Composition, kit and detection method for detecting burkholderia pseudomallei based on double-target RPA-lateral chromatography test strip

The dual-target RPA-lateral chromatography test strip detection method solves the problem of false negatives caused by single-target gene mutations in the detection of Burkholderia melioides, achieving rapid detection with high accuracy and low cost, and is suitable for primary healthcare institutions and areas with limited resources.

CN121992121APending Publication Date: 2026-05-08ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION +2
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
Filing Date
2026-01-14
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing Burkholderia melioides detection technologies suffer from false negatives due to single-target gene mutations, and are highly dependent on equipment, making them difficult to widely apply in resource-constrained grassroots settings.

Method used

The dual-target RPA-lateral chromatography test strip detection method is adopted. It is designed to target two independent gene targets of Burkholderia melioides and combine them with lateral chromatography test strips for detection. Different reporter groups are used to develop color on the test strips to achieve double confirmation.

Benefits of technology

It significantly improves the accuracy and reliability of testing, reduces the risk of false negatives, is suitable for primary healthcare institutions and areas with limited resources, the results are visually observable, it is inexpensive, and suitable for rapid screening and diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992121A_ABST
    Figure CN121992121A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular diagnosis, and particularly relates to a composition, a kit and a detection method for detecting burkholderia pseudomallei based on a double-target RPA-lateral chromatography test strip. The composition comprises a first RPA primer pair and a first probe aiming at a first target gene of burkholderia pseudomallei, and a second RPA primer pair and a second probe aiming at a second target gene, the 5'ends of the first probe and the second probe are respectively marked with different reporter groups which can be identified by the lateral chromatography test strip. The detection method comprises the following steps: extracting genome DNA of a sample to be detected; carrying out RPA constant-temperature amplification reaction by using the composition; and diluting the amplification product, dropwise adding the diluted amplification product to a sample adding area on the lateral chromatography test strip, and reading a result. Through double-target double confirmation, false negative leak detection caused by single-target gene mutation is effectively avoided, and the detection accuracy is improved; the detection method is simple and convenient to operate, low in cost, free of complex instruments, visible in result and especially suitable for rapid screening on a base site.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a composition, kit, and detection method for detecting Burkholderia melioides based on a dual-target RPA-lateral chromatography test strip (LFD). Background Technology

[0002] Burkholderia medroxynsis (BP) is a highly pathogenic bacterium that can cause melioidosis. It is prevalent in Southeast Asia and southern my country and has a high mortality rate. Early and rapid diagnosis is crucial for treatment and prevention.

[0003] Currently, molecular diagnostic methods are widely used due to their high sensitivity and specificity. Among them, recombinase polymerase isothermal amplification (RPA) technology has attracted much attention due to its rapid reaction and the requirement for only isothermal equipment (37-42℃). To further improve the convenience and applicability of detection, RPA technology is often used in conjunction with different detection platforms.

[0004] Several RPA-based combination schemes exist in existing technologies. For example, patent document CN116083612A discloses a "composition and method for one-pot detection of melioidosis nucleic acid based on RPA-Cas12a". This technology integrates RPA amplification and CRISPR / Cas12a detection in a single reaction tube, achieving dual-signal visualization through fluorescent probes and HNB dye. The advantages of this method are its simplicity and closed-tube detection to prevent contamination. However, its detection relies on the activity of the Cas12a protein and fluorescence excitation / reading equipment, resulting in relatively high costs. Furthermore, in resource-constrained field settings, fluorescence interpretation requires a specific light source. More importantly, this technology primarily targets a single pathogen and introduces a human internal reference gene as an internal standard for sample extraction and the reaction process. While the internal reference gene serves as quality control to prevent false negatives due to sample quality issues, it does not address the risk of false negatives in detection of the pathogen's own target gene due to mutations or deletions.

[0005] Another common approach is the "Composition for Visual Detection of Glandular Based on RPA-LbCas12a System and Its Application" disclosed in patent document CN114807401A, which uses a two-step method of RPA amplification followed by CRISPR detection, and is also based on fluorescence signal detection of a single target.

[0006] In addition, the combination of RPA technology and lateral chromatography test strips is a mature and rapid detection method that is inexpensive, provides visually clear results, and requires no complex instruments. However, most existing RPA-LFD detection methods are still designed for single targets, and they also have the risk of false negatives when faced with pathogen genomic variations.

