Immunoglobulin related methods of identifying, preventing and treating tissue aging

Abstract

The present invention provides a method of identifying the degree of aging of a subject or a tissue or organ thereof, comprising a) detecting the presence of an immunoglobulin (Ig) molecule in a sample from the subject; and b) comparing the result of the detection with a reference value. The invention also provides a method for regulating senescence of a subject or a tissue or organ or cell thereof through Ig, and a method for screening an anti-senescence compound or composition or identifying the effect of a drug on senescence by detecting Ig.

Description

Technical Field

[0001] This invention relates to the field of biomedicine. Specifically, this invention provides methods for identifying and / or regulating aging. More specifically, this invention relates to methods for identifying the degree of aging by detecting the presence of immunoglobulins in tissues, or for preventing, treating, or delaying aging by reducing immunoglobulin levels. Background Technology

[0002] Organisms are highly ordered and complex systems composed of billions of cells that communicate as functional units within organ structures, organ systems, and throughout the body. In aging tissues, the integrity of spatial structures is gradually eroded, leading to a decline in systemic function, which is highly heterogeneous across organs and tissues. Studying these temporal and spatial multi-tissue cellular changes helps identify previously unknown molecular mechanisms driving aging and understand how to target these mechanisms to slow down the aging process in organisms.

[0003] The accumulation of senescent cells is causally linked to morphological changes and functional decline in aging tissues. Senescent cells release pro-inflammatory molecules, such as cytokines and chemokines, collectively known as the aging-associated secretory phenotype (SASP), which can damage neighboring non-senescent cells and lead to age-related diseases. However, the distribution and molecular characteristics of senescent cells within tissues are variable both intra- and inter-organ. Therefore, analyzing the location of senescent cells, their environment, and their interactions with neighboring cells holds significant potential for advancing our understanding of aging drivers and may help identify potential intervention targets.

[0004] On the other hand, immunosenescence is a significant contributing factor to aging, referring to the gradual degeneration and functional decline or disorder of the immune system with age. Immunosenescence affects both innate and adaptive immune functions, leading to increased susceptibility to infections, cancer, and autoimmune diseases in the elderly. Immunoglobulins, as core tools of the immune system, play a crucial role in recognizing and neutralizing antigens (such as bacteria, viruses, and toxins). However, significant gaps remain in research on the distribution and functional changes of immunoglobulins in tissues and their impact on cellular senescence with aging. Summary of the Invention

[0005] The inventors made an unexpected discovery that immunoglobulins accumulate abnormally in aging tissues or organs and have the potential to drive cellular senescence and the release of inflammatory factors.

[0006] In a first aspect, the present invention provides a method for identifying the degree of aging of a subject or its tissues or organs, comprising: a) Detecting the presence of immunoglobulin (Ig) molecules in samples from said object; and b) Compare the results of the test with the reference values.

[0007] In some implementations, the reference value is obtained by detecting a reference object. In some implementations, the reference value is obtained by detecting a group of reference objects.

[0008] In some embodiments, the presence of the Ig molecule includes the expression, concentration, and / or distribution of the Ig molecule or its heavy or light chain, or fragments thereof, and the number, proportion, and / or distribution of Ig-positive cells. In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA. In some embodiments, the method includes detecting the expression, concentration, or distribution of immunoglobulin light chain constant regions (Igkc and / or Iglc). In some embodiments, the sample is selected from samples from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0009] In a second aspect, the present invention provides a method for preparing an animal model of aging, comprising administering Ig molecules to the animal or increasing the level of Ig molecules in the animal.

[0010] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA. In some embodiments, the animal model is an animal model of tissue or organ aging, and the method includes locally administering the Ig molecule to the tissue or organ or increasing the level of the Ig molecule in the tissue or organ. In some embodiments, the tissue or organ is selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0011] The present invention also provides a method for preparing an aging cell model, comprising contacting cells with Ig molecules. In some embodiments, the Ig molecules are selected from IgG, IgM, and IgA. In some embodiments, the cells are animal cells, such as non-human mammalian cells, non-human primate cells, or human cells.

[0012] In a third aspect, the present invention provides a method for treating or preventing aging and age-related diseases in a subject, comprising reducing the level of Ig molecules or Ig receptors in the subject, for example, the age-related diseases being chronic diseases, such as those selected from arthritis, premature ovarian failure, liver fibrosis, pulmonary fibrosis, asthenia, and cardiovascular diseases.

[0013] In some embodiments, the aging is the aging of a tissue or organ, and the method includes reducing the level of Ig molecules or Ig receptors in the tissue or organ. In some embodiments, the Ig molecules are selected from IgG, IgM, and IgA.

[0014] In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting one or more genes selected from PIGR, FCAR, FCGR1A or its variants (such as FCGR1B and FCGR1C), FCGR2A, FCGR2B, FCGR2C, FCGR3A, FCGR3B, and FCGR4.

[0015] In some embodiments, the Ig molecule is IgG. In some embodiments, the method includes reducing the level of FcγRIV protein. In some embodiments, the method includes reducing the level of FcγRIV protein by antisense technology or RNAi. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting the Fcgr4 gene.

[0016] In a fourth aspect, the present invention provides a method for screening anti-aging compounds or compositions, comprising: i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig molecules in the sample; and iv) Compare the results of the test with reference values.

[0017] In some implementations, the reference value is obtained by detecting a reference object. In some implementations, the reference value is obtained by detecting a group of reference objects.

[0018] In some embodiments, the presence of the Ig molecule includes the concentration and / or distribution of the Ig molecule or its heavy or light chain, or fragments thereof, and the number, proportion, and / or distribution of Ig-positive cells. In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA. In some embodiments, the method includes detecting the concentration or distribution of the immunoglobulin light chain constant region (IgKc and / or IgLC). In some embodiments, the sample is selected from samples from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0019] This invention also provides a method for identifying the effect of a drug on tissue aging, including... i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig molecules in the sample; and iv) Compare the results of the test with reference values.

[0020] In some implementations, the reference value is obtained by detecting a reference object. In some implementations, the reference value is obtained by detecting a group of reference objects.

[0021] In some embodiments, the presence of the Ig molecule includes the concentration and / or distribution of the Ig molecule or its heavy or light chain, or fragments thereof, and the number, proportion, and / or distribution of Ig-positive cells. In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA. In some embodiments, the method includes detecting the concentration or distribution of the immunoglobulin light chain constant region (IgKc and / or IgLC). In some embodiments, the sample is selected from samples from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain. Attached Figure Description

[0022] Figure 1 Co-staining of IgG and IgKc in the hippocampus, lungs, spleen, heart, small intestine, and lymph nodes of young and old mice; the left side shows representative images of IgG and IgKc co-staining and their magnified views. The right side shows the fold change or proportion change of IgG or IgKc positive cells in multiple tissues of young and old mice (n = 3-5 mice per group).

[0023] Figure 2 Western blot analysis was performed on multiple tissues (including heart, lung, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord) in young and aged mice to quantify the protein levels of IgG heavy chain (IgG-H), IgG light chain (IgG-L), IgA heavy chain (IgA-H), IgM heavy chain (IgM-H), and Igkc in various tissues of young and aged mice (n = 6 mice per group). β-actin was used as a loading control for all tissues except the heart. For the heart, bands extracted from Ponceau Red membrane staining were used as loading controls (LC).

[0024] Figure 3 SA-β-Gal analysis of multiple tissues (including hippocampus, spinal cord, lung, liver, small intestine, spleen, lymph nodes, and testis) in young and old mice; the top image is a representative image, and the bottom image shows the percentage of SA-β-Gal positive areas in the tissues (n = 3 mice per group).

[0025] Figure 4ELISA was used to detect the levels of Igkc, IgG, and IL6 in the plasma of young and old mice. The diagram on the left shows the experimental procedure, and the diagram on the right shows the quantification of the levels of Igkc, IgG, and IL6 in the plasma (n = 5 mice per group for IgG and IL6; n = 6 for young mice and n = 7 for old mice for Igkc).

[0026] Figure 5 Immunofluorescence staining of CD138 in the spleen and lymph nodes of young and old mice; the left side shows a representative image of CD138 staining and its magnified view. The right side shows the statistical analysis of the percentage of CD138-positive cells.

[0027] Figure 6 Co-staining of SPiDER-βGal and Igkc in the spleen and lymph nodes of young and old mice; the left side shows representative images of SPiDER-βGal and Igkc co-staining and their magnified views (n = 5 mice per group). The right side shows the quantification results of Igkc-positive cells and their distance from SPiDER-βGal-positive cells. The number of Igkc-positive cells per unit area within equally spaced intervals was counted using randomly selected SPiDER-βGal-positive cells as the center point.

[0028] Figure 7 Co-staining of IgG and F4 / 80 in the spleen and lymph nodes of young and old mice; the left side shows a representative image of IgG and F4 / 80 co-staining and its magnified view (n = 5 mice per group). The right side shows the distance of IgG positive cells to surrounding F4 / 80 positive cells. The number of IgG positive cells per unit area within equally spaced intervals was counted using randomly selected F4 / 80 positive cells as the center point.

[0029] Figure 8 Co-staining of IgG and IgKc in the spleen and lymph nodes of female mice at 4, 13, and 19 months of age; the left side shows a representative image of IgG and IgKc co-staining and its magnified view. The right side shows the fold change of IgG or IgKc positive cells during aging (n = 3-5 mice per group).

[0030] Figure 9 Representative images and quantification results of Western blot analysis of IgG heavy chain protein levels in liver and lymph node tissues of individuals aged 15–67 years (n = 8–9 for each tissue).

[0031] Figure 10Immunofluorescence staining of IgG in the brain, lymph nodes, and spleen of young and elderly individuals; representative images and magnified views are shown on the left. The percentage of IgG-positive cells in the tissues is shown on the right (n = 3 individuals per group). For lymph nodes, the age and sex of the population were 14 years (female), 15 years (male), 15 years (male), 21 years (male), 21 years (female), 45 years (female), 56 years (male), 58 years (male), 60 years (male), and 65 years (male). For spleen, the age and sex of the population were 14 years (female), 15 years (male), 21 years (female), 23 years (female), 35 years (male), 52 years (female), 52 years (female), 61 years (male), 65 years (male), and 66 years (female). For the frontal lobe, the ages and sexes of the population were 16 (female), 27 (female), 28 (male), 31 (male), 32 (female), 64 (female), 66 (male), 67 (male), 68 (female), and 69 (male).

[0032] Figure 11 IgG induced an increase in the number of SA-β-gal positive cells in three mouse macrophage groups, with the isolation purity of all three macrophage groups exceeding 95%. A. Immunofluorescence staining of F4 / 80 cells in BMM, SPM, and PCM. The left image shows a representative image of F4 / 80 staining. The right image shows the proportion of F4 / 80 positive cells (n = 7). B. SA-β-gal staining in BMM, PCM, and SPM treated with IgG or PBS. The left image shows a representative image of SA-β-gal staining. The right image shows the doubling change in the number of SA-β-gal positive cells in each group (PBS or IgG treatment).

[0033] Figure 12 IgG induces increased P21 expression in three mouse macrophages; the left image shows a representative image and magnified view of P21 co-stained with F4 / 80. The right image shows the doubling change in P21 fluorescence intensity in the PBS or IgG treatment groups (n = 5 per group).

[0034] Figure 13 IgG induces increased expression of P21 and iNOS proteins in mouse macrophages; representative Western blot images and quantitative analysis of P21 and iNOS protein levels in BMM and SPM after IgG or PBS treatment.

[0035] Figure 14IgG induces increased expression of three mouse macrophage aggregates. A. The left image shows a representative and magnified image of aggresome co-stained with F4 / 80; the right image shows statistical data of aggregate-positive cells in PBS and IgG-treated groups (n = 5 per group). B. Co-staining of MMTV and F4 / 80 in BMDM treated with PBS (Veh) or IgG. n = 5 biological replicates. Scale bar, 20 μm. C. Co-staining of H3K9me3 and F4 / 80 in BMDM treated with Veh or IgG. The left image shows a representative image of H3K9me3 and F4 / 80 co-stained. The right image shows the fluorescence intensity of H3K9me3 in the Veh or IgG-treated groups (at least 250 cells per group). Scale bar, 20 μm. D. Co-staining of Lamin B1 and F4 / 80 in BMDM treated with Veh or IgG. The left image shows a representative image of Lamin B1 and F4 / 80 co-stained. The right figure shows the fluorescence intensity values ​​of Lamin B1 in the Veh or IgG treatment groups (at least 250 cells were counted for each group). Scale bar, 20 μm.

[0036] Figure 15 IgG induces increased expression of p-P65 and STAT1 in mouse macrophages; representative Western blot images and quantitative analysis of p-P65 and STAT1 protein levels in BMM and SPM treated with IgG or PBS. n = 3 independent cell culture wells.

[0037] Figure 16 IgG induced increased secretion of inflammatory factors such as IL-6, C4B, and C1qA from three mouse macrophages. The levels of IL-6, C1qA, and C4B in the culture medium of primary cultured macrophages (BMM, SPM, and PCM) after treatment with IgG or PBS were detected by ELISA. n = 3 independent cell culture wells.

[0038] Figure 17 IgG induced increased nitrite (NO) production in three mouse macrophages. Primary cultured macrophages (BMM, SPM, and PCM) were treated with IgG or PBS, and nitrite production in the culture medium was measured. n = 3 independent cell culture wells.

[0039] Figure 18RNAseq data confirmed that IgG promoted significant upregulation of genes associated with aging and inflammation. A. PCA shows the differences in transcriptomic profiles in BMM, SPM, PCM, and microglia after IgG treatment. B. Heatmap shows the upregulation and downregulation of differentially expressed genes (DEGs) in BMM, SPM, PCM, and microglia after IgG treatment. C. Network diagram shows the enrichment analysis results of DEG upregulation in BMM, SPM, PCM, and microglia after IgG treatment. D. Heatmap shows the overlap between the upregulated DEG and SASP gene sets in BMM, SPM, PCM, and microglia after IgG treatment. E. Box plot shows gene expression in BMM, SPM, PCM, and microglia after IgG treatment. F. Network diagram of upstream regulators of upregulated DEGs in BMM, SPM, PCM, and microglia after IgG treatment.

