 Add 150 μL of room temperature elution reaction solution II (0.5×SSC, 0.1% (v / v) Tween20), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.
[0150] 10.2.4 Add 150 μL of room temperature elution reaction solution III (0.2×SSC), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.
[0151] 10.2.5 After briefly centrifuging the PCR tube, remove the residual liquid using a 10 µL pipette tip.
[0152] 10.2.6 Remove the PCR tube from the magnetic rack, add 20 μL of enzyme-free water, vortex for 10 s, and centrifuge briefly.
[0153] 11. Capture Library Amplification Prepare the capture library amplification system in centrifuge tubes according to Table 9. Add the obtained system to the DNA suspension containing magnetic beads (product of step 10), vortex to mix and then briefly centrifuge. Place the above PCR tubes in a PCR instrument, and the reaction program is shown in Table 10.
[0154] Table 9 Capture Library Amplification System
[0155] Note: The amplification primers are as follows: MGI-Du-F: TCTCAGTTACGTCAGCAGTT, SEQ ID NO:1; MGI-Du-R: GGCATGGCGACCTTATCAG, SEQ ID NO:2.
[0156] Table 10 Reaction Procedure
[0157] 12. Capture Library Purification 12.1 Take out magnetic bead A in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 min. Vortex again before use. Transfer 60 μL of magnetic bead A into a new PCR tube.
[0158] 12.2 After PCR amplification is complete, the PCR tube is briefly centrifuged and then placed on a magnetic rack to stand for 5 minutes until the solution becomes clear.
[0159] 12.3 Transfer the supernatant to a PCR tube containing magnetic bead A, vortex for 10 s to mix, and incubate at room temperature for 10 min.
[0160] 12.4 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes. Once the liquid is completely clear, carefully discard the supernatant, being careful not to pick up the magnetic beads.
[0161] 12.5 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 s, and carefully remove the supernatant.
[0162] 12.6 Repeat step 12.5 once.
[0163] 12.7 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.
[0164] 12.8 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is non-reflective.
[0165] 12.9 Remove the PCR tube from the magnetic rack, add 22 µL of DNA dissolving solution to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.
[0166] 12.10 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 20 μL of the supernatant into a new 1.5 mL centrifuge tube.
[0167] 13. Library quantification and sequencing The above-mentioned library was quantitatively analyzed using Qubit and then sent to Geneplus Medical Laboratory sequencing facility for sequencing.
[0168] Example 2: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 1, except that “2h” is replaced with “4h” in Table 8.
[0169] Example 3: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA-targeted library is the same as in Example 1, except that "2h" in Table 8 is replaced with "16h". The intermediate library is evaporated to dryness before hybridization. The specific steps are as follows: 1) 6.8 Remove the PCR tube from the magnetic rack, add 60 µL Low TE to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.
[0170] 2) After the 6.9 PCR tube is briefly centrifuged, it is placed on a magnetic rack and left to stand for 5 min. After the liquid is completely clear, carefully transfer 59 μL of supernatant into a new 1.5 mL centrifuge tube.
[0171] 3) 7. Hybridization Remove the Cot-1 DNA and universal Blocker, thaw them, vortex to mix, briefly centrifuge, and place on an ice box. The preparation system is shown in Table 11. Mix each component in a 1.5 mL centrifuge tube according to Table 11, vortex to mix, briefly centrifuge, open the tube cap and place it in a vacuum concentrator, concentrate and dry at 60℃ (40 min). After the liquid is completely evaporated, remove it and briefly centrifuge. Do not over-dry.
[0172] Table 11 Library Condensation System
[0173] Take out hybridization reaction solution 1 (hyb#1) and hybridization reaction solution 2 (hyb#2) from Example 1, thaw them, vortex to mix, centrifuge briefly, and place them on an ice box to prepare the hybridization reaction solution in Table 12. After mixing the hybridization reaction solution thoroughly, add it to the bottom of a centrifuge tube that has been vacuum concentrated and dried, vortex to mix, centrifuge briefly, and incubate at room temperature for 10 min. Vortex to mix the incubated product and centrifuge briefly. Transfer all 17 µL of product from the centrifuge tube to a new 0.2 mL PCR tube and centrifuge briefly. Place the above PCR tube in a PCR instrument and run the program shown in Table 8 (replace "2h" with "16h").
[0174] Table 12 Hybridization reaction solution
[0175] Example 4: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 1, except that: 1) the Mg in hybridization reaction solution 1 (hyb#1) in Table 6 is... 2+ The concentration of (magnesium acetate) should be replaced with 100 mM (Mg). 2+ The concentration in the product is 50 mM); 2) Replace “2h” with “1h” in Table 8.