[0007] Therefore, there is still a need in the field for a Burkholderia melioides detection solution that has higher detection accuracy, can effectively avoid false negatives caused by single-target gene mutations, further reduces detection costs, and is more suitable for rapid screening in grassroots sites with limited equipment, in order to solve the above-mentioned problems in the existing technology. Summary of the Invention

[0008] The purpose of this invention is to provide a composition, kit, and detection method for detecting Burkholderia melioides based on a dual-target RPA-lateral chromatography test strip, in order to solve the problems of false negatives and missed detections caused by single-target gene mutations in the prior art.

[0009] The technical solution of the present invention is as follows: Firstly, a composition for detecting Burkholderia melioides is provided, comprising: The first RPA primer pair and the first probe are used to specifically amplify and detect the first target gene of Burkholderia melioides. The second RPA primer pair and the second probe are used to specifically amplify and detect the second target gene of Burkholderia melioides. Among them, the first target gene is different from the second target gene; The first probe has a first reporter group labeled at its 5' end, and the second probe has a second reporter group labeled at its 5' end, which is different from the first reporter group. Both the first and second probes have blocking groups modified at their 3' ends. The first and second reporter groups can be specifically captured and colored by different detection lines on the lateral chromatography test strip.

[0010] Preferably, the upstream primer nucleotide sequence of the first RPA primer pair is shown in SEQ ID NO:1, the downstream primer nucleotide sequence is shown in SEQ ID NO:2, and the nucleotide sequence of the first probe is shown in SEQ ID NO:3.

[0011] Preferably, the first reporter group is fluorescein, and the blocking group is a C3 spacer arm.

[0012] Preferably, the upstream primer nucleotide sequence of the second RPA primer pair is shown in SEQ ID NO:4, the downstream primer nucleotide sequence is shown in SEQ ID NO:5, and the nucleotide sequence of the second probe is shown in SEQ ID NO:6.

[0013] Preferably, the second reporter group is digoxigenin, and the blocking group is a C3 spacer arm.

[0014] Secondly, a kit for detecting Burkholderia melioides is provided, comprising the above-mentioned composition and further comprising a lateral chromatography test strip, the lateral chromatography test strip comprising a sample application area, a conjugate pad, a detection area, and an absorbent pad; the detection area is provided with a control line and at least two detection lines, the control line being coated with a ligand capable of binding to a marker on the downstream primer, and the at least two detection lines being respectively coated with an antibody or ligand capable of specifically binding to the first reporter group and the second reporter group.

[0015] Thirdly, a method for detecting Burkholderia melioides is provided, comprising the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Mix the genomic DNA obtained in step (1) with the above composition and perform a recombinase polymerase isothermal amplification reaction to obtain RPA amplification product; (3) After diluting the RPA amplification product obtained in step (2), add it dropwise to the sample application area of ​​the lateral chromatography strip to carry out the chromatography reaction; (4) Observe the color development results of the detection area of ​​the lateral chromatography test strip: if the control line and both detection lines are colored, it is determined that the sample contains Burkholderia melioides; if only the control line is colored and neither detection line is colored, it is determined that the sample does not contain Burkholderia melioides; if the control line is not colored, it is determined that the test is invalid.

[0016] Preferably, the conditions for the recombinase polymerase isothermal amplification reaction are: reaction at 42°C for 15-30 min; more preferably, the reaction time is 30 min.

[0017] Compared with the prior art, the advantages of the present invention are: (1) Double confirmation to prevent false negatives: By designing a detection system targeting two independent gene targets of Burkholderia melioides, the risk of false negatives caused by natural variation, deletion or primer binding region mutation of one of the targets is greatly reduced, and the accuracy and reliability of the detection are significantly improved.

[0018] (2) High specificity: The dual-target design itself constitutes dual specificity verification, further eliminating the possibility of cross-reaction with other similar bacterial species (such as Burkholderia melioides, Burkholderia thamnip, etc.).

[0019] (3) Strong on-site applicability: Using lateral chromatography test strips as the detection terminal, the results can be directly observed with the naked eye, without the need for a quantitative PCR instrument, blue light excitation lamp or other complex electronic equipment. The entire detection process can be completed within 1 hour, and the operation steps are simple, making it very suitable for rapid screening and diagnosis in primary medical institutions, disease control sites, border ports or areas with limited resources.