[0040] Figure 19 Knockdown of the gene Fcgr4, which encodes the IgG Fc receptor, alleviates IgG-induced macrophage senescence and inflammation. A. qRT-PCR analysis of Fcgr4 expression levels in siRNA-treated and control BMMs. n = 4 independent cell culture wells. B. Representative Western blot images and quantitative analysis of FcγRIV protein levels in siRNA-treated or control BMMs. n = 3 independent cell culture wells. C. ELISA detection of IL6 and C1qA levels in siRNA-transfected BMMs treated with IgG or PBS. n = 3-4 independent cell culture wells. D. SA-β-Gal staining of siRNA-transfected BMMs treated with IgG or PBS. The left image shows a representative image of SA-β-Gal staining. The right image shows the proportion of SA-β-gal positive cells after treatment in each group (si-NC PBS, si-NC IgG, or si-Fcgr4 IgG). n = 3 independent cell culture wells. E. Immunofluorescence staining of Lamin B1 in primary cultured macrophages (BMDM) transfected with siRNA treated with Veh or IgG. The left panel shows a representative image of Lamin B1 staining. The right panel shows the fluorescence intensity values ​​of Lamin B1 in each group (treated with si-NC-Veh, si-NC-IgG, or si-Fcgr4 IgG) (at least 250 cells were counted per group). Scale bar, 20 μm.

[0041] Figure 20IgG treatment triggers increased senescence and inflammation in human macrophages, such as an increase in SA-β-gal positive cells, elevated P21 expression, and increased HERVK-Env protein expression. A. Immunofluorescence staining of human macrophages with CD68. The left image shows a representative image of CD68 staining. The right image shows the proportion of CD68 positive cells (n = 5). B. SA-β-gal staining of human macrophages treated with IgG or PBS. The left image shows a representative image of SA-β-gal staining. The right image shows the changes in SA-β-gal positive cells in each group (PBS or IgG treatment). n = 5 independent cell culture wells. C. Co-staining of P21 and CD68 in human macrophages after treatment with IgG or PBS. The left image shows a representative image and magnified view of P21 and CD68 co-staining. The right image shows the doubling change in P21 fluorescence intensity in the PBS and IgG treatment groups (n = 5 per group). D. Co-staining of HERVK-Env and CD68 in human macrophages after treatment with IgG or PBS. The left image shows a representative image and magnified view of HERVK-Env and CD68 co-staining. The right image shows the doubling change in HERVK-Env fluorescence intensity values ​​in the PBS and IgG treatment groups (n = 5 per group). E. Co-staining of H3K9me3 and CD68 in human macrophages treated with Veh or IgG. The left image shows a representative image of H3K9me3 and CD68 co-staining. The right image shows the fluorescence intensity value of H3K9me3 in the Veh or IgG treatment groups (at least 250 cells per group). Scale bar, 20 μm. F. Co-staining of Lamin B1 and CD68 in human macrophages treated with Veh or IgG. The left image shows a representative image of Lamin B1 and CD68 co-staining. The right image shows the fluorescence intensity value of Lamin B1 in the Veh or IgG treatment groups (at least 250 cells per group). Scale bar, 20 μm. G. SA-β-Gal staining of human macrophages treated with Veh or IgG (n=5). Scale bar, 50 μm. H. ELISA was used to detect IL6 levels in culture medium collected from human macrophages treated with Veh or IgG (n=4).

[0042] Figure 21IgG treatment triggers increased senescence and inflammation in mouse microglia, such as an increase in SA-β-gal positive cells, elevated expression of P21, aggregates, p-P65, and STAT1, increased secretion of IL6, C1qA, and C4B, and increased NO production. A. Immunofluorescence staining of IBA-1 in microglia. The left image shows a representative image of IBA-1. The right image shows the proportion of IBA-1 positive cells (n = 7). B. SA-β-Gal staining of primary microglia treated with IgG or PBS. The left image shows a representative image of SA-β-Gal staining. The right image shows the proportion of SA-β-gal positive cells in each group (PBS or IgG treatment). n = 3 independent cell culture wells. C. Representative Western blot images and quantification of P21 protein in microglia treated with IgG or PBS. n = 3 independent cell culture wells. D. Co-staining of P21 and IBA-1 in microglia treated with IgG protein or PBS. The left image shows a representative image and magnified view of P21 co-stained with IBA-1. The right image shows the fluorescence intensity of P21 in the PBS and IgG treatment groups (n=5 per group). E. Co-staining of aggregates and IBA-1 in microglia treated with IgG protein or PBS. The left image shows a representative image and magnified view of aggresome co-stained with IBA-1. The right image shows statistical data of aggregate-positive cells in the PBS and IgG treatment groups (n=5 per group). F. Representative Western blot images and quantitative analysis of p-P65 and STAT1 protein levels in microglia treated with IgG or PBS. n=3 independent cell culture wells. G. Quantitative analysis of IL-6, C1qA, and C4B levels in microglia treated with IgG or PBS. H. Quantitative analysis of nitrite production in microglia treated with IgG or PBS.

[0043] Figure 22 IgG treatment triggers increased senescence and inflammation in human microglia, such as elevated aggresome expression and increased IL6 secretion. A. Immunofluorescence staining of IBA-1 in human microglia. The left image shows a representative image of IBA-1. The right image shows the proportion of IBA-1 positive cells (n = 9). B. Co-staining of P21 and IBA-1 in human microglia treated with PBS (Vehicle) or IgG (n = 5). Scale bar, 20 μm. C. Co-staining of aggregates and IBA-1 in human microglia treated with IgG protein or PBS. The left image shows a representative image and magnified view of aggresome and IBA-1 co-staining. The right image shows statistics of aggregate-positive cells in the PBS and IgG treated groups (n = 3 per group). D. Detection of IL6 levels in the culture medium of human microglia treated with IgG or PBS by ELISA. n = 4 independent cell culture wells.

[0044] Figure 23 IgG treatment caused IgG accumulation in multiple tissues and organs of young mice.

[0045] Figure 24 IgG treatment resulted in an increase in P21-positive cells in multiple tissues and organs of young mice.

[0046] Figure 25 IgG treatment increased inflammation levels in multiple organs and tissues in young mice, including S100A8, IL1b, and IBA1.

[0047] Figure 26 ASO-Fcgrt treatment can reduce FcRn levels in multiple tissues and organs of aged mice.

[0048] Figure 27 ASO-Fcgrt treatment can reduce IgG levels in multiple tissues and organs of aged mice.

[0049] Figure 28 ASO-Fcgrt treatment can reduce the levels of P21, S100A8 and IL-1β in multiple tissues and organs of aged mice.

[0050] Figure 29 ASO-Fcgrt treatment can reduce SA-β-gal levels in multiple tissues and organs of aged mice.

[0051] Figure 30 ASO-Fcgrt treatment can reduce IL-1β levels in the lymph nodes and spleen of aged mice.

[0052] Figure 31Morphological and histological analysis of male mouse tissues to identify aging phenotypes. A. SPiDER-βGal staining of various tissues from young (2-month-old) and aged (25-month-old) male mice, including hippocampus, liver, small intestine, spleen, lymph nodes, and testes. Top image is a representative image; bottom image shows the percentage of SPiDER-βGal-positive cells in the tissues (n=5). Scale bar, 20 μm. B. Immunofluorescence of the immunocellular marker CD45 in the heart, lung, small intestine, and testes of young and aged male mice. Top image is a representative image; bottom image shows the percentage of CD45-positive cells in the tissues (n=5). Scale bar, 15 μm. C. Immunofluorescence of the microglia marker IBA1 in the hippocampus and spinal cord of young and aged male mice. Quantitative percentage of IBA1-positive microglia (n=6). Scale bars, 50 μm and 20 μm (magnification). D. H&E staining of liver tissue from young and aged male mice. Dashed circles indicate inflammatory areas, and the changes in wrinkling within these areas are quantified (n=5). Scale bars, 100μm and 50μm (magnification). E. Masson trichrome staining of spleen, small intestine, and heart in young and aged male mice. The left image is a representative image, and the right image shows the quantification of the percentage of fibrosis area (small intestine, heart, and aged spleen n=5; young spleen n=4). Scale bar, 50μm. F. Immunofluorescence of CD31 in hippocampus, spinal cord, and spleen of young and aged male mice. Quantification of the percentage of CD31-positive areas (n=6). Scale bars, 500μm and 50μm (magnification). G. Immunofluorescence of DCX in hippocampus of young and aged male mice, quantifying the percentage of DCX-positive cells (young group n=7; aged group n=6). Scale bars, 50μm and 20μm (magnification). H. H&E staining of heart tissue from designated groups of male mice (n=4). Scale bars, 1 mm and 50 μm (magnification). I. H&E staining of lung tissue from male mice in designated groups. n = 5 mice per group. Scale bars, 100 μm and 50 μm (magnification).

[0053] Figure 32Multi-timepoint histological analysis of aging and inflammatory biomarkers in male mouse tissues. A. SPiDER-βGal staining of various tissues, including hippocampus, liver, spleen, and lymph nodes, from male mice of five different age groups (2 months, 4 months, 13 months, 19 months, and 25 months). The left image is a representative image, and the right image shows the percentage of SPiDER-βGal-positive cells in the tissues (n=3-5). Scale bar, 40 μm. B. Immunohistochemical staining of P21 in the hippocampus, liver, spleen, and lymph nodes of mice of five different age groups. The top image is a representative image, and the bottom image shows the percentage of P21-positive cells in the tissues (n=5). Scale bars, 50 μm and 10 μm (magnification). C. Immunofluorescence staining of Lamin B1 in the liver and spleen of mice of five different age groups. The top image is a representative image and a magnified view. The bottom image shows the fold change in Lamin B1 fluorescence intensity in the tissues (n=5). Scale bar, 10 μm and 10 μm (magnification). D. Aggregate staining in hippocampus, spleen, and lymph nodes of mice in five different age groups. Top image: representative image and magnified view. Bottom image: fold change of aggregate-positive areas in tissues (n=4-5 mice per group). Scale bar, 50 μm and 10 μm (magnification). E. Masson staining of spleen and lymph nodes in five different age groups. Top image: representative image and magnified view. Bottom image: fold change of fibrotic areas in tissues (n=5-6). Scale bar, 50 μm. F. Immunohistochemical staining of γH2AX in liver, spleen, and lymph nodes in five different age groups. Top image: representative image and magnified view. Bottom image: fold change of γH2AX-positive cells in tissues (n=4-5). Scale bar, 50 μm and 20 μm (magnification). G. Immunofluorescence staining of 4-HNE in the hippocampus, spleen, and lymph nodes of mice from five different age groups. The top image shows a representative image and a magnified view. The bottom image shows the percentage of 4-HNE-positive cells in the tissues (n=4-5). Scale bars for the hippocampus and spleen are 40 μm and 15 μm (magnified), respectively. Scale bars for the lymph nodes are 200 μm and 15 μm (magnified). H. Staining of IL-1β in the hippocampus, spleen, and lymph nodes of mice from five different age groups. The top image shows a representative image and a magnified view. The bottom image shows the percentage of IL-1β-positive cells in the tissues (n=4-5). Scale bars, 40 μm and 15 μm (magnified). I. Immunohistochemical staining of TNFα in the spleen and lymph nodes of five different age groups. The top image shows a representative image and a magnified view. The bottom image shows the fold change of TNFα-positive cells in the tissues (n=4-5). Scale bars, 50 μm and 10 μm (magnified).

[0054] Figure 33Immunofluorescence staining of MMTV in spleen and lymph nodes of mice from five different age groups. The top image shows a representative image and a magnified view. The bottom image shows the fold change in the number of MMTV-positive cells in the tissues (n=5). Scale bars, 40 μm and 15 μm (magnification).

[0055] Figure 34 : Mouse symbiotic experiment. A. Schematic diagram showing two live mice surgically connected and sharing a physiological system. B. Immunofluorescence staining of IgG in the spleen of xenobiotic mice. The left image shows representative images from four groups of mice, including young mice in isochronous symbiosis (Iso-Y), older mice in isochronous symbiosis (Iso-O), young mice in heterochronous chronic symbiosis (Het-Y), and older mice in heterochronous chronic symbiosis (Het-O). The right image shows the fold change of IgG positive cells in each group (n=4-5). Scale bar, 50 μm. C. Immunohistochemical staining of P21 in the spleen of xenobiotic mice. The left image shows representative images from four groups of mice, including Iso-Y, Iso-O, and Het-Y, as well as Het-O. The right image shows the fold change of P21 positive cells in each group (n=5). Scale bar, 50 μm and 20 μm (magnified).

[0056] Figure 35 Mouse exercise experiment. A. Schematic diagram. B. Immunofluorescence staining of IgG in the spleen of exercised aged mice or control aged mice. Left image: representative image and magnified view. Right image: fold change of IgG positive cells in each group (n=5-6 per group). Scale bar: 40μm and 15μm (magnification). C. Immunohistochemical staining of P21 in the spleen of exercised aged mice or control aged mice. Left image: representative image and magnified view. Right image: fold change of P21 positive cells in each group (n=4-5 per group). Scale bar: 50μm and 20μm (magnification).

[0057] Figure 36 Changes in tissue structure and moisture. A. H&E staining of spleen tissue from young and old male mice. Nuclear density less than 450 nuclei / 1000 μm. 2 The white pulp was defined as fragmented white pulp (n=5). Scale bar, 100 μm. B. Immunofluorescence staining showed structural changes in the livers of young and aged mice, manifested as different proportions of liver regions (E-cadherin was the marker for region 1, and glutamine synthase (GS) was the marker for region 3) (n=5). Quantification and display of fold changes in the proportions of region 1 and region 3 in the livers of young and aged mice were shown. Scale bars, 200 μm and 40 μm (magnification).