[0176] Example 5: A method for constructing a cf DNA targeted library A method for constructing a cf DNA targeted library is the same as in Example 1, except that the FFPE DNA sample is replaced with a 30 ng cf DNA sample, and the sample does not need to be fragmented.
[0177] Example 6: A method for constructing a cf DNA targeted library A method for constructing a cf DNA targeted library is the same as in Example 2, except that the FFPE DNA sample is replaced with a 30 ng cf DNA sample, and the sample does not need to be fragmented.
[0178] Example 7: A method for constructing a cf DNA targeted library A method for constructing a cf DNA targeted library is the same as in Example 3, except that the FFPE DNA sample is replaced with a 30 ng cf DNA sample, and the sample does not need to be fragmented.
[0179] Example 8: A method for constructing a cf DNA targeted library A method for constructing a cf DNA targeted library is the same as in Example 5, except that the 188 probe is replaced with the mf probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-renaturation-extension" in Table 10 is 19.
[0180] Example 9: A method for constructing a cf DNA targeted library A method for constructing a cf DNA targeted library is the same as in Example 6, except that the 188 probe is replaced with the mf probe, and the number of cycles for "denaturation-renaturation-extension" in Table 10 is 19.
[0181] Example 10: A method for constructing a cf DNA targeted library A method for constructing a cfDNA targeted library is the same as in Example 7, except that the 188 probe is replaced with the mf probe, and the number of cycles for "denaturation-renaturation-extension" in Table 10 is 19.
[0182] Example 11: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 1, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).
[0183] Example 12: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 2, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).
[0184] Example 13: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 3, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).
[0185] Example 14: A method for constructing an FFPE DNA-targeting library A method for constructing an FFPE DNA targeted library is the same as in Example 1, except that “2h” is replaced with “1h” in Table 8.
[0186] Comparative Example 1: A Method for Constructing an FFPE DNA Targeting Library A method for constructing an FFPE DNA targeted library is the same as in Example 1, except that: 1) Hybridization reaction solution 1 (hyb#1) in Table 6 contains: 3M betaine, 2M tetramethylammonium chloride, and 30mM Co 3+ ([Co(NH3)6]Cl3), 0.01% Triton X-100; Hybridization reaction solution 2 (hyb#2) contains: N-methylpyrrolidone.
[0187] Comparative Example 2: A Method for Constructing an FFPE DNA Targeted Library A method for constructing an FFPE DNA targeted library is the same as in Example 14, except that: 1) the Mg in hybridization reaction solution 1 (hyb#1) in Table 6 is... 2+ (Magnesium acetate) replaced with Co 3+ ([Co(NH3)6]Cl3).
[0188] The hybridization capture efficiency and 0.5 mean (0.5 × mean depth) of Example 1 (reagent T36, evaporated to dryness and free for 2 hours), Example 2 (reagent T36, evaporated to dryness and free for 4 hours), Example 3 (reagent T36, evaporated to dryness and free overnight), and Comparative Example 1 (reagent RapidT1) were analyzed. The results are as follows: Figure 1 As shown; the capture efficiency and 0.5 mean (0.5 × average depth) of Example 4 (50 mM magnesium), Example 14 (15 mM magnesium), and Comparative Example 2 (15 mM cobalt) were measured, and the results are as follows. Figure 2 As shown, the capture efficiency (1h, 2h rapid hybridization) of the hybridization reaction solution (reagent T36) of the present invention is higher than that of Comparative Example 1 (reagent RapidT1), and it has good performance at different hybridization times of 1h, 2h, 4h and 16h.
[0189] The hybridization capture efficiency and 0.5 mean of Examples 1-3 (tissue samples with 188 probe-2h, 188 probe-4h, and 188 probe-16h, respectively) and 5-13 (plasma samples with 188 probe-2h, 188 probe-4h, 188 probe-16h, MF probe-2h, MF probe-4h, and MF probe-16h, respectively, tissue samples with 1021 probe-2h, 1021 probe-4h, and 1021 probe-16h, respectively) were analyzed, and the results are as follows: Figure 3 As shown: The hybridization reaction solution of the present invention is compatible with panels of different sizes and different hybridization times; even small panels can achieve high and relatively stable capture efficiency, the hybridization time can be selected from 2 to 16 hours, the fast and slow mixing reagents are consistent, which is convenient for production and simultaneous operation of multiple products.
[0190] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.
Claims
1. A hybridization reaction solution, comprising: hybridization reaction solution 1 and hybridization reaction solution 2; wherein hybridization reaction solution 1 comprises: betaine, tetramethylammonium chloride, and Mg. 2+ The hybridization reaction solution 2 contains: formamide and N-methylpyrrolidone.