[0020] (4) Low cost: Compared with devices that rely on CRISPR / Cas protein or fluorescence detection, the cost of lateral chromatography test strips is lower, which is conducive to the popularization and large-scale application of the technology. Attached Figure Description

[0021] The present invention will be further described below with reference to the accompanying drawings and embodiments: Figure 1 This is a schematic diagram of the process of the dual-target RPA-lateral chromatography test strip detection method described in this invention; Figure 2 This is a graph showing the detection results of dual-target RPA-LFD for different concentrations of Burkholderia melioides DNA template in Example 1 of the present invention; Figure 3 This is a graph showing the specific detection results of Burkholderia melioides and other closely related bacterial species by the method described in Example 3 of the present invention; Figure 4 This is a schematic diagram of the reaction temperature optimization experiment results described in Example 5 of the present invention; Figure 5 This is a schematic diagram of the reaction time optimization experiment results described in Example 5 of the present invention; Figure 6 This is a comparison of the detection results of clinical samples using the method described in Example 4 of this invention and the real-time PCR method. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments.

[0023] Example 1

[0024] This embodiment details the preparation of the core detection elements of the present invention—specific primers, probes, and lateral chromatography test strips.

[0025] 1. Target Gene Selection and Bioinformatics Analysis: Complete genome sequences of multiple Burkholderia strains were obtained from public databases such as NCBI. Multiple sequence alignment was performed using software such as MEGA and ClustalW to screen for two specific gene regions that were highly conserved (conservation >99%) across all aligned strains and significantly different from other Burkholderia bacteria and common background bacteria. These regions were defined as the first and second target genes, respectively. These two regions are physically separated on the genome and encode different functional proteins, ensuring that their variations are independent of each other.

[0026] 2. Primer and probe design: For each selected target gene, primers / probes were designed strictly according to the RPA primer / probe design principles recommended by TwistDx. Software such as Oligo 7 or Primer Premier 5.0 was used for assistance.

[0027] Primer design: Design forward and reverse primers approximately 30-35 nucleotides (nt) in length. Ensure the primer melting temperature (Tm) is suitable, the GC content is between 40-60%, and avoid the formation of stable secondary structures and dimers within or between primers. Avoid using bases at the 3' end that are prone to initiating mismatches. Reserve the 5' end of the downstream primer for labeling with biotin for subsequent capture by the test strip.

[0028] Probe Design: Design probes approximately 46-52 nt in length targeting the internal sequence of each target gene amplification region. The probe sequence must be completely complementary to the target sequence. Key Features: A tetrahydrofuran (THF) residue is introduced as a modifying base in the middle of the probe sequence (typically about 30-34 bases from the 5' end). This THF site is the specific recognition and cleavage site for exonuclease III in the RPA reaction. A reporter molecule (first or second reporter group) is covalently linked to the 5' end of the probe. A blocking group, such as a C3 spacer or a phosphate group, must be attached to the 3' end of the probe to prevent DNA polymerase from extending from the 3' end of the probe during the RPA reaction. This ensures that only specific primer extension and probe cleavage events produce a detectable reporter marker fragment.

[0029] 3. Oligonucleotide Synthesis and Purification: The final designed sequences were entrusted to Sangon Biotech Co., Ltd. for synthesis and chemical modification. All synthesized oligonucleotides were purified by high-performance liquid chromatography (HPLC) or polyacrylamide gel electrophoresis (PAGE), and quality control identification was performed by mass spectrometry (MS) or capillary electrophoresis (CE) to ensure sequence accuracy, complete modification, and purity meeting requirements.

[0030] The core sequence of this invention, determined and prepared through the above process, is as follows (all sequences shown are in the 5'→3' direction): First target gene detection system: Upstream primer Bp-1F: has the nucleotide sequence shown in SEQ ID NO:1 (ATTTTCCTCCTTCTCGGTCATGCCGATTCCAATC).

[0031] Downstream primer Bp-1R: has the nucleotide sequence shown in SEQ ID NO:2. Its 5' end is covalently labeled with a biotin molecule (structure: Biotin-TGGGCGCAAGATTGCCTGTCGATCATCGGTAA).

[0032] Probe Bp-1P: Has the nucleotide sequence shown in SEQ ID NO:3. Its 5' end is covalently labeled with fluorescein (FAM); counting from the 5' end, a THF base analog is inserted between the 33rd and 34th nucleotides; its 3' end is covalently linked to a C3-Spacer blocking group. Its complete structure can be represented as: 5'-FAM-TTCACATATTCTTCCGCCAACCTTTCCAACAGG / THF / CTGCGGAATCCGCTGA-C3 Spacer-3'.

[0033] Second target gene detection system: Upstream primer Bp-2F: has the nucleotide sequence shown in SEQ ID NO:4 (CCTCGCCGGCCCAGCTGCAACAGTCCGCAGATGCGCAGCA).

[0034] Downstream primer Bp-2R: has the nucleotide sequence shown in SEQ ID NO:5. Its 5' end is covalently labeled with a biotin molecule (structure: Biotin-CATTCGTCTTGGAGACGCTCGGCAGCCTGCC).