[0058] Figure 37Senescent cells and cytokine secretion are co-localized and surrounded by plasma cells. A. Co-staining of SPiDER-βGal and TNF-α in the liver, spleen, and testes of young (2-month-old) and old (25-month-old) male mice. The left image shows a representative image and magnified view of SPiDER-βGal and TNF-α co-staining. The middle image shows the fold change of SPiDER-βGal and TNF-α positive cells in multiple tissues. The right image shows the quantification of TNF-α positive cells and their distance from SPiDER-βGal positive cells (n=4-6). The number of TNF-α positive cells at equidistant distances and per unit area was calculated using randomly selected SPiDER-βGal positive cells as the center point. Scale bar, 20 μm. B. Co-staining of SPiDER-βGal and NeuN (neuronal marker) in the hippocampus of young and old male mice. The left image shows a representative image of SPiDER-βGal and NeuN co-staining. The middle panel shows the percentage of NeuN-positive cells among SPiDER-βGal-positive cells. The right panel shows the fold change in the number of SPiDER-βGal-positive cells in the hippocampus between young and old groups, as well as the ratio of NeuN-positive to NeuN-negative cells in each group of SPiDER / βGal-positive cells (n=5). Scale bars, 50 μm and 10 μm (magnification). C. Co-staining of SPiDER-βGal and CYP11A1 (Leydig cell markers) in the testes of young and old male mice. The left panel shows a representative image of SPiDER-βGal and CYP11A1 staining in the testes. The middle panel shows the fold change in the number of SPiDER-βGal-positive cells between young and old groups. The right panel shows the fold change in the number of CYP11A1-positive and CYP11A1-negative cells in each group of SPiDER-βGal-positive cells (n=5). Scale bars, 200 μm and 20 μm (magnification). D. Co-staining of SPiDER-βGal and CD138 (plasma cell markers) in the spleen of young and aged male mice. The left panel shows a representative image of CD138 and SPiDER-βGal co-staining and a magnified view. The right panel shows a statistical analysis of the percentage of CD138-positive cells in SPiDER-βGal-positive cells (n=5). Scale bars, 100 μm and 15 μm (magnification). E. Co-staining of SPiDER-βGal and CD138 in lymph nodes of young and aged male mice. The left panel shows a representative image of CD138 and SPiDER-βGal co-staining and a magnified view. The right panel shows a statistical analysis of the percentage of CD138-positive cells in SPiDER-βGal-positive cells (n=5). Scale bars, 200 μm and 25 μm (magnification).

[0059] Figure 38Immunofluorescence staining of complement 4B (C4B) in the spleen and lymph nodes of young and aged mice. The left panel shows a representative image and magnified view of C4B staining. The right panel shows the fold change in C4B-positive cells in young (2-month-old) and aged (25-month-old) mice (n=4 or 5). Scale bars, 40 μm and 15 μm (magnification). Mann-Whitney test. Data are expressed as mean ± SEM.

[0060] Figure 39 : A heatmap showing high-frequency upregulation of senescence-DEG in different mouse tissues and cell types. Invention Details The invention is described in conjunction with the embodiments listed below; however, it should be understood that they are not intended to limit the invention to these embodiments. Rather, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the scope of the invention as defined in the claims. Those skilled in the art will recognize that many methods and materials similar to or equivalent to those described herein can be used to practice the invention. The invention is not limited to the methods and materials described. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although suitable methods and materials are described below, similar or equivalent methods and materials may also be used in the practice or testing of the invention.

[0061] I. Definition As used herein, the term “and / or” covers all combinations of items connected by the term and should be regarded as if each combination had been listed separately herein. For example, “A and / or B” covers “A,” “A and B,” and “B.” For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”

[0062] In this article, the term "object" refers to non-human animal objects, such as non-human mammals, birds, reptiles, fish, etc., including livestock, poultry, pets, racing animals, or human objects.

[0063] The term "aging" generally refers to the progressive decline in an organism's physiological and / or psychological adaptability to its environment, gradually leading to death. Aging can be divided into physiological aging and pathological aging. Physiological aging refers to the physiological degeneration process that occurs after maturity, while pathological aging is the age-related change caused by various external factors (including various diseases). However, aging is the result of the combined effects of many pathological, physiological, and psychological processes, and in most cases, it is impossible to completely distinguish between physiological and pathological aging. Aging can be systemic or it can be the aging of tissues, organs, or systems.

[0064] The "degree of aging" of an object is usually related to "physiological age," which refers to the level of physiology and function reflected by an object at a certain natural age, that is, the degree of physiological and functional performance corresponding to a certain natural age.

[0065] Premature aging in an individual refers to a physiological age that is significantly greater than their chronological age, usually caused by factors such as environment, disease, or overwork. In some cases, premature aging includes hereditary progeria, such as Hutchinson-Gilford progeria syndrome (HGPS) and Werner syndrome (WS).

[0066] Cellular senescence is considered a major cause of aging in organisms, generally referring to cells maintaining vitality and metabolic activity but losing their proliferative capacity. Significant characteristics of senescent cells include (i) growth arrest, (ii) enlarged and flattened cell morphology, (iii) DNA damage foci in the cell nucleus, (iv) senescence-associated secretory phenotype (SASP), (v) increased senescence-associated β-galactosidase (SA-β-gal) activity, (vi) increased expression of the tumor suppressor p21, and (vii) an increase in the number and size of aggresomes.

[0067] The senescence phenotype pathways that lead to cellular senescence typically include replicative senescence (RS), premature senescence, and post-differentiation senescence (SAD). Replicative senescence is a type of senescence that occurs after a large number of cell divisions. For example, when grown in a culture, primary cells undergo cellular senescence after approximately 50 cell divisions. This impairment to further proliferation is thought to be due to the shortening of telomeres with each successive cell division, causing the cell to reach a point that triggers a DNA damage response (the so-called "Hayflick limit"), ultimately leading to induced proliferation arrest and senescence. Premature senescence refers to cellular senescence without telomere loss or dysfunction, such as senescence caused by chromatin relaxation. Premature senescence can be induced by a variety of stimuli, including, for example, chemotherapy, radiation therapy, DNA damage, oxidative stress, inflammation, strong mitotic signaling, and ribosomal stress. Furthermore, genetic defects in cells can also cause premature cellular senescence; for example, cells from HGPS or WS patients mentioned above exhibit premature senescence. Senescence-associated aging (SAD) refers to the senescence-like phenotype (including senescence-associated sarcopenia) exhibited by terminally differentiated postmitotic cells. It can be induced by various stressors, including genotoxicity, protein toxicity, oxidative stress, and ribosomal stressors. Studies have shown that SAD has been observed in certain diseases. In this article, the “senescence degree” of cells refers to the senescence-related phenotype being comparable to the corresponding phenotype of cells after a specific number of passages.

[0068] The inventors discovered that immunoglobulins (Ig) accumulate abnormally in aging tissues and drive cellular senescence and the release of inflammatory factors.

[0069] As used herein, the term "immunoglobulin" refers to a globulin with antibody (Ab) activity or a chemical structure similar to that of an antibody molecule. An immunoglobulin is a tetrapeptide chain structure composed of two identical light chains and two identical heavy chains linked by interchain disulfide bonds. Immunoglobulins are generally classified into five classes: immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD), and immunoglobulin E (IgE). Immunoglobulins also encompass the peptide linking monomers in multimeric immunoglobulins (such as IgM and IgA), i.e., the J chain, also known as IgJ; and various immunoglobulin subtypes, such as the IgG subtypes IgG1, IgG2, IgG3, and IgG4. Immunoglobulin is a chemical structural concept. Immunoglobulins include antibodies and membrane immunoglobulins. Antibodies are mainly found in serum, but can also be found in other body fluids and exocrine fluids; their main function is to specifically bind antigens. Membrane immunoglobulins are antigen receptors on B cell membranes that specifically recognize antigen molecules. Immunoglobulins are usually synthesized and secreted by B cells after they differentiate and mature into plasma cells.

[0070] In this article, "reference value" refers to a constant index of representative physiological and biochemical characteristics, including morphology, function, and metabolites, of a normal object or its cells, tissues, or organs in a specific state (such as age or passage number), or normal isolated cells or cell populations. Reference values ​​can be predetermined values ​​or values ​​obtained by testing a reference object or reference cells.

[0071] In this document, "reference object" refers to an object that has the aforementioned representative characteristics. For example, in this invention, a reference object refers to an object that has, for instance, representative characteristics of a specific degree of aging or physiological age.

[0072] As used herein, the terms "polynucleotide" or "nucleic acid molecule" include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA), as well as DNA or RNA analogs produced using nucleotide analogs. The nucleic acid molecule may be single-stranded or double-stranded, preferably double-stranded DNA. The synthesis of the nucleic acid may use nucleotide analogs or derivatives (e.g., inosine or thiophosphate nucleotides). Such nucleotides can be used, for example, to prepare nucleic acids with altered base-pairing capabilities or increased nuclease resistance.

[0073] As used herein, the term "coding" refers to the amino acid sequence of a polynucleotide that directly identifies its protein product. The boundaries of a coding sequence are generally defined by an open reading frame (ORF), typically beginning with an ATG start codon or other start codons such as GTG and TTG, and ending with a stop codon such as TAA, TAG, and TGA. The coding sequence can be DNA, cDNA, or a recombinant nucleotide sequence.

[0074] As used in this article, "antisense nucleic acid" refers to a nucleic acid molecule that has a complementary sequence to a target nucleic acid (e.g., mRNA) and participates in gene expression regulation by binding to the target nucleic acid through base pairing. Antisense nucleic acids include RNA or DNA molecules that can precisely complement specific mRNAs and specifically block their translation.

[0075] As used in this article, "interfering nucleic acid" refers to RNA molecules that encode RNA interference (RNAi), including nucleic acid molecules such as siRNA, shRNA, and miRNA.

[0076] In this article, the term "protein" refers to a biological macromolecule composed of one or more chains of "polypeptides". A polypeptide is a chain containing ten or more amino acid residues linked by peptide bonds. All peptide and polypeptide chemical formulas or sequences in this article are written from left to right, indicating the direction from the amino terminus to the carboxyl terminus.

[0077] In the context of peptides, the terms "amino acid," "residue," and "amino acid residue" are used interchangeably, including both naturally occurring and non-natural amino acids in proteins. The single-letter and three-letter names for naturally occurring amino acids in proteins follow the conventional names used in the field, as seen in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd, ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

[0078] As used herein, "percentage of similarity" refers to the percentage of amino acids or nucleotides that are approximately the same in two polypeptides or nucleic acid molecules when the alignment is optimal. For example, "95% amino acid / nucleotide similarity" means that when the alignment is optimal, the two polypeptides have 95% of the same amino acids or nucleotides.

[0079] As used in this article, “isolated” cells refer to cells that are separate from their source organism, usually referring to cells cultured in vitro, including but not limited to adherent cells, suspension cells, or 3D cultured cells.

[0080] The CRISPR / Cas system refers to clusters of regularly spaced short palindromic repeats and related systems that can cut DNA strands at specific locations under the guidance of guide RNA.

[0081] The CRISPR-dCas system involves modifying Cas to lose its nuclease activity, thus preventing it from cleaving the DNA strand, while simultaneously linking it to the transcription activation domain to achieve site-specific transcriptional activation.

[0082] Similarly, the CRISPR-dCas system can also be used to regulate transcription by modulating the methylation level of the region of interest. Specifically, dCas can be linked to sequences that promote methylation, such as amino acid sequences with methyltransferase activity (e.g., CRISPR-dCas-SunTag-DNMT3A), to increase the methylation level of the region of interest, thereby reducing transcription in that region. Alternatively, dCas can be linked to sequences that inhibit methylation, such as the Tet (ten-eleven translocation) catalytic domain (CRISPR-dCas-Tet), to decrease the methylation level of the region of interest, thereby increasing transcription in that region.

[0083] II. Methods for Assessing the Degree of Aging The inventors made an unexpected discovery that Ig molecules and complement molecules accumulate abnormally in tissues and organs during the aging process.

[0084] Therefore, the present invention provides a method for identifying the degree of aging of a subject or its tissues, organs, or systems, or for assessing the age of a subject, including... a) Detect the presence of Ig (e.g., IgG, IgM, and IgA) and / or complement (e.g., complement C3, C4, or their active forms (e.g., C4B and C1q) molecules in samples from said object; and b) Compare the results of the test with the reference values.

[0085] In some embodiments, the presence of the Ig molecule includes the concentration and / or distribution of the Ig molecule or its heavy or light chain or fragments, and the number, proportion, and / or distribution of Ig-positive cells. Lower concentrations and / or distributions of Ig molecules or their heavy or light chains and fragments, as well as lower numbers, proportions, and / or distributions of Ig-positive cells, represent a lower degree of aging or a lower physiological age.

[0086] In some embodiments, the presence of the complement molecule includes the concentration and / or distribution of the complement molecule or fragments thereof, and the number, proportion, and / or distribution of complement-positive cells. Lower concentrations and / or distributions of complement molecules or fragments thereof, as well as lower numbers, proportions, and / or distributions of complement-positive cells, represent lower levels of aging or lower physiological age.

[0087] In some embodiments, the reference value is obtained by detecting a reference object. In this invention, the reference object refers to an object at a specific physiological age. A desired reference object can be determined by detecting representative characteristics related to physiological age (e.g., characteristics selected from brain activity, skin elasticity, reflexes, and balance). Preferably, due to individual differences, the reference value is obtained by detecting a group of reference objects.

[0088] According to the present invention, a number of normal subjects who are statistically significant in number and are at a specific natural age (e.g., 20, 30, 40, 50, 60, 70, 80, 90 or older) or a natural age range (e.g., 18-22, 28-32, 38-42, 48-52, 58-62, 68-72, 78-82, 88-92, etc.) may also be selected as reference subjects.