2. The hybridization reaction solution according to claim 1, characterized in that, The hybridization reaction solution 1 and hybridization reaction solution 2 may exist independently or in mixture; Preferably, the Mg 2+ The concentration in hybridization reaction solution 1 is 1-100 mM; Preferably, the concentration of betaine in hybridization reaction solution 1 is 1-10 M; Preferably, the concentration of tetramethylammonium chloride in hybridization reaction solution 1 is 1-10 M; Preferably, the concentration of Triton X-100 in hybridization reaction solution 1 is 0.01%-1% by volume. Preferably, the concentration of formamide in hybridization reaction solution 2 is 50%-90% by volume. Preferably, the concentration of N-methylpyrrolidone in hybridization reaction solution 2 is 10%-50% by volume. Preferably, when the hybridization reaction solution 1 and hybridization reaction solution 2 are present in a mixture, the volume ratio of the hybridization reaction solution 1 to the hybridization reaction solution 2 is (1-10):
1.
3. A hybridization capture kit comprising the hybridization reaction solution according to any one of claims 1-2.
4. The hybridization capture kit according to claim 3, characterized in that, The hybridization capture kit also includes: a magnetic bead suspension; Preferably, the magnetic bead suspension comprises hybridization reaction solution 1 and hybridization reaction solution 2 as described in any one of claims 1-2; Preferably, the hybridization capture kit further comprises: a library blocking solution; Preferably, the hybridization capture kit further comprises: a capture probe; Preferably, the hybridization capture kit further comprises: a washing solution combination; Preferably, the cleaning solution combination comprises magnetic bead cleaning solution, elution reaction solution I, elution reaction solution S, elution reaction solution II, and elution reaction solution III; Preferably, the magnetic bead cleaning solution comprises: Tris-HCl, EDTA, NaCl, and Tween 20; Preferably, the elution reaction solution I comprises SSC buffer and SDS; Preferably, the elution reaction solution S comprises SSC buffer and Tween 20; Preferably, the elution reaction solution II comprises SSC buffer and Tween 20; Preferably, the elution reaction solution III contains SSC buffer; Preferably, the hybridization capture kit further comprises: a reagent combination for capturing library amplification; Preferably, the reagent combination for capturing library amplification comprises: amplification primers and DNA polymerase reaction solution.
5. A DNA-targeted library construction kit comprising the hybridization capture kit according to any one of claims 3-4.
6. The DNA targeted library construction kit according to claim 5, characterized in that, The DNA targeted library construction kit also includes a DNA library construction reagent combination; Preferably, the DNA library construction reagent combination comprises at least one of the following: a reagent combination for adapter ligation, a reagent combination for end repair and adding "A", a reagent combination for library amplification, a substance for breaking DNA, and a nucleic acid extraction reagent combination.
7. A hybridization method comprising the step of using the hybridization reaction solution according to any one of claims 1-2.
8. The method according to claim 7, characterized in that, The method includes the following steps: mixing the DNA library, hybridization reaction solution, capture probe, and library blocking solution, and reacting; Preferably, the Mg 2+ The concentration in the reaction system is 0.5-50 mM; Preferably, the concentration of betaine in the reaction system is 0.5-5M; Preferably, the concentration of tetramethylammonium chloride in the reaction system is 0.5-5M; Preferably, the concentration of Triton X-100 in the reaction system is 0.005%-0.5% by volume. Preferably, the concentration of formamide in the reaction system is 5%-20% by volume. Preferably, the concentration of N-methylpyrrolidone in the reaction system is 1%-10% by volume. Preferably, the reaction time is 1-20 hours; Preferably, the library blocking solution is the library blocking solution of claim 4.
9. A hybridization capture method comprising the steps of using the hybridization capture kit according to any one of claims 3-4.
10. The method according to claim 9, characterized in that, The method includes the following steps: b1) Hybridization; b2) Capture; b3) Elution; b4) Capture library amplification; The hybridization method is the method described in any one of claims 7-8; Preferably, the capture method is as follows: mixing magnetic beads with the product of b1), and reacting; Preferably, the elution includes hot elution and room temperature elution; Preferably, the method for capturing library amplification is as follows: the product obtained in b3) and the reagents used for capturing library amplification are mixed together, and a PCR reaction is performed.
11. A method for constructing a DNA-targeted library, comprising the step of using the DNA-targeted library construction kit according to any one of claims 5-6.
12. The method according to claim 11, characterized in that, The method includes the following steps: 1) DNA library construction; 2) Hybrid capture; The hybridization capture method is the method according to any one of claims 9-10; Preferably, the method for constructing the DNA library includes the step of using the DNA library construction reagent combination as described in claim 6.
13. A DNA-targeting library, obtained by the method described in any one of claims 11-12 of this invention.
14. A sequencing method for sequencing the DNA targeting library of claim 13.
Citation Information
Patent Citations
Specific molecular tag UMI group, mixed specific molecular tag linker and application
CN114317528A