[0035] Probe Bp-2P: Has the nucleotide sequence shown in SEQ ID NO:6. Its 5' end is covalently labeled with digoxigenin (DIG); counting from the 5' end, a THF base analog is inserted between the 31st and 32nd nucleotides; its 3' end is covalently linked with a C3-Spacer blocking group. Its complete structure can be represented as: 5'-Digoxin-CGCGCAACAGCGCGCTGACCGCGGCGCTGTA / THF / CGCGGCACGACGAATTTC-C3 Spacer-3'.

[0036] 4. Lateral Chromatography Test Strip: Commercially available general-purpose LFD test strips or custom-made according to the requirements of this invention are used. The test strip structure, from the sample application end to the absorption end, includes: a sample pad (sample application area), a conjugate pad, a nitrocellulose (NC) membrane (detection area), and an absorbent pad. In the detection area of ​​the NC membrane, three lines are precisely sprayed using a spraying device: the furthest line is the control line (C line), coated with high-purity streptavidin; the two lines closest to the C line are the detection lines, the first detection line (T1 line) coated with mouse anti-fluorescein (Anti-FAM) monoclonal antibody, and the second detection line (T2 line) coated with mouse anti-digoxigenin (Anti-DIG) monoclonal antibody. The conjugate pad can be pre-coated with gold-labeled or colored latex-labeled streptavidin (for capturing biotinylated products), or this label can be mixed with the sample during detection. After assembly, the test strip is cut into strips approximately 2.8 mm wide, sealed, and dried for storage.

[0037] Example 2

[0038] This embodiment establishes a complete detection operation process based on the element prepared in Example 1, and evaluates its analytical sensitivity.

[0039] 1. Main reagents and instruments RPA amplification reagents: lyophilized enzyme powder kits based on the principle of recombinase polymerase amplification can be used, such as the TwistAmp® nfo kit (TwistDx Ltd.).

[0040] DNA extraction reagents: Genomic DNA extraction kits suitable for pathogen samples can be used, such as the Quick-DNA™ / RNA Pathogen Miniprep Kit (Zymo Research).

[0041] Lateral chromatography test strips: Customized or compatible commercially available dual-detection-line test strips as described in Example 1.

[0042] Test strip dilution buffer: phosphate buffer (PBS, pH 7.4) containing 0.1% (v / v) Tween-20.

[0043] Positive control template: pure culture of Burkholderia melioides strain, genomic DNA extracted using the DNA extraction kit described above, and quantified using the Qubit™ dsDNA HS detection kit (Thermo Fisher).

[0044] Temperature control equipment: metal bath or constant temperature incubator, with a temperature control accuracy of ±0.5℃.

[0045] Preparation and serial dilution of Bp genomic DNA template: The extracted Bp genomic DNA stock solution was serially diluted 10-fold with nuclease-free water to obtain a concentration of 1×10⁻⁶. 4 1×10 3 1×10 2 1×10 1 Prepare a DNA solution of copies / μL. Use nuclease-free water as a negative control template. Prepare at least 3 replicates for each dilution and negative control.

[0046] 2. RPA amplification reaction a. Preparation of the reaction system: Prepare the Master Mix as shown in the table below in a 1.5 mL centrifuge tube on ice or a cold plate (the total volume should be sufficient for multiple reactions). All liquid components must be fully thawed and vortexed before use.

[0047] Table 1: Dual-target RPA reaction system (single reaction, total volume 50.0 μL)

[0048] It should be noted that the primer and probe addition amounts shown in Table 1 are optimized results. In some preferred embodiments, the molar ratio of the first RPA primer pair (Bp-1F / Bp-1R) to the second RPA primer pair (Bp-2F / Bp-2R) in the reaction system is 1:1 to 1.5:1, and the molar ratio of the first probe (Bp-1P) to the second probe (Bp-2P) in the reaction system is 1:1. This ratio helps to balance the amplification efficiency of the two detection systems, ensuring the synchronicity and stability of dual-target detection.

[0049] b. Reaction Initiation: Add 42.5 μL of the prepared Master Mix to the bottom of a reaction tube containing TwistAmp® nfo lyophilized enzyme powder. Then add 5.0 μL of template DNA or negative control water at the appropriate dilution. Gently pipette and mix several times, avoiding excessive air bubbles. Add 2.5 μL of 280 mM magnesium acetate (MgOAc) solution to the inner wall of the tube cap. Quickly tighten the cap and immediately centrifuge briefly (approximately 1500 × g, 5-10 s) to ensure thorough contact and mixing of the MgOAc solution on the cap with the reaction mixture at the bottom of the tube, thereby initiating the RPA reaction.