[0089] The reference values ​​can be expressed as "mean ± standard deviation" or as a range. When testing a population to determine the reference values, the highest and lowest values ​​can be removed, for example, removing the highest 2.5% and / or the lowest 2.5%.

[0090] When the detection results (i.e., the presence of Ig molecules, for example, the concentration and / or distribution of Ig molecules or their heavy or light chains or fragments, and the number, proportion, and / or distribution of Ig-positive cells; and / or the presence of complement molecules, for example, the concentration and / or distribution of complement molecules or their fragments, and the number, proportion, and / or distribution of complement-positive cells) are higher than the reference value, the aging degree of the subject or its tissue or organ, or the physiological age of the subject, is identified as higher than the aging degree or physiological age corresponding to the reference value; when the detection results (i.e., the presence of Ig molecules, for example, the concentration and / or distribution of Ig molecules or their heavy or light chains or fragments, and the number, proportion, and / or distribution of Ig-positive cells; and / or the presence of complement molecules, for example, the concentration and / or distribution of complement molecules or their fragments, and the number, proportion, and / or distribution of complement-positive cells) are lower than the reference value, the aging degree of the subject or its cells, tissues, or organs, or the physiological age of the subject, is identified as lower than the aging degree or physiological age corresponding to the reference value.

[0091] In some implementations, the reference value is obtained by detecting a reference object or a group of reference objects. When the detection result is higher than the reference value, the aging degree of the object or its tissues or organs, or the physiological age of the object, is identified as higher than the (average) aging degree of the reference object or the group of reference objects, or the (average) physiological age of the reference object or the reference group; when the detection result is lower than the reference value, the aging degree of the object or its cells, tissues or organs, or the physiological age of the object, is identified as lower than the (average) aging degree of the reference object or the group of reference objects, or the (average) physiological age of the reference object or the reference group.

[0092] In some embodiments, the reference value is a value or range representing the concentration and / or distribution of the Ig molecule or the heavy or light chain of the Ig molecule or fragments thereof in a reference object or a population of reference objects, and the number, proportion, and / or distribution of Ig-positive cells. The Ig-positive cells may be B cells or plasma cells.

[0093] In some embodiments, the presence of the Ig molecule (such as IgG, IgM, and IgA) is detected by a protein-binding molecule. Protein-binding molecules include any molecule capable of binding to a given protein, such as, but not limited to, receptors for Ig molecules (such as IgG receptor FcγRIV, and IgA receptors pIgR and FcαRI) and their ligand-binding moieties, or anti-Ig antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, the Ig receptor is selected from FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some embodiments, the binding molecule includes an extracellular domain of the Ig receptor. In some embodiments, the antigen-binding fragment of the antibody includes, but is not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0094] In some implementations, the presence of nucleotide sequences (such as mRNA) encoding Ig molecules (such as IgG, IgM, and IgA), Igkc, and / or Iglc can be detected.

[0095] In some embodiments, the reference value is a value or range representing the concentration and / or distribution of the complement (such as complement C3, C4, or their active forms (such as C4B) and C1q) molecules or fragments representing a reference object or a population of reference objects, as well as the number, proportion, and / or distribution of complement-positive cells. Examples of complement-positive cells include, but are not limited to, immune cells (such as macrophages, neutrophils, B cells, and T cells) and hepatocytes.

[0096] In some embodiments, the presence of the complement molecule is detected by a protein-binding molecule. Protein-binding molecules include any molecule capable of binding to a given protein, such as, but not limited to, receptors for complement molecules (e.g., CR1, CR2, and CR3) and their ligand-binding moieties, or anti-complement antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, the antigen-binding fragments of antibodies include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0097] In some implementations, the presence of nucleotide sequences (e.g., mRNA) encoding complement molecules (e.g., complement C3, C4, or their active forms (e.g., C4B and C1q) can be detected.

[0098] In some embodiments, the object is a mammal. In some embodiments, the object is a non-human mammal. For example, the object is a mouse, or the object is a non-human primate. Preferably, the object is a human.

[0099] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of immunoglobulin light chain constant regions (IgKc and / or Iglc) in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgKc and / or Iglc-positive cells in a sample.

[0100] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgG in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgG-positive cells in a sample.

[0101] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgM in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgM-positive cells in a sample.

[0102] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgA in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgA-positive cells in a sample.

[0103] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C3 in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C3-positive cells in a sample.

[0104] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C4 in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C4-positive cells in a sample. For example, complement C4 or its active form C4B can be detected.

[0105] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C1q in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C1q-positive cells in a sample.

[0106] The samples that can be used in the methods of the present invention are samples from the tissues, organs, or systems of the object, such as biopsy samples of various tissues or organs. The samples may be samples from one or more tissues or organs of the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen), nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex), endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads), urinary system (e.g., kidneys, ureters, bladder, and urethra), digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder), musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments), respiratory system (e.g., lungs, trachea, bronchi), and reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissues include, but are not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage.

[0107] The samples that can be used in the methods of the present invention can also be bodily fluid samples, such as synovial fluid, cerebrospinal fluid, urine, saliva and blood, including whole blood, plasma or serum.

[0108] In some embodiments, the sample is a sample from tissues or organs selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0109] In some embodiments, the method includes detecting the number of IgG-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the number of IgKc-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female.

[0110] In some embodiments, the method includes detecting the concentration of IgKc in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgG in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgA in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgM in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female.

[0111] In some embodiments, the method includes detecting the number of IgG-positive cells in tissues or organs selected from the prefrontal cortex, lymph nodes, and spleen, optionally wherein the subject is a human. In some embodiments, the method includes detecting the concentration of IgG in tissues or organs selected from the liver and lymph nodes, optionally wherein the subject is a human.

[0112] In some embodiments, the method includes detecting the presence of complement C4B in tissues or organs selected from the liver and lymph nodes, optionally wherein the subject is a mouse.

[0113] III. Methods for preparing aging models The inventors discovered that Ig and complement molecules promote aging and an inflammatory microenvironment. Therefore, aging models can be prepared using Ig and / or complement molecules.

[0114] The present invention provides a method for preparing an aging animal model, the method comprising administering Ig and / or complement molecules to the animal or increasing the level of Ig and / or complement molecules in the animal.

[0115] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA.

[0116] In some of the embodiments, the complement molecule is selected from complement C3, C4 or their active forms (such as C4B) and C1q.

[0117] In some embodiments, the animal model is an animal model of tissue or organ aging, and the method includes locally administering the Ig and / or complement molecules to the tissue or organ or increasing the levels of Ig molecules and / or complement in the tissue or organ.

[0118] The organ or tissue may be from one or more of the following: the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen); the nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex); the endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads); the urinary system (e.g., kidneys, ureters, bladder, and urethra); the digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder); the musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments); the respiratory system (e.g., lungs, trachea, bronchi); and the reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissue includes, but is not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage. In some embodiments, the tissue or organ is selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0119] In some embodiments, the animal is selected from non-human mammals, birds, reptiles, fish, etc., including livestock, poultry, pets, and racing animals. In some embodiments, the animal is a rodent, such as a rat, mouse, or hamster.

[0120] The levels of Ig and / or complement molecules in animals can be increased using methods known in the art, for example, through transcriptional activation systems targeting loci encoding Ig and / or complement, or demethylation systems targeting loci encoding Ig and / or complement. In some embodiments, the transcriptional activation system is a CRISPR-dCas transcriptional activation system. In some embodiments, the demethylation system is a CRISPR-dCas-based demethylation system, such as CRISPR-dCas-Tet.

[0121] Ig molecule levels can also be increased by activating Ig-secreting cells or their precursors, such as plasma cells and B cells. In some embodiments, the method includes administering a B-cell agonist or plasma cell agonist, such as B-cell activating factor (e.g., BAFF), to the animal.

[0122] Ig molecule levels can also be increased by reducing Ig molecule consumption. For example, IgG levels in tissues are maintained through FcRn receptor-mediated recycling on the cell surface. It has been shown that FcRn consumption can reduce IgG concentrations in tissues. Therefore, in some embodiments, the method includes increasing FcRn levels. For example, FcRn levels can be increased by a transcriptional activation system targeting the Fcgrt gene or a demethylation system targeting the Fcgrt gene. In some embodiments, the transcriptional activation system is a CRISPR-dCas transcriptional activation system. In some embodiments, the demethylation system is a CRISPR-dCas-based demethylation system, such as CRISPR-dCas-Tet.

[0123] In the established animal models of aging (e.g., mouse models), the number of IgG positive cells in tissues or organs (e.g., spleen, lymph, hippocampus, and lung tissue) was increased, the number of P21 positive cells in tissues was increased, the degree of fibrosis in lymph and spleen tissues was increased, the number of S100A8 positive cells was increased, the number of IL-1b positive cells in lymph was increased, and the number of IBA1 positive cells in the hippocampus was increased.

[0124] The present invention also provides a method for preparing an aging cell model or promoting cell senescence, comprising contacting cells with Ig or complement molecules.

[0125] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA.

[0126] In some of the embodiments, the complement molecule is selected from complement C3, C4, or their active forms (such as C4B) and C1q. In some embodiments, the method further includes increasing the level of Ig receptors on the cells. The level of Ig receptors can be increased by methods known in the art, for example, by a transcriptional activation system targeting a locus encoding the Ig receptor or a demethylation system targeting a locus encoding the Ig receptor. In some embodiments, the transcriptional activation system is a CRISPR-dCas transcriptional activation system. In some embodiments, the demethylation system is a CRISPR-dCas-based demethylation system, such as CRISPR-dCas-Tet.

[0127] In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV.

[0128] In some embodiments, the Ig molecule is IgG. In some embodiments, the receptor is FcγRIV.

[0129] In some embodiments, the cells are animal cells, such as non-human mammalian cells, non-human primate cells, or human cells. In some embodiments, the cells are mouse cells, such as, but not limited to, macrophages, microglia, and hepatocytes. In some embodiments, the cells are human cells, such as, but not limited to, macrophages and microglia.

[0130] IV. Methods to inhibit, delay, prevent, or treat aging The inventors also discovered that inhibiting Ig and complement can reverse the aging phenotype, thereby preventing, delaying or treating aging or aging-related diseases.

[0131] Therefore, the present invention provides a method for delaying, treating or preventing aging and age-related diseases in a subject, including reducing the level of Ig and / or complement molecules or Ig receptors in the subject, for example, the age-related diseases being chronic diseases such as arthritis, premature ovarian failure, liver fibrosis, pulmonary fibrosis, asthenia, and cardiovascular diseases.

[0132] The use of compositions that reduce the levels of Ig and / or complement molecules or Ig receptors in a subject in the preparation of a medicament for delaying, treating or preventing aging and age-related diseases in a subject in need, such as chronic diseases selected from arthritis, premature ovarian failure, liver fibrosis, pulmonary fibrosis, asthenia, and cardiovascular diseases.

[0133] In some embodiments, the aging is the aging of a tissue or organ or the aging of cells in the tissue or organ, and the method includes or the drug is used to reduce the level of Ig and / or complement molecules or the level of Ig receptors in the tissue or organ.

[0134] The organ or tissue may be from one or more of the following: the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen); the nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex); the endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads); the urinary system (e.g., kidneys, ureters, bladder, and urethra); the digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder); the musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments); the respiratory system (e.g., lungs, trachea, bronchi); and the reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissue includes, but is not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage. In some embodiments, the tissue or organ is selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0135] In some embodiments, the object is selected from non-human mammals, birds, reptiles, fish, etc., including livestock, poultry, pets, and racing animals. In some embodiments, the animal is a rodent, such as a rat, mouse, or hamster. In some embodiments, the object is a human being.

[0136] The levels of Ig and / or complement molecules or Ig receptors in a subject or its tissues, organs, or cells can be reduced using methods known in the art. For example, genes encoding Ig and / or complement or Ig receptors can be knocked out or knocked down using gene editing systems that target loci encoding Ig and / or complement or Ig receptors. These gene editing systems include, but are not limited to, a wide range of nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems. Genes encoding Ig and / or complement or Ig receptors can also be knocked down using RNAi or antisense techniques.

[0137] The levels of Ig and / or complement molecules or Ig receptors can also be reduced by a transcriptional repression system targeting loci encoding Ig and / or complement or Ig receptors, or by an augmentation system targeting loci encoding Ig or Ig receptors. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the augmentation system is a CRISPR-dCas-based augmentation system.

[0138] Ig molecule levels can also be reduced by inhibiting Ig-secreting cells or their precursors, such as plasma cells and B cells. In some embodiments, the method includes administering a B-cell inhibitor or a plasma cell inhibitor to the subject, such as an antibody against B cells or an antigen-binding fragment thereof, like rituximab and ofatumumab.

[0139] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA.

[0140] In some embodiments, the complement molecule is selected from complement C3, C4 or their active forms (such as C4B) and C1q.

[0141] In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some embodiments, the method includes administering an Ig receptor inhibitor or antagonist. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting one or more genes selected from PIGR, FCAR, FCGR1A or its variants (such as FCGR1B and FCGR1C), FCGR2A, FCGR2B, FCGR2C, FCGR3A, FCGR3B, and FCGR4.

[0142] In some embodiments, the Ig molecule is IgG. In some embodiments, the method includes reducing the level of FcγRIV protein. In some embodiments, the method includes reducing the level of FcγRIV protein by antisense technology or RNAi. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting the Fcgr4 gene, such as siRNA containing the nucleotide sequence of SEQ ID NO: 2.

[0143] In some embodiments, the Ig molecule is IgA. In some embodiments, the method includes reducing the levels of pIgR and / or FcαRI proteins. In some embodiments, the method includes reducing the levels of pIgR and / or FcαRI proteins via antisense technology or RNAi.

[0144] Ig levels can also be reduced by increasing Ig molecule consumption. The inventors discovered that intraperitoneal injection of an antisense oligonucleotide (ASO) targeting FcRn into 19-month-old aged mice resulted in a significant reduction in the number of FcRn-positive cells in the spleen, lymph nodes, hippocampus, and lungs after 40 days of treatment, accompanied by a decrease in the number of tissue IgG-positive cells. Simultaneously, aging markers, including P21, SA-β-gal, and IL-1β, were also significantly reduced in these tissues.

[0145] Therefore, in some embodiments, the Ig molecule is IgG, and the method includes reducing the level of FcRn. For example, the Fcgrt gene can be knocked out or knocked down using a gene editing system targeting the Fcgrt gene. The gene editing system includes, but is not limited to, a wide range of nucleases, ZFN, TALEN, and CRISPR / Cas systems. The expression of the Fcgrt gene can also be knocked down using RNAi or antisense techniques, such as administering an antisense oligonucleotide (ASO) targeting the Fcgrt gene to the subject, such as an ASO containing the nucleotide sequence of SEQ ID NO: 1. The level of FcRn can also be reduced using a transcriptional repression system targeting the Fcgrt gene or a system that increases methylation of the Fcgrt gene. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the system that increases methylation is a CRISPR-dCas-based system that increases methylation.

[0146] In some implementations, the method includes using an FcRn inhibitor or antagonist, such as an antibody against FcRn, including, but not limited to, Efgartigimod, Orilanolimab, Nipocalimab, Rozanolixizumab, and Batoclimab.

[0147] In some embodiments, the method includes administering agents that suppress systemic immune responses, such as cyclophosphamide and azathioprine, thereby reducing the production of immunoglobulins by suppressing the immune system.

[0148] In some embodiments, the method includes using an enzyme capable of degrading complement or an enzyme that degrades Ig (such as IgG lysin (Imlifidase)). In some embodiments, the method includes using an inhibitor of complement molecules, such as a peptide inhibitor, for example, AMY-101 (Cp40). In some embodiments, the method includes using an antibody against complement, such as Anti-C1q (ANX005).

[0149] In some embodiments, the method includes removing Ig and / or complement molecules from the plasma, such as plasma exchange therapy, such as mechanically removing, for example, IgG, IgM and IgA from the plasma, as well as complement C3, C4 or their active forms (such as C4B) and C1q, and then replenishing with fresh frozen plasma or a replacement solution.

[0150] The present invention provides a method for inhibiting, preventing or delaying cellular senescence, the method comprising reducing the level of Ig and / or complement molecules in the cellular environment or reducing the level of Ig receptors on the cells.

[0151] In some embodiments, the cells are animal cells, such as non-human mammalian cells, non-human primate cells, or human cells. In some embodiments, the cells are isolated cells. In some embodiments, the method includes reducing the levels of Ig and / or complement molecules in the culture medium.

[0152] The level of Ig receptors in cells can be reduced using methods known in the art. For example, genes encoding Ig receptors can be knocked out or knocked down using gene editing systems that target loci encoding Ig receptors. These gene editing systems include, but are not limited to, a wide range of nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems. Genes encoding Ig receptors can also be knocked down using RNAi or antisense techniques.

[0153] The level of the Ig receptor can also be reduced by a transcriptional repression system targeting a locus encoding the Ig receptor or a system that increases methylation targeting a locus encoding the Ig receptor. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the system that increases methylation is a CRISPR-dCas-based system that increases methylation.

[0154] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA. In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some embodiments, the method includes administering an Ig receptor inhibitor or antagonist. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting one or more genes selected from PIGR, FCAR, FCGR1A or its variants (such as FCGR1B and FCGR1C), FCGR2A, FCGR2B, FCGR2C, FCGR3A, FCGR3B, and FCGR4.

[0155] In some embodiments, the Ig molecule is IgG. In some embodiments, the method includes reducing the level of FcγRIV protein. In some embodiments, the method includes reducing the level of FcγRIV protein by antisense technology or RNAi. In some embodiments, the method includes administering an antisense oligonucleotide or siRNA targeting the Fcgr4 gene, such as siRNA containing the nucleotide sequence of SEQ ID NO: 2.

[0156] In some embodiments, the Ig molecule is IgA. In some embodiments, the method includes reducing the levels of pIgR and / or FcαRI proteins. In some embodiments, the method includes reducing the levels of pIgR and / or FcαRI proteins via antisense technology or RNAi.

[0157] In some embodiments, the Ig molecule is IgG, and the method includes reducing FcRn levels. For example, the Fcgrt gene can be knocked out or knocked down using a gene editing system targeting the Fcgrt gene. The gene editing system includes, but is not limited to, a wide range of nucleases, ZFN, TALEN, and CRISPR / Cas systems. Fcgrt gene expression can also be knocked down using RNAi or antisense techniques, such as administering an antisense oligonucleotide (ASO) targeting the Fcgrt gene to the subject, such as an ASO containing the nucleotide sequence of SEQ ID NO: 1. FcRn levels can also be reduced using a transcriptional repression system targeting the Fcgrt gene or a system that increases methylation of the Fcgrt gene. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the system that increases methylation is a CRISPR-dCas-based system that increases methylation.

[0158] In some implementations, the method includes using an FcRn inhibitor or antagonist, such as an antibody against FcRn, including, but not limited to, Efgartigimod, Orilanolimab, Nipocalimab, Rozanolixizumab, and Batoclimab.

[0159] In some embodiments, the method includes using an enzyme capable of degrading complement or an enzyme that degrades Ig (such as IgG lysin (Imlifidase)). In some embodiments, the method includes using an inhibitor of complement molecules, such as a peptide inhibitor, for example, AMY-101 (Cp40). In some embodiments, the method includes using an antibody against complement, such as Anti-C1q (ANX005).

[0160] V. Reagent kits for identifying aging The present invention provides a kit for identifying the degree of aging of a subject or its tissues, organs or systems or for assessing the age of a subject, comprising a detection agent for detecting the presence of Ig and / or complement molecules in a sample from said subject.

[0161] The present invention also provides the use of a detection reagent for detecting the presence of Ig and / or complement molecules in a sample from said object in the preparation of a kit for identifying the degree of aging of the object or its tissues, organs or systems or for assessing the age of the object.

[0162] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA.

[0163] In some embodiments, the complement molecule is selected from complement C3, C4 or their active forms (such as C4B) and C1q.

[0164] In some embodiments, the object is a mammal. In some embodiments, the object is a non-human mammal. For example, the object is a mouse, or the object is a non-human primate. Preferably, the object is a human.

[0165] In some embodiments, the detection agent comprises a binding molecule that binds to Ig and / or complement molecules, including but not limited to receptors for Ig molecules (such as IgG receptor FcγRIV, and IgA receptors pIgR and FcαRI) and their ligand-binding moieties, or anti-Ig and / or complement antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some of these embodiments, the detection agent comprises an extracellular domain of the Ig receptor.

[0166] In some embodiments, the antigen-binding fragments of the antibody include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments). In some embodiments, the detection reagent includes a visual label.

[0167] In some embodiments, the detection agent comprises the extracellular domain of FcγRIV.

[0168] In some embodiments, the detection agent comprises a binding molecule targeting the Ig light chain or a fragment thereof (such as a light chain constant region, such as Igkc and / or Iglc), such as an anti-Igkc antibody or an anti-Iglc antibody or an antigen-binding fragment thereof.

[0169] In some embodiments, the detection agent comprises primers and / or probes for detecting nucleotide sequences (such as mRNA) encoding Ig molecules (such as IgG, IgM, and IgA), Igkc, and / or Iglc.

[0170] The samples that can be detected using the kit of the present invention are samples from tissues, organs, or systems of the described object, such as biopsy samples of various tissues or organs. The samples may be samples from one or more tissues or organs of the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen), nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex), endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads), urinary system (e.g., kidneys, ureters, bladder, and urethra), digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder), musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments), respiratory system (e.g., lungs, trachea, bronchi), and reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissues include, but are not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage.

[0171] The samples that can be detected using the kit of the present invention can also be bodily fluid samples, such as synovial fluid, cerebrospinal fluid, urine, saliva and blood, including whole blood, plasma or serum.

[0172] In some embodiments, the sample is a sample from tissues or organs selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0173] In some embodiments, the kit of the present invention can be used to detect the number of IgG-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the kit of the present invention can be used to detect the number of IgKc-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female.

[0174] In some embodiments, the kit of the present invention can be used to detect the concentration of IgKc in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the kit of the present invention can be used to detect the concentration of IgG in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the kit of the present invention can be used to detect the concentration of IgA in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the kit of the present invention can be used to detect the concentration of IgM in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord, optionally wherein the subject is a mouse, which may be male or female.

[0175] In some embodiments, the kit of the present invention can be used to detect the number of IgG-positive cells in tissues or organs selected from the prefrontal cortex, lymph nodes, and spleen, optionally wherein the subject is a human. In some embodiments, the kit of the present invention can be used to detect IgG concentrations in tissues or organs selected from the liver and lymph nodes, optionally wherein the subject is a human.

[0176] In some embodiments, the kit of the present invention can be used to detect the presence of complement C4B in tissues or organs selected from the liver and lymph nodes, optionally, wherein the subject is a mouse.

[0177] VI. Pharmaceutical compositions that inhibit, delay, prevent, or treat aging The present invention provides a pharmaceutical composition for preventing, delaying or treating aging of a subject or its tissues or organs or for treating aging-related diseases, comprising an agent for reducing the level of Ig and / or complement molecules or Ig receptors in the subject and a pharmaceutically acceptable carrier, for example, the aging-related diseases being chronic diseases such as arthritis, premature ovarian failure, liver fibrosis, pulmonary fibrosis, asthenia, and cardiovascular diseases.

[0178] In some embodiments, the aging is the aging of a tissue or organ, and the agent is used to reduce the levels of Ig molecules and / or complement or Ig receptors in the tissue or organ.

[0179] The organ or tissue may be from one or more of the following: the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen); the nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex); the endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads); the urinary system (e.g., kidneys, ureters, bladder, and urethra); the digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder); the musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments); the respiratory system (e.g., lungs, trachea, bronchi); and the reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissue includes, but is not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage. In some embodiments, the tissue or organ is selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0180] In some embodiments, the object is selected from non-human mammals, birds, reptiles, fish, etc., including livestock, poultry, pets, and racing animals. In some embodiments, the animal is a rodent, such as a rat, mouse, or hamster. In some embodiments, the object is a human being.

[0181] In some embodiments, the agent comprises a gene-editing system that targets loci encoding Ig and / or complement or Ig receptors. The gene-editing system includes, but is not limited to, a wide range of nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems. In some embodiments, the agent comprises interfering RNA (such as shRNA, siRNA, or miRNA) or antisense oligonucleotides for knocking down genes encoding Ig and / or complement or Ig receptors.

[0182] In some embodiments, the agent comprises a transcriptional repression system targeting loci encoding Ig and / or complement or Ig receptors, or an augmenting methylation system targeting loci encoding Ig and / or complement or Ig receptors. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the augmenting methylation system is a CRISPR-dCas-based augmenting methylation system.

[0183] In some embodiments, the agent comprises a B-cell inhibitor or a plasma cell inhibitor, such as an antibody against B cells or an antigen-binding fragment thereof, like rituximab and ofamumumab.

[0184] In some embodiments, the Ig molecule is selected from IgG, IgM, and IgA.

[0185] In some embodiments, the complement molecule is selected from complement C3, C4 or their active forms (such as C4B) and C1q.

[0186] In some embodiments, the Ig receptor is selected from pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. In some embodiments, the agent comprises an Ig receptor inhibitor or antagonist. In some embodiments, the agent comprises an antisense oligonucleotide or siRNA targeting one or more genes selected from PIGR, FCAR, FCGR1A or its variants (such as FCGR1B and FCGR1C), FCGR2A, FCGR2B, FCGR2C, FCGR3A, FCGR3B, and FCGR4.

[0187] In some embodiments, the Ig molecule is IgG. In some embodiments, the agent comprises an antisense oligonucleotide or interfering RNA (such as shRNA, siRNA, or miRNA) targeting the Fcgr4 gene, such as siRNA containing the nucleotide sequence of SEQ ID NO: 2.

[0188] In some embodiments, the Ig molecule is IgG, and the agent comprises a gene editing system targeting the Fcgrt gene. The gene editing system includes, but is not limited to, a wide range of nucleases, ZFN, TALEN, and CRISPR / Cas systems. In some embodiments, the agent comprises an antisense oligonucleotide targeting the Fcgrt gene, such as an ASO containing the nucleotide sequence of SEQ ID NO: 1, or interfering RNA (such as shRNA, siRNA, or miRNA). In some embodiments, the agent comprises a transcriptional repression system targeting the Fcgrt gene or a system for increasing methylation of the Fcgrt gene. In some embodiments, the transcriptional repression system is a CRISPR-dCas transcriptional repression system. In some embodiments, the system for increasing methylation is a CRISPR-dCas-based system for increasing methylation.

[0189] In some embodiments, the agent comprises an FcRn inhibitor or antagonist, such as an antibody against FcRn, for example, but not limited to, Efgartigimod, Orilanolimab, Nipocalimab, Rozanolixizumab, and Batoclimab.

[0190] In some embodiments, the agent comprises an agent that inhibits the systemic immune response, such as cyclophosphamide and azathioprine.

[0191] In some embodiments, the agent comprises an enzyme capable of degrading complement or an enzyme that degrades Ig (such as IgG lysin (Imlifidase)). In some embodiments, the agent comprises an inhibitor of complement molecules, such as a peptide inhibitor, for example, AMY-101 (Cp40). In some embodiments, the agent comprises an antibody against complement, such as Anti-C1q (ANX005).

[0192] VII. Methods for screening compounds or drugs This invention provides a method for screening anti-aging compounds or compositions, including... i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig (such as IgG, IgM and IgA) and / or complement (such as complement C3, C4 or their active forms (such as C4B and C1q) molecules in the sample; iv) Compare the results of the detection with reference values; and Optional existence v) Sacrifice the object.