[0050] c. Constant temperature incubation: Immediately after starting the reaction tube, transfer it to a metal bath or constant temperature incubator preheated to 42°C and incubate in the dark for 30 minutes.

[0051] 4. Lateral chromatography detection a. Product dilution: After the RPA reaction is complete, carefully aspirate 5.0 μL of amplification product from each reaction tube (avoiding aspiration of possible aerosols) and transfer it to a clean PCR tube or centrifuge tube containing 95.0 μL of pre-cooled test strip dilution buffer (PBS containing 0.1% Tween-20). Vortex to mix for 5 seconds.

[0052] b. Sample addition and chromatography: Take one of the lateral chromatography test strips prepared in Example 1, and vertically immerse its sample pad end into the 100 μL diluted detection solution, or vertically drop all 100 μL of liquid onto the sample addition area of ​​the test strip. Place it horizontally at room temperature (15-25℃) and allow the liquid to precipitate along the test strip towards the absorbent pad using capillary action.

[0053] Result Interpretation: After adding the sample and allowing it to stand for 15 minutes, observe the color development of the lines on the nitrocellulose membrane under a white background. The results are as follows: Figure 2 As shown.

[0054] Positive result: The control line (C line) is clearly visible (red or purple), and both test line 1 (T1 line) and test line 2 (T2 line) are clearly visible. This indicates that Bp is present in the sample, and both target sites have been successfully detected.

[0055] Negative result: Only the control line (C line) is clearly visible; the T1 and T2 lines are not visible. This indicates that the sample does not contain Bp, or that the Bp content is below the method detection limit.

[0056] Invalid result: The control line (C line) does not develop color. Regardless of whether the T1 and T2 lines develop color, this result is considered invalid, indicating a failure in the chromatography process (such as a faulty test strip, insufficient sample volume, buffer problem, etc.), and retesting is required.

[0057] Sensitivity results: such as Figure 2 As shown, gradient detection of Bp DNA template revealed a positive correlation between the detection signal intensity and template concentration. When the template concentration was 1 × 10⁻⁶, the signal intensity increased. 4 copies / mL (E(1)) and 1×10 3 When the number of copies / mL (E(0)) is 0, a clear and visible control line (C line) and two test lines (T1 line and T2 line) consistently appear on all repeated test strips, which is interpreted as a definite positive result.

[0058] At a template concentration of 1×10 2 When the number of copies / mL (E(-1)) is reached, the detection results fluctuate. In partial replicates, two test lines may appear simultaneously, but the color intensity is significantly weaker than in higher concentration samples; in partial replicates, only one test line (T1 or T2) may appear (e.g., ...). Figure 2 (As shown in the circled area). This indicates that at this concentration, the amplification efficiency is at a critical point, and the detection systems for the two independent targets may exhibit slight differences in sensitivity. Nevertheless, as long as either detection line shows color, combined with the trend of the other target, it can still provide a valid positive indication.

[0059] When the template concentration drops to 1×10 1 When the concentration is 1 copies / mL (E(-2)), neither the T1 nor T2 lines show color in any replicates, and the result is interpreted as negative. The negative control (N) shows only a clear C line in all tests.

[0060] In summary, the dual-target RPA-LFD method established in this invention has a detection sensitivity (i.e., stable detection of both targets) of 1 × 10⁻⁶ for the genomic DNA of pure cultured Bp strains. 3 copies / mL. At 1×10 2At a concentration of copies / mL, the method has detection capability, but results may fluctuate or show single-target positivity. This highlights the practical value of dual-target design in providing redundant detection signals at extremely low pathogen loads. This sensitivity range meets the routine needs for Bp detection in clinical samples.

[0061] The detection results for templates of different concentrations are summarized in the table below: Table 2: Comparison of detection results of dual-target RPA-LFD method and qPCR method on serially diluted Bp DNA template

[0062] Among them, + indicates clear color development or a clear positive result; - indicates no color development or no detection; ± indicates weak or unstable color development; "unstable" means that at this concentration, different repeated tests may show one or two detection lines, reflecting the redundancy indication value of dual-target detection at critical concentrations.

[0063] Example 3 This embodiment is used to verify the specificity of the method of the present invention for Bp detection and to assess the possibility of cross-reaction with related bacterial species.