[0193] This invention also provides a method for identifying the effect of a drug on tissue aging, including... i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig (such as IgG, IgM and IgA) and / or complement (such as complement C3, C4 and C1q) molecules in the sample; iv) Compare the results of the detection with reference values; and Optional existence v) Sacrifice the object.

[0194] In some embodiments, the presence of the Ig molecule includes the expression, concentration, and / or distribution of the Ig molecule or its heavy or light chain or fragments, as well as the number, proportion, and / or distribution of Ig-positive cells. Lower expression, concentration, and / or distribution of the Ig molecule or its heavy or light chain or fragments, and lower number, proportion, and / or distribution of Ig-positive cells represent a lower degree of aging or a lower physiological age.

[0195] In some embodiments, the presence of the complement molecule includes the concentration and / or distribution of the complement molecule or fragments thereof, and the number, proportion, and / or distribution of complement-positive cells. Lower concentrations and / or distributions of complement molecules or fragments thereof, as well as lower numbers, proportions, and / or distributions of complement-positive cells, represent lower levels of aging or lower physiological age.

[0196] In some embodiments, the reference value is obtained by detecting a reference object. In this invention, the reference object refers to an object at a specific physiological age. A desired reference object can be determined by detecting representative characteristics related to physiological age (e.g., characteristics selected from brain activity, skin elasticity, reflexes, and balance). Preferably, due to individual differences, the reference value is obtained by detecting a group of reference objects.

[0197] The reference values ​​can be expressed as "mean ± standard deviation" or as a range. When testing a population to determine the reference values, the highest and lowest values ​​can be removed, for example, removing the highest 2.5% and / or the lowest 2.5%.

[0198] When the detection results (i.e., the presence of the Ig molecule, for example, the expression, concentration, and / or distribution of the Ig molecule or its heavy or light chain or fragments, and the number, proportion, and / or distribution of Ig-positive cells; and / or the presence of complement molecules, for example, the concentration and / or distribution of complement molecules or fragments, and the number, proportion, and / or distribution of complement-positive cells) are higher than the reference value, the aging degree of the subject or its tissue or organ, or the physiological age of the subject, is identified as higher than the aging degree or physiological age corresponding to the reference value; when If the detection result (i.e., the presence of the Ig molecule, for example, the expression, concentration and / or distribution of the Ig molecule or the heavy chain or light chain of the Ig molecule or fragments thereof, and the number, proportion and / or distribution of Ig-positive cells; and / or the presence of complement molecules, for example, the concentration and / or distribution of complement molecules or fragments thereof, and the number, proportion and / or distribution of complement-positive cells) is lower than the reference value, then the aging degree of the object or its cells, tissues or organs, or the physiological age of the object, is identified as being lower than the aging degree or physiological age corresponding to the reference value.

[0199] In some implementations, the reference value is obtained by detecting a reference object or a group of reference objects. When the detection result is higher than the reference value, the aging degree of the object or its tissues or organs, or the physiological age of the object, is identified as higher than the (average) aging degree of the reference object or the group of reference objects, or the (average) physiological age of the reference object or the reference group; when the detection result is lower than the reference value, the aging degree of the object or its cells, tissues or organs, or the physiological age of the object, is identified as lower than the (average) aging degree of the reference object or the group of reference objects, or the (average) physiological age of the reference object or the reference group.

[0200] In some embodiments, the reference value is a value or range representing the expression, concentration, and / or distribution of the Ig molecule or its heavy or light chain or fragments in a reference object or population, and the number, proportion, and / or distribution of Ig-positive cells. The Ig-positive cells may be B cells or plasma cells.

[0201] In some embodiments, the presence of the Ig (such as IgG, IgM, and IgA) molecules is detected by protein-binding molecules. Protein-binding molecules include any molecule capable of binding to a given protein, such as, but not limited to, receptors for Ig molecules (such as IgG receptor FcγRIV, and IgA receptors pIgR and FcαRI) and their ligand-binding moieties, or anti-Ig antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, the antigen-binding fragments of antibodies include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0202] In some implementations, the presence of nucleotide sequences (such as mRNA) encoding Ig molecules (such as IgG, IgM, and IgA), Igkc, and / or Iglc can be detected.

[0203] In some embodiments, the reference value is a value or range representing the concentration and / or distribution of the complement (such as complement C3, C4, or their active forms (such as C4B and C1q) molecules or fragments thereof in a reference object or a reference object population, and the number, proportion, and / or distribution of complement-positive cells. The complement-positive cells are...

[0204] In some embodiments, the presence of the complement molecule is detected by a protein-binding molecule. Protein-binding molecules include any molecule capable of binding to a given protein, such as, but not limited to, receptors for complement molecules (e.g., CR1, CR2, and CR3) and their ligand-binding moieties, or anti-complement antibodies, antigen-binding fragments of antibodies, and antibody derivatives. In some embodiments, the antigen-binding fragments of antibodies include, but are not limited to, Fv fragments (e.g., single-chain Fv and disulfide-bonded Fv) and Fab-like fragments (e.g., Fab fragments, Fab' fragments, and F(ab')2 fragments).

[0205] In some implementations, the presence of nucleotide sequences (e.g., mRNA) encoding complement molecules (e.g., complement C3, C4, and C1q) can be detected.

[0206] In some embodiments, the object is a mammal. In some embodiments, the object is a non-human mammal. For example, the object is a mouse, or the object is a non-human primate.

[0207] In some embodiments, the method includes detecting the concentration and / or distribution of immunoglobulin light chain constant regions (IgKC and / or IglC) in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgKC and / or IglC positive cells in a sample.

[0208] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgG in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgG-positive cells in a sample.

[0209] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgM in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgM-positive cells in a sample.

[0210] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of IgA in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of IgA-positive cells in a sample.

[0211] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C3 in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C3-positive cells in a sample.

[0212] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C4 in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C4-positive cells in a sample. For example, the active form of complement C4, C4B, can be detected.

[0213] In some embodiments, the method includes detecting the expression, concentration, and / or distribution of complement C1q in a sample. In some embodiments, the method includes detecting the number, proportion, and / or distribution of complement C1q-positive cells in a sample.

[0214] The samples that can be used in the methods of the present invention are samples from the tissues, organs, or systems of the object, such as biopsy samples of various tissues or organs. The samples may be samples from one or more tissues or organs of the circulatory system (e.g., heart, blood vessels, lymph nodes, lymphatic vessels, spleen), nervous system (e.g., spinal cord, brainstem, cerebellum, and cerebrum, such as hippocampus and prefrontal cortex), endocrine system (e.g., pituitary gland, pineal gland, thyroid gland, parathyroid gland, thymus, adrenal gland, pancreas, and gonads), urinary system (e.g., kidneys, ureters, bladder, and urethra), digestive system (e.g., esophagus, stomach, small intestine, large intestine, pancreas, liver, and gallbladder), musculoskeletal system (e.g., bones, skeletal muscles, joints, tendons, ligaments), respiratory system (e.g., lungs, trachea, bronchi), and reproductive system (e.g., reproductive tract, testes, ovaries, vas deferens, fallopian tubes, and uterus). The tissues include, but are not limited to, epithelial tissue, endothelial tissue, connective tissue, mucosa, smooth muscle, skeletal muscle, myocardium, valves, bone, and cartilage.

[0215] The samples that can be used in the methods of the present invention can also be bodily fluid samples, such as synovial fluid, cerebrospinal fluid, urine, saliva and blood, including whole blood, plasma or serum.

[0216] In some embodiments, the sample is a sample from tissues or organs selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

[0217] In some embodiments, the method includes detecting the number of IgG-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the number of IgKc-positive cells in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, and small intestine, optionally wherein the subject is a mouse, which may be male or female.

[0218] In some embodiments, the method includes detecting the concentration of IgKc in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgG in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgA in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female. In some embodiments, the method includes detecting the concentration of IgM in tissues or organs selected from the heart, lungs, hippocampus, lymph nodes, spleen, small intestine, testes, and spinal cord, optionally wherein the subject is a mouse, which may be male or female.

[0219] Example Materials and Methods Unless otherwise specified, the experimental procedures in the embodiments of this application are performed according to conventional methods in the art. The following materials and methods are intended to be illustrative and not to limit the invention.

[0220] 1) Animal use and care Wild-type C57BL / 6J mice were used in the experiments and were provided by SPF Biotechnology Co., Ltd., Beijing, China. These mice were housed in a certified SPF-grade facility with environmental conditions controlled within a temperature range of 20-25°C and humidity between 30% and 70%, using a 12-hour light-dark cycle. All experimental procedures were approved by the Institutional Animal Care and Use Committee of the Chinese Academy of Sciences.

[0221] 2) IgG treatment of young mice Six-month-old mice were treated with either IgG or the vector. IgG (Bioss, bs-0296P) was mixed in PBS and administered to mice via intraperitoneal injection (ip). Mice were injected with either IgG or the vector every ten days for a total of ten injections. In addition, young mice weighing 30 grams were injected with 10 mg of IgG each time.

[0222] 3) ASO treatment of aged mice Aged mice aged 19 months were treated with Fcgrt ASO (TAGCAACGATTTCCGTCTCA, SEQ ID NO:1) or a non-targeted control ASO. Each injection consisted of 10 nanomoles of Fcgrt ASO (Ribobio, siBDM1999A), administered every 4 days for a total of ten injections.

[0223] 4) Tissue sample collection Under anesthesia, we collected various tissues (heart, lung, liver, small intestine, testis, spleen, mesenteric lymph nodes, spinal cord, and hippocampus) from randomly selected young and old mice in each group. The extracted tissues were then immediately rinsed with 1×PBS solution containing 0.4 U / mL SUPERase In RNase inhibitor (Invitrogen, AM2694). Excess fluid was gently blotted from the tissue surface using absorbent paper. Tissue samples from the same region were then directly immersed in an OCT compound (Sakura, 4583) and placed in pre-chilled freeze molds on dry ice. RNase-free conditions were maintained throughout the process. Furthermore, consistent location and polarity of each tissue sample within the same region were ensured. Once the samples were completely frozen on dry ice, they were immediately transferred to sealed bags and stored at -80°C for subsequent slicing and spatial transcriptome sequencing.

[0224] Furthermore, to ensure consistency of tissue sections in spatial transcriptomics, we standardized the tissue sampling procedure, always using the maximum cross-sectional area of ​​each tissue. This method was strictly followed in all mice, ensuring consistency and comparability of tissue section depth and orientation in the analysis.

[0225] In mice of the same age and under the same feeding conditions, the organs described above were obtained from each group for histological staining and subsequent experimental validation. After removal, the organs were rinsed with 1×PBS solution containing an RNase inhibitor. Any remaining fluid was rapidly removed, and the tissues were then preserved in 4% PFA or liquid nitrogen. Subsequently, tissues preserved in PFA were paraffin-embedded for staining and further validation. Tissues preserved in liquid nitrogen were used for Western blotting and other required experiments.

[0226] 5) Staining of aging-associated β-galactosidase (SA-β-Gal) In short, mouse tissues (including hippocampus, spinal cord, lung, liver, small intestine, spleen, lymph nodes, and testis) were embedded in an OCT compound (Sakura, 4583), then cryosectioned to a thickness of 10 μm using a Leica CM3050S cryostat, mounted on Superfrost™ Plus microscope slides (VWR), and stored at -80°C. Cell staining methods were as described previously (Sun...). et al. , 2023, CHIT1-positive microglia drive motor neuronageing in the primate spinal cord. NatureCells were pre-seeded on plates and treated with PBS or 0.6 mg / mL IgG (Bioss, bs-0296P) for 24 hours.

[0227] Before SA-β-Gal staining, sections were thawed at room temperature for 10 minutes. Tissue sections or cells were then fixed at room temperature for 15 minutes in a solution containing 2% formaldehyde and 0.2% glutaraldehyde. Subsequently, sections or cells were rinsed three times in PBS and then stained overnight at 37°C with freshly prepared SA-β-Gal staining buffer (containing 150 mM NaCl, 2 mM MgCl2, 40 mM citrate / sodium phosphate buffer, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], and 1 mg / mL X-Gal (Amresco, 0428)). Microscopic images were captured using a digital camera attached to a microscope (Nikon), and SA-β-Gal positive areas or cells were quantified using ImageJ software (version 1.48v).

[0228] 6) Immunofluorescence staining Tissue sections collected from frozen OCT and cells cultured on coverslips (Thermo Fisher Scientific) were fixed in 4% PFA for 10–20 minutes. For paraffin-embedded samples, dewaxing, rehydration, and antigen retrieval were performed according to the previous procedure. Samples were then permeabilized with 0.4% Triton X-100 (Sigma) for 30 minutes and blocked for 1 hour at room temperature with 5% donkey serum diluted in 1×PBS (Jackson Immuno Research). Subsequently, samples were incubated overnight with primary antibody at 4°C, washed with 1×PBS, incubated with secondary antibody for 1 hour at room temperature, and then stained with Hoechst 33342 (Thermo Fisher Scientific). Images of the stained samples were acquired using a ZEISS LSM900 confocal microscope and quantified using ImageJ software (version 1.48v).

[0229] The primary antibodies used in this study included: Igkc (SouthernBiotech, 1050-08), mouse IgG (Abcam, ab46540), human IgG (proteintech, CL488-10284), F4 / 80 (Servicebio, gb-113373), F4 / 80 (Cell Signaling Technology, 70076), IBA1 (Abcam, ab5076), P21 (Abcam, ab188224), S100A8 (Abcam, ab180735), and IL1β (Santa Cruz, sc-52012). Secondary antibodies include Thermo Fisher Scientific's Alexa 568 donkey anti-mouse IgG (A10037, 1:500), 488 donkey anti-mouse IgG (A21202, 1:500), 568 donkey anti-rabbit IgG (A10042, 1:500), and 488 donkey anti-rabbit IgG (A10042, 1:500).

[0230] 7) Immunohistochemical staining First, paraffin-embedded sections were treated with xylene to remove the paraffin, followed by stepwise rehydration with a series of ethanol solutions (100%, 90%, 80%, 70%, and 50%). The sections were then briefly rinsed in distilled water. For antigen retrieval, sections were treated in a pressure cooker at 115°C for 10 minutes using sodium citrate buffer (pH 6.0). After cooling to room temperature, sections were permeabilized in PBS containing 0.4% Triton X-100 for 1 hour, followed by treatment with 3% hydrogen peroxide for 20 minutes to inhibit endogenous peroxidase activity. Blocking was performed by incubating sections in 5% donkey serum at room temperature for 1 hour. Primary antibody incubation was performed overnight at 4°C. The next day, sections were exposed to HRP-labeled secondary antibody and incubated at room temperature for 1 hour. Staining was performed using DAB for development and hematoxylin for contrast staining. Sections were then dehydrated in ascending series of ethanol (50%, 70%, 80%, 90%, 100%), cleared in xylene, and mounted with neutral resin-based media. Imaging was performed using a PerkinElmer Vectro Polaris or Leica Aperio VESA8 system, and the percentage of positively stained cells was quantified using ImageJ software.

[0231] 8) Masson staining The Solebro Marson Trichrome Staining Kit 7 was used. Briefly, paraffin sections were dewaxed, rehydrated, and then stained sequentially with iron hematoxylin working solution, phosphomolybdic acid-acid fuchsin solution, phosphomolybdic acid-phosphotungstic acid solution, and aniline blue. Slides were rinsed in distilled water and differentiated with 1% acetic acid solution. Sections were then dehydrated with ethanol, cleared with xylene, and mounted with neutral resin. Images were scanned using a PE panoramic scanner and counted using ImageJ software (version 1.48v).

[0232] 9) Western blot analysis Tissues and cells were lysed in RIPA lysis buffer (P0013B, Beyotime Biotechnology) and then heated to 105°C for 10 minutes. Total protein concentration was quantified using a BCA kit according to the manufacturer's instructions. Proteins were then separated using SDS-PAGE and transferred to a Millipore PVDF membrane. The membrane was blocked in a solution containing 5% skim milk powder (BBILife Sciences) dissolved in 1×TBST and incubated overnight at 4°C with the specified primary antibody. Subsequently, the membrane was incubated at room temperature with HRP-linked secondary antibody for 1 hour and banding was performed using a Bio-Rad ChemiDoc XRS system.

[0233] The primary antibodies used in this study included: IgKC (SouthernBiotech, 1050-08), IgG (Abcam, ab46540), anti-human IgG (Thermo Fisher Scientific, 62-8420), iNOS (Abcam, ab283655), p-P65 (Cell Signaling Technology, 3033S), STAT1 (Cell Signaling Technology, 9172S), P21 (Abcam, ab188224), FcγRIV (Cell Signaling Technology, 73741), and β-actin (Santa Cruz, sc-69879). The secondary antibody was from ZSGB-Bio.

[0234] 10) Enzyme-linked immunosorbent assay (ELISA) The levels of IL6, IFN-β, CCL2, CCL5, C4B, and C1qA in PBS- or IgG-treated primary macrophage and microglia culture media were measured using a commercial ELISA kit. Briefly, cell culture medium was added to pre-coated plates and incubated at room temperature for 1–2 hours. After incubation, the plates were washed according to the kit protocol and incubated with the detection antibody, streptavidin-HRP, substrate solution, and stop solution. The absorbance of the plates was measured at 450 nm using a Synergy H1 microplate reader (BioTek). ELISA kits for plasma assays include IL6 (Biolegend, 431307, 1:1), IFN-β (Abcam, ab252363, 1:1), CCL2 (Abcam, ab208979, 1:500), CCL5 (Abcam, ab100739, 1:30), C4B (Abbexa, abx153739, 1:1), and C1qA (Abbexa, abx254804, 1:1). Sample dilution ratios are listed after the ELISA kit catalog number.

[0235] 11) Nitrite determination The nitrite assay was performed according to the instructions in the Griess reagent system (Promega, G2930) product manual. First, 50 μL of primary macrophage or microglia culture medium was added to each well, with three replicates. Then, 50 μL of sulfonamide solution was added to all wells and incubated at room temperature in the dark for 5–10 minutes. Next, 50 μL of NED solution was added to all wells and incubated at room temperature in the dark for 5–10 minutes. Finally, the absorbance was measured using a microplate reader (BioTek) within 30 minutes, with the filter set between 520 nm and 550 nm.

[0236] 12) Isolation and culture of primary mouse macrophages C57BL / 6J mice were provided by Beijing SPF Biotechnology Co., Ltd., and housed in a 12-hour light-dark cycle environment for at least 5 days for preliminary experiments. Peritoneal macrophages (PCMs) and splenic macrophages (SPMs) were then isolated. To stimulate a large number of macrophages, 1 mL of 3% sterile thioglycolic acid was injected intraperitoneally daily for 3 days. Mice were then humanely sacrificed via cervical dislocation. 1 mL of pre-cooled PBS was injected intraperitoneally, and the abdomen was gently massaged for 3–5 minutes. Subsequently, the peritoneal cavity was carefully opened, and the peritoneal fluid was removed and centrifuged at 500 g for 5 minutes at 4°C. The supernatant was discarded, and the red precipitate was allowed to stand at room temperature for 5 minutes.

[0237] For SPM, the spleen was aseptically removed from mice using sterile techniques and placed in a culture dish containing pre-chilled PBS. Connective tissue and fat were removed. The spleen was transferred to cold DMEM / F12 (Gibco, 11330057) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS, Gibco, 15140-163) and squeezed through a 70 μm cell sieve using a sterile syringe core to obtain single cells. Cells were centrifuged at 1000 rpm for 5 minutes at 4°C, and the supernatant was discarded. To lyse erythrocytes, cells were incubated in 3 ml lysis buffer (BD) at room temperature for 5 minutes, followed by a single wash with wash buffer (PBS containing 2% fetal bovine serum, Gibco). After another round of centrifugation, cells were collected and cultured for 59 days in medium supplemented with macrophage colony-stimulating factor (M-CSF). These cells were then cultured for 5 days and exposed to either PBS or IgG (0.6 mg / ml). After 24 hours of treatment with PBS or IgG, the culture medium and cell pellet were collected.

[0238] To prepare bone marrow-derived macrophages (BMMs), mice were humanely sacrificed via cervical dislocation and then sterilized by immersion in 70% ethanol for 2 minutes. After drying the ethanol, the mouse limbs were fixed, and the femur and tibia were carefully separated, ensuring minimal contamination and avoiding premature exposure of the bone marrow. The bone was transferred to pre-cooled PBS in a laminar flow hood and washed twice with PBS containing 2% penicillin-streptomycin (Gibco, 15140-163). Residual muscle tissue was removed from the bone, but the bone was not cut. The cleaned bone was placed in PBS containing 2% penicillin-streptomycin. Both ends of the bone were cut to expose the bone marrow, and the bone marrow was flushed into a 50 ml EP tube using a 2 ml syringe until the flushing solution was clear. The bone marrow was filtered through a 70 μm filter moistened with PBS. Centrifuged at 500 g for 10 minutes at 4°C, the supernatant was discarded, and the erythrocyte pellet was retained. Erythrocyte lysis was achieved by adding 2 ml of lysis buffer and incubating at room temperature for 5 minutes, followed by neutralization with PBS. Centrifugation was repeated under the same conditions to obtain the macrophage pellet. The obtained macrophages were seeded into 24-well or 6-well plates at an appropriate cell density. The culture medium used was DMEM / F12 complete medium supplemented with 25 µg / ml M-CSF. The medium was changed every two days, and cell treatment began on day four.

[0239] 13) Isolation and culture of primary microglia To isolate microglia, mice were sprayed with 75% ethanol until they lost consciousness. The brains of the mice were then removed and placed in a culture dish containing 2% penicillin-streptomycin, while the remaining carcasses were temporarily stored in an empty dish. Using fine forceps, the dura mater and skull were carefully removed sequentially. The entire brain was then transferred to a new culture dish containing complete DMEM / F12 (Gibco, 11330057) medium. Under a microscope, the olfactory bulb was removed, and the left and right hemispheres and cerebellum were separated. The meninges of the mouse cerebral cortex were carefully dissected with fine forceps, preferably on ice. The cleaned tissue was immediately transferred to a centrifuge tube containing 5 mL of DMEM / F12 (Gibco, 11330057), 10% fetal bovine serum (FBS), and 1% penicillin-streptomycin (PS), and repeatedly ground approximately 10 times until the tissue was largely dispersed. The tissue was then filtered through a 70 μm cell filter, and the filtrate was transferred to a 25 cm agar plate pre-coated with poly-L-lysine hydrobromide (PLL) (Sigma-Aldrich, P1274-100MG). 2 The culture medium was added to the culture flask and brought to a total volume of 8 mL. On the second day of culture, the medium was replaced with complete medium containing 25 ng / ml GM-CSF (Novoprotein, CK02). On days 5-6, microglia could be observed floating in the medium. At this point, the supernatant was collected and centrifuged to obtain the microglia pellet, which was then cultured at 1x10⁻⁶ ppm. 5 Seeds were inoculated at a density of 1,000 cells per day. The culture medium was changed every two days.

[0240] 14) Isolation and culture of primary mouse hepatocytes Primary hepatocytes were isolated from 3-month-old C57BL / 6J young mice. The procedure was briefly as follows: Mice were disinfected with 75% ethanol, and the abdomen was opened with microsurgical scissors to expose the liver, portal vein, and vena cava. A catheter was then inserted into the inferior vena cava, and the liver was perfused at a flow rate of 5 ml / min with preheated perfusion buffer (containing 0.15 M NaCl; 5 mM KCl; 25 mM NaHCO3; 5 mM glucose; 20 mM Hepes; 1 mM EDTA) to flush out blood and chelate calcium. Next, digestion buffer (containing 0.15 M NaCl; 5 mM KCl; 25 mM NaHCO3; 5 mM glucose; 20 mM Hepes; 0.5 mg / mL collagenase P) was perfused into the liver. After perfusion, the liver was gently dissected and transferred to a new 10 cm culture dish in DMEM / F12 medium containing 10% FBS and 0.5% penicillin-streptomycin. The liver cysts were ruptured using fine-tipped forceps to release cells, which were then filtered through a 70 μm cell filter and centrifuged at 50 g for 5 min. Cells were purified by passing them through a 50% Percoll (Sigma) gradient at low speed (500 × g, 10 min). Trypan blue staining showed that the viability of the isolated hepatocytes was approximately 90%. Hepatocytes were counted and measured at 3 × 10⁻⁶ cells / min. 5 Hepatocytes were seeded at a density of [number] cells / mL on collagen-coated cell culture plates. Three hours after seeding, hepatocytes adhered to the surface, and the culture medium was changed to hepatocyte culture medium (DMEM / F12 containing 1×ITS (Sigma), 20 ng / mL EGF (Sigma), 20 ng / mL HGF (Novoprotein), 0.1 μM dexamethasone (Sigma), and 0.5% penicillin-streptomycin). After two days of culture, hepatocytes were treated with IgG (1.2 mg / mL) for two days.

[0241] 15) Isolation and culture of primary human macrophages At the General Hospital of the Chinese People's Liberation Army, peripheral blood mononuclear cells (PBMCs) were extracted from human blood samples using magnetic bead sorting with a STEMCELL kit (catalog number 19359) to isolate CD14+CD16- classical monocytes. The sorted cells were seeded on plates and cultured in 1640 medium supplemented with 10% fetal bovine serum (FBS), 5% penicillin-streptomycin (PS), and 50 ng / mL human-M-CSF (stemImmune, HHM-GC-0100) to differentiate into macrophages. Partial medium replacement was performed on day 3, and complete medium replacement was performed on day 6. After cells reached a stable state, they were treated with PBS or IgG (1.2 mg / mL). Twenty-four hours later, the supernatant from the cell culture medium was collected for ELISA analysis, and cells were collected for CD68 staining to assess macrophage differentiation efficiency.

[0242] 16) Isolation and culture of human microglia Human fetal brain tissue obtained from Peking University Third Hospital was mechanically homogenized and then digested with digestive fluid. The tissue mixture was sieved, resuspended in microglia culture medium (DMEM / F12 + 10% FBS + 1% PS + 1% GlutaMax), and seeded into pre-coated polylysine-coated cell culture flasks for 5 minutes to collect the microglia mixture. Next, the suspension of non-adherent cells was collected and reseeded into polylysine-coated cell culture flasks for culture on day 9. On day 9, the cell culture flasks were placed on a 120 rpm shaker for 2 hours to remove loosely attached microglia. The collected cell suspension was centrifuged, resuspended in microglia culture medium, and the microglia were counted at 1×10⁻⁶ cells / mL. 5 Cells were seeded at a density of 10 cells / mL on collagen-coated cell culture plates. After 2 days, when the cells had adhered to the surface, the culture medium was replaced with microglia culture medium containing PBS or IgG (1.2 mg / mL) for 24 hours.

[0243] 17) Aggregate staining For aggregate staining, cells on the covering slide (in a 24-well plate) were washed three times with PBS. Then, they were treated with PBS containing 0.4% Triton X-100 for 10 minutes, followed by three more washes with PBS. In the dark, they were stained with a 1:2500 diluted aggregate staining solution for 3 minutes, followed by three more washes with PBS. Destaining was then performed with 1% acetic acid for 15 minutes. Subsequently, cells were blocked with 5% donkey serum and a 1:200 diluted F4 / 80 primary antibody was added. Cells were incubated overnight at 4°C. The next day, fluorescent secondary antibody was added, and the slides were mounted for imaging under a microscope.