[0064] 1. Test strains: Seven strains of Burkholderia species closely related to Bp, including common environmental or clinical commensal / pathogenic bacteria, were selected, including: Burkholderia melioides; Burkholderia thamnip; Burkholderia cepacia; Pseudomonas aeruginosa; Staphylococcus aureus; Escherichia coli; and Acinetobacter baumannii. Positive control (Bp) and negative control (nuclease-free water) were also set up.

[0065] 2. Template Preparation: All test strains were inoculated onto suitable solid culture media for resuscitation, and single colonies were picked and inoculated into liquid culture media for overnight incubation. Genomic DNA was extracted from 1 mL of bacterial culture using the same Quick-DNA™ / RNA Pathogen Miniprep Kit as in Example 2. The extracted DNA was quantified using Qubit and uniformly diluted to a concentration greater than 1 × 10⁻⁶. 5 Copies / mL, to ensure that even very low levels of nonspecific amplification can be observed.

[0066] 3. Detection method: Take DNA template (5.0 μL) of each strain and positive and negative controls respectively, and strictly follow the "dual target RPA-LFD standard detection procedure" established in Example 2. Each sample is tested twice in parallel.

[0067] 4. Specific results: such as Figure 3As shown, in all tests, only the test strips using Bp DNA as a template showed clear T1 and T2 lines simultaneously, forming a clear positive interpretation pattern together with the C line. All tests using DNA from the other six non-Bp strains (including the closely related Burkholderia melioides and Burkholderia thamnica) as templates showed only a clear C line on the test strips; the T1 and T2 lines showed no color development whatsoever, resulting in clear negative results. The negative control also showed only C line color development. This result fully demonstrates that the two RPA primer-probe systems designed in this invention have high specificity for Bp and show no cross-reactivity with other Burkholderia bacteria and common clinical pathogens within the test range. The dual-target design further enhances this specificity because the probability of non-specific binding to two completely different Bp-specific sequences simultaneously is extremely low.

[0068] Example 4 This embodiment optimizes two key parameters of the RPA amplification reaction—reaction temperature and reaction time—to determine the optimal reaction conditions and ensure the stability and sensitivity of the detection.

[0069] 1. Optimization of reaction temperature Experimental design: with a concentration of 1×10 3 Bp DNA copies / mL was used as a template (this concentration is close to the detection limit by 10 times and is sensitive to changes in conditions). The reaction time was fixed at 30 min, and a series of temperature gradients were set: 38℃, 39℃, 40℃, 41℃, 42℃, 43℃, and 44℃. Three replicate reactions were set up at each temperature point.

[0070] Operation and interpretation: Perform RPA reaction and LFD detection according to the procedure in Example 2, and compare the color intensity of T1 line and T2 line on the test strips obtained at different temperatures (using the color depth and width of the strips as the intuitive evaluation criteria).

[0071] Optimization results: such as Figure 4 As shown, the reaction temperature significantly affects the color intensity of the detection lines. At 38℃ and 39℃, lines T1 and T2 are visible, but the color is relatively light. Within the temperature range of 40℃ to 43℃, both detection lines exhibit strong, deep red bands with clear boundaries, and good stability between replicates. When the temperature increases to 44℃, the color intensity slightly decreases. Considering color intensity, stability, and protection of enzyme activity, 42℃ is selected as the recommended optimal reaction temperature for RPA amplification using the method of this invention. At this temperature, RPA enzyme activity is within its efficient and stable range, and potential non-specific amplification can be effectively avoided.

[0072] 2. Optimization of reaction time Experimental design: At the optimal temperature of 42℃, using the same 1×103 Using Bp DNA copies / mL as a template, different reaction time gradients were set: 15 min, 20 min, 25 min, and 30 min. Three replicates were set up for each time point.

[0073] Operation and interpretation: Follow the procedure in Example 2. After the set time is reached, immediately remove the reaction tube for LFD detection and compare the color development of the detection line under different reaction times.

[0074] Optimization results: such as Figure 5 As shown, reaction time directly affects amplification yield and detection signal. At 15 min, the T1 and T2 lines begin to appear, but their color is faint, indicating that amplification has not yet reached the plateau phase. At 20 min, the detection lines show significantly deeper color development. At 25 min and 30 min, the detection lines reach their strongest color development and their intensity tends to stabilize, with full and clear bands. To ensure a stable and reliable strong signal even with low-concentration samples (close to the detection limit), 30 min is selected as the recommended optimal reaction time for RPA amplification using the method of this invention. This time is sufficient to allow the amplification reaction to proceed fully, maximizing detection sensitivity.

[0075] Example 5 This embodiment aims to verify the practical application performance of the dual-target RPA-LFD method established in this invention using real clinical samples, and to compare it with the currently commonly used single-target quantitative PCR (qPCR) method in laboratories, so as to highlight the potential advantages of the dual-target design of this invention.