[0244] Example 1: Increased expression levels of immunoglobulins in multiple organs and tissues after aging. Our data show that, compared to young male mice (2 months old), the number of IgG and IgKc positive cells increased in the hippocampus, heart, lungs, small intestine, spleen, and lymph nodes of older male mice (25 months old). Figure 1 When we performed Western blot analysis on multi-organ tissue samples (including heart, lung, hippocampus, lymph nodes, spleen, small intestine, testis, and spinal cord) from young and old male mice, we found that the protein levels of IgG heavy chain (IgG-H), IgG light chain (IgG-L), IgA heavy chain (IgA-H), IgM heavy chain (IgM-H), and Igkc increased with age. Figure 2 IgJ chain levels increase with age. Figure 39 ), and an increase in classic aging markers (such as SA-βGal) Figure 3 Meanwhile, morphological and histological analyses showed increases in aging markers SPiDER-βGal, CD45, IBA1, CD31, and DCX. Figure 31 Furthermore, ELISA analysis revealed that plasma IgG, IgKc, and IL6 protein levels in aged male mice (25 months old) were significantly higher than in the younger group (2 months old). Figure 4 Meanwhile, as mice age, their tissue structure becomes disordered. Figure 36 ).

[0245] Furthermore, we found that plasma cells (CD138-positive cells, which are the main immunoglobulin-secreting cells) accumulate in the spleen and lymph nodes of mice with increasing age. Figure 5 Furthermore, complement (such as C4B) accumulates in the spleen and lymph nodes of mice with increasing age. Figure 38 In the liver, spleen, and testicular lymph nodes, cytokine-secreting cells co-localize with senescent cells. Figure 37 A); In aging tissues, aging neurons (NeuN+ cells in the hippocampus, Figure 37 B) and Leydig cells (CYP11A1+ cells in the testes), Figure 37 C) significantly increased; in the spleen and lymph nodes, plasma cells were found surrounding senescent cells. Figure 37 (D and E). Simultaneously, through immunofluorescence co-staining, we found that in the spleen and lymphoid tissues of aged mice, senescent cells (SPiDER-βGal positive cells) and IgKc positive cells were spatially close to each other, demonstrating a potential interaction. Figure 6 Furthermore, we found that in the spleen and lymphoid tissues of aged mice, macrophages (F4 / 80 positive cells) and IgG positive cells were spatially close to each other, demonstrating the potential interaction between IgG positive cells and macrophages. Figure 7 We also found that aging markers such as SPiDER-βGal positive cells, P21,4-HNE, γH2AX positive cells, and MMTV (a mouse homolog of human HERVK, an aging marker, and also a potential downstream target of IgG activation or an upstream factor activating IgG) positive cells were upregulated with age in various tissues. Furthermore, we noted the expansion of aggregates and fibrosis, as well as increased levels of inflammatory cytokines, while laminin B1 signaling decreased with age. Simultaneously, multi-timepoint histological analysis showed that aging and inflammatory biomarkers in male mouse tissues increased with age. Figure 32 and 33 We also noted that established anti-aging protective strategies, such as long-term exercise and exposure to youthful bodily fluids, reduce the accumulation of IgG and senescent cells in aging tissues. Figure 34 and 35 ).

[0246] Furthermore, we found that the number of IgG and IgKc positive cells increased with age in the spleen and lymph nodes of female mice at 4, 13, and 19 months of age. Figure 8 ).

[0247] Notably, we demonstrated that IgG levels increase with age in human lymph node and liver samples. Figure 9 Meanwhile, immunofluorescence staining showed that the number of IgG positive cells in the lymph nodes, spleen, and brain of elderly humans increased significantly with age. Figure 10 We have identified for the first time a consistent pattern of multiple immunoglobulin accumulation patterns in tissues across multiple time points, sexes, and species, representing a widespread phenomenon in mammals and potentially a new marker of human aging.

[0248] Example 2: IgG promotes aging and inflammatory microenvironment by activating macrophages. We isolated three types of macrophages (bone marrow-derived macrophages, spleen-derived macrophages, and peritoneal macrophages) and treated them with 0.6 mg / mL IgG. Figure 11 A). The results showed that IgG induced senescence in all macrophages, manifested as an increase in SA-β-gal-positive cells (A). Figure 11 B), P21 expression increased ( Figure 12 and 13 ) and aggregate formation ( Figure 14 Simultaneously, we observed a significant increase in the secretion of activated NF-κB / P65 (p-P65), STAT1, and pro-inflammatory factors IL6, IFN-β, CCL2, CCL5, C4B, and C1qA. Figure 15 and16 Furthermore, after IgG treatment, we observed increased expression of inducible nitric oxide synthase (iNOS) and increased production of nitric oxide (NO), both of which are markers of pro-inflammatory macrophages. Figure 13 and 17 ).

[0249] Knocking down the gene Fcgr4 encoding the IgG Fc receptor with siRNA (CCAAGATTCAATGGAGCA, SEQ ID NO: 2) can alleviate IgG-induced macrophage senescence. Figure 19 Specifically, the RNA of Fcgr4 in macrophages treated with siRNA ( Figure 19 A) and protein ( Figure 19 B) levels were significantly reduced; IL-6 secretion was significantly reduced in Fcgr4 knockdown macrophages after IgG treatment. Figure 19 C), and SA-β-gal and Lamin B1 levels were significantly reduced ( Figure 19 (D and E). These results support the role of cell surface IgG receptors in mediating IgG pro-aging signaling.

[0250] Similarly, we also observed that IgG treatment triggers senescence in human macrophages. Figure 18 and 20 In summary, these data suggest that macrophages enter a senescent and pro-inflammatory state when exposed to elevated levels of IgG.

[0251] Example 3: IgG promotes aging and inflammatory microenvironment by activating microglia. Next, we extended our research to microglia (a special type of macrophage in the brain) and found that genes encoding immunoglobulin receptors are also upregulated in microglia during aging. Figure 18 Similar to our observations in macrophages, IgG treatment of mouse and human microglia significantly induced the expression of aging-related biomarkers and the secretion of inflammatory factors. Figure 21 and 22 ).

[0252] Example 4: IgG treatment can induce aging in multiple tissues and organs of young mice. For IgG treatment in young mice, 6-month-old mice were divided into an IgG group and a control group. IgG (Bioss, bs-0296P) was dissolved in PBS and administered to mice via intraperitoneal injection (ip). Mice were given either IgG or the control every ten days. In addition, young mice weighing 30 grams were injected with 10 mg of IgG.

[0253] Furthermore, we examined whether elevated IgG levels in vivo were sufficient to induce aging in multiple tissues. To this end, we injected IgG into 6-month-old mice via intraperitoneal injection and subsequently examined a range of aging-related characteristics. Notably, after 100 days of IgG injection, IgG accumulation was observed in the spleen, lymph nodes, hippocampus, and lungs. Figure 23 The accumulation of these IgGs leads to a pronounced aging phenotype in these tissues, including an increase in the aging marker p21 and the accumulation of inflammatory mediators such as IL-1β and S100A8. Figure 24-25 These results confirm that excessive IgG itself can induce cellular senescence and accelerate the aging of living tissues.

[0254] Example 5: ASO-Fcgrt treatment can delay aging in aged mice. In the treatment of aged mice with ASO, 19-month-old aged mice were divided into an Fcgrt ASO group and a non-targeted control ASO group. Each treatment consisted of 10 nanomoles of Fcgrt ASO (Ribobio, siBDM1999A) solution administered intraperitoneally (ip). A total of 10 treatments were given, once every 4 days.

[0255] Tissue IgG levels are maintained through FcRn receptor-mediated recycling. It has been demonstrated that FcRn depletion can reduce tissue IgG concentrations. Based on this, we developed an antisense oligonucleotide (ASO) targeting FcRn and administered it intraperitoneally to 19-month-old aged mice. After 40 days of treatment, a significant reduction in FcRn expression was observed in the spleen, lymph nodes, hippocampus, lungs, and heart. Figure 26 ), accompanied by a decrease in IgG levels ( Figure 27 Simultaneously, aging markers were significantly reduced in these tissues, including P21, S100A8, and IL-1β. Figure 28 SA-β-gal ( Figure 29 ) and IL-1β ( Figure 30 These findings reinforce the view that IgG accumulation is a major factor in aging across multiple tissues and suggest that strategies aimed at reducing IgG levels (e.g., expression and concentration) may help mitigate systemic aging.

Claims

1. A method for identifying the degree of aging of a subject or its tissues or organs, comprising: a) Detecting the presence of immunoglobulin (Ig) molecules in samples from said object; and b) Compare the results of the test with the reference values.

2. The method of claim 1, wherein the reference value is obtained by detecting a reference object.

3. The method of claim 1 or 2, wherein the reference value is obtained by detecting a group of reference objects.

4. The method of any one of claims 1-3, wherein the presence of the Ig molecule includes the expression, concentration and / or distribution of the Ig molecule or the heavy chain or light chain of the Ig molecule or fragments thereof, and the number, proportion and / or distribution of Ig-positive cells.

5. The method of claim 4, wherein the Ig molecule is selected from IgG, IgM and IgA.

6. The method of claim 4, wherein the method comprises detecting the concentration or distribution of the immunoglobulin light chain constant region (IgKC).

7. The method of any one of claims 1-6, wherein the sample is selected from heart, lung, lymph, spleen, digestive tract, testis, spinal cord and brain samples.

8. The method of any one of claims 1-7, wherein the presence of the Ig molecule is detected by a protein-binding molecule.

9. The method of claim 8, wherein the protein-binding molecule is selected from the receptor or ligand-binding portion of an Ig molecule, such as pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), or FcγRIV, and anti-Ig antibodies or their antigen-binding portions and derivatives thereof.

10. A method for preparing an animal model of aging, comprising administering Ig molecules to the animal or increasing the level of Ig molecules in the animal.

11. The method of claim 10, wherein the Ig molecule is selected from IgG, IgM and IgA.

12. The method of claim 10 or 11, wherein the animal model is an animal model of tissue or organ aging, the method comprising locally administering the Ig molecule to the tissue or organ or increasing the level of the Ig molecule in the tissue or organ.

13. The method of claim 11, wherein the tissue or organ is selected from the heart, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

14. A method for preparing a cell model of aging, comprising contacting cells with Ig molecules.

15. The method of claim 14, wherein the Ig molecule is selected from IgG, IgM and IgA.

16. The method of claim 14 or 15, wherein the cell is an animal cell, such as a non-human mammalian cell, a non-human primate cell, or a human cell.

17. A method for treating or preventing aging or aging-related diseases in a subject of need, comprising reducing the level of Ig molecules or Ig receptors in the subject, for example, said aging-related diseases being chronic diseases such as arthritis, premature ovarian failure, liver fibrosis, pulmonary fibrosis, asthenia, and cardiovascular diseases.

18. The method of claim 17, wherein the aging is the aging of a tissue or organ, the method comprising reducing the level of Ig molecules or Ig receptors in the tissue or organ.

19. The method of claim 17 or 18, wherein the Ig molecule is selected from IgG, IgM and IgA.

20. The method of any one of claims 17-19, wherein the Ig molecule is IgG.

21. The method of any one of claims 17-20, wherein the method comprises reducing the levels of pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), FcγRIV and / or FcRn.

22. The method of claim 21, comprising reducing the levels of pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), FcγRIV and / or FcRn proteins by antisense technology or RNAi.

23. The method of claim 22, comprising applying Antisense oligonucleotides or siRNAs targeting one or more genes selected from PIGR, FCAR, FCGR1A or its variants (such as FCGR1B and FCGR1C), FCGR2A, FCGR2B, FCGR2C, FCGR3A, FCGR3B, FCGR4 and Fcgrt; B cell inhibitors or plasma cell inhibitors, such as antibodies against B cells or their antigen-binding fragments, like rituximab and ofatumumab. Enzymes capable of degrading Ig, such as IgG lysin (Imlifidase); and / or Anti-FcRn antibodies, such as Efgartigimod, Orilanolimab, Nipocalimab, Rozanolixizumab, and Batoclimab.

24. A method for screening anti-aging compounds or compositions, comprising: i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig molecules in the sample; and iv) Compare the results of the test with reference values.

25. The method of claim 24, wherein the reference value is obtained by detecting a reference object.

26. The method of claim 24 or 25, wherein the reference value is obtained by detecting a group of reference objects.

27. The method of any one of claims 24-26, wherein the presence of the Ig molecule includes the expression, concentration and / or distribution of the Ig molecule or the heavy chain or light chain of the Ig molecule or fragments thereof, and the number, proportion and / or distribution of Ig-positive cells.

28. The method of claim 27, wherein the Ig molecule is selected from IgG, IgM and IgA.

29. The method of claim 27, wherein the method comprises detecting the concentration or distribution of the immunoglobulin light chain constant region (IgKC).

30. The method of any one of claims 24-29, wherein the sample is selected from heart, lung, lymph, spleen, digestive tract, testis, spinal cord and brain samples.

31. The method of any one of claims 24-30, wherein the presence of the Ig molecule is detected by a protein-binding molecule.

32. The method of claim 31, wherein the protein-binding molecule is selected from the receptor or ligand-binding portion of an Ig molecule, such as pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), or FcγRIV, and anti-Ig antibodies or their antigen-binding portions and derivatives thereof.

33. A method for identifying the effect of a drug on tissue aging, comprising: i) Applying a compound or composition to a target; ii) Obtain a sample from the object; iii) Detect the presence of Ig molecules in the sample; and iv) Compare the results of the test with reference values.

34. The method of claim 33, wherein the reference value is obtained by detecting a reference object.

35. The method of claim 33 or 34, wherein the reference value is obtained by detecting a group of reference objects.

36. The method of any one of claims 33-35, wherein the presence of the Ig molecule includes the expression, concentration and / or distribution of the Ig molecule or the heavy chain or light chain of the Ig molecule or fragments thereof, and the number, proportion and / or distribution of Ig-positive cells.

37. The method of claim 36, wherein the Ig molecule is selected from IgG, IgM and