[0076] Clinical Sample Collection: Clinical samples were collected from hospitals in melioidosis-endemic areas after ethical review approval and with informed consent from patients. This included 10 stool samples (S1-S10) from patients confirmed as Bp-positive by conventional bacterial isolation and culture methods. One stool sample from a healthy volunteer was also collected as a negative control (N). All samples were stored at -80°C until testing.

[0077] Sample pretreatment and DNA extraction: Take about 100 mg (rice grain size) of fecal sample and strictly follow the instructions of the Quick-DNA™ / RNA Pathogen Miniprep Kit used in Example 2, including mechanical cell disruption, proteinase K digestion, and purification by binding column. Finally, wash with 50 μL of nuclease-free water to obtain the total DNA of the sample.

[0078] The method of this invention (dual-target RPA-LFD) detection: Take 5.0 μL of the extracted clinical sample DNA as described above, and perform the detection strictly according to the optimized standard procedure of Example 2 (42℃, 30min RPA; LFD detection). Two independent observers interpret the test strip results.

[0079] Comparative method (single-target qPCR) detection: As a reference, a commercially available quantitative real-time PCR detection kit targeting the Bp-specific target gene TTS1 (Type III Secretion System 1 gene cluster) (e.g., a brand-name Bp Detection Kit) was used to detect the same extracted DNA sample. The qPCR reaction was performed on an ABI 7500 real-time quantitative PCR instrument, and the reaction program was strictly set according to the kit instructions: typically 95°C pre-denaturation for 3 min, followed by 95°C denaturation for 15 s, and annealing / extension at 60°C for 40 s, for a total of 40 cycles. The cycle number (Ct value) corresponding to the fluorescence signal exceeding the threshold line was used as the result. According to the kit instructions and standard judgment criteria, a Ct value <35 was defined as positive, and ≥35 or no detection was defined as negative.

[0080] Verification and comparison results: The detection results are summarized in Table 3 below, and the schematic diagram is shown in [reference needed]. Figure 6 .

[0081] Table 3: Comparison of results of dual-target RPA-LFD and single-target qPCR detection in clinical samples

[0082] Results Analysis and Discussion In the table, "+" indicates clear color development; "-" indicates no color development; and "Not detected" indicates that the fluorescence signal did not exceed the threshold during the entire 40 cycles.

[0083] 1. Compared with the "gold standard" bacterial culture method: The dual-target RPA-LFD method of this invention gave clear positive results (dual color development of T1 and T2 lines) in all 10 culture-positive samples (S1-S10), which was 100% consistent with the culture results (sensitivity 100%). The result of one negative control (N) was negative, with specificity of 100%.

[0084] 2. Compared to single-target qPCR: qPCR detected the positive result in 9 samples (S2-S10), but the Ct value of sample S3 was 35.31, which was on the edge of the set positive judgment threshold (Ct=35), resulting in uncertainty in the interpretation of the result. Most importantly, single-target qPCR failed to detect the culture-positive sample S1 ("not detected"). However, the method of this invention provided a clear positive signal for sample S1.

[0085] 3. Discussion and Advantages: A reasonable explanation for the discrepancy result of "culture positive but qPCR negative" in sample S1 is that the clinical isolate experienced a point mutation or minor variation in the primer or probe binding region of the TTS1 target gene targeted by qPCR, preventing the primer or probe from effectively binding and extending, thus resulting in a false negative. However, the dual-target design employed in this invention targets another independent and different specific gene (the second target) in the Bp genome. This mutation is likely not located in the second target region; therefore, the detection system of this invention (especially the primer-probe of the second target) can still effectively identify and amplify the DNA of this strain, providing a positive signal through the T2 line (or T1 / T2 double line). This comparative result strongly demonstrates the significant advantages and value of the dual-target design of this invention in addressing natural variations in pathogen genomes and preventing false negatives due to single-target failure. It improves the robustness of the detection method and its coverage of strain diversity. Furthermore, the method of this invention is simpler and faster to operate, and does not require expensive instruments.

[0086] Based on the above embodiments, this invention successfully constructed and validated a rapid detection system for Burkholderia melioides based on a dual-target RPA-lateral chromatography test strip. This system possesses the following key features: High accuracy: Sensitivity up to 100 copies / μL, no cross-reaction with closely related bacteria, and high specificity.

[0087] High reliability: The unique dual-target design provides redundant detection paths, which can effectively avoid the risk of false negatives caused by single-target gene mutations, making the test results more reliable.

[0088] Site-friendly: The entire process is conducted at a constant temperature, and the results can be read visually using the test strips. No complicated instruments are required, and the test can be completed in about 1 hour, making it extremely suitable for field, grassroots, and emergency use.

[0089] Low cost: The main consumables are conventional biochemical reagents and test strips, which are far less expensive than platforms based on CRISPR or fluorescence detection.

[0090] This invention provides a Burkholderia melioides detection composition, kit, and method based on a dual-target RPA-lateral chromatography test strip. This approach achieves double confirmation by detecting two independent gene targets of the pathogen, effectively preventing false negatives due to single-target mutations and significantly improving detection accuracy. Furthermore, the use of a lateral chromatography test strip as the readout method eliminates the need for complex instruments, making the entire detection process simple, quick, and easy to interpret visually. The low cost makes it highly suitable for primary healthcare units, on-site emergency response, and epidemiological screening scenarios, demonstrating promising application prospects.

[0091] The above embodiments are merely illustrative of the technical concept and features of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. It will be apparent to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects. The scope of the present invention is defined by the appended claims rather than the foregoing description, and thus all changes falling within the meaning and scope of the equivalents of the claims are intended to be included within the present invention.

Claims

1. A composition for detecting Burkholderia melioides, characterized in that, include: The first RPA primer pair and the first probe are used to specifically amplify and detect the first target gene of Burkholderia melioides. The second RPA primer pair and the second probe are used to specifically amplify and detect the second target gene of Burkholderia melioides. The first target gene is different from the second target gene; The first probe has a first reporter group labeled at its 5' end, and the second probe has a second reporter group labeled at its 5' end, which is different from the first reporter group. Both the first and second probes have blocking groups modified at their 3' ends. The first and second reporter groups can be specifically captured and colored by different detection lines on the lateral chromatography test strip.

2. The composition for detecting Burkholderia melioides according to claim 1, characterized in that, The upstream primer nucleotide sequence of the first RPA primer pair is shown in SEQ ID NO:1, and the downstream primer nucleotide sequence is shown in SEQ ID NO:2; the nucleotide sequence of the first probe is shown in SEQ ID NO:

3.

3. The composition for detecting Burkholderia melioides according to claim 2, characterized in that, The first reporter group is fluorescein, and the blocking group is a C3 spacer arm.

4. The composition for detecting Burkholderia melioides according to any one of claims 1-3, characterized in that, The upstream primer nucleotide sequence of the second RPA primer pair is shown in SEQ ID NO:4, and the downstream primer nucleotide sequence is shown in SEQ ID NO:5; the nucleotide sequence of the second probe is shown in SEQ ID NO:

6.

5. The composition for detecting Burkholderia melioides according to claim 4, characterized in that, The second reporter group is digoxigenin, and the blocking group is a C3 spacer arm.

6. A kit for detecting Burkholderia melioides, characterized in that, It comprises the composition according to any one of claims 1-5.

7. The reagent kit according to claim 6, characterized in that, It also includes a lateral chromatography test strip, which includes a sample application area, a conjugation pad, a detection area, and an absorption pad; the detection area is provided with a control line and at least two detection lines, the control line is coated with a ligand that can bind to the label on the downstream primer, and the at least two detection lines are respectively coated with antibodies or ligands that can specifically bind to the first reporter group and the second reporter group.

8. A method for detecting Burkholderia melioides, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) The genomic DNA obtained in step (1) is mixed with the composition according to any one of claims 1-5 and subjected to a recombinase polymerase isothermal amplification reaction to obtain the RPA amplification product; (3) After diluting the RPA amplification product obtained in step (2), add it dropwise to the sample application area of ​​the lateral chromatography strip to carry out the chromatography reaction; (4) Observe the color development results of the detection area of ​​the lateral chromatography test strip: if the control line and both detection lines are colored, it is determined that the sample contains Burkholderia melioides; if only the control line is colored and neither detection line is colored, it is determined that the sample does not contain Burkholderia melioides; if the control line is not colored, it is determined that the test is invalid.

9. The method according to claim 8, characterized in that, In step (2), the conditions for the isothermal amplification reaction of the recombinase polymerase are: reacting at 42℃ for 15-30 min.

Citation Information

Patent Citations

  • RPA-LbCas12a system-based composition for visual detection of nasal-like carbuncle and application of RPA-LbCas12a system-based composition

    CN114807401A

  • RPA-Cas12a-based composition for one-pot detection of nasosphallele-like nucleic acid and application of RPA-Cas12a-based composition

    CN116083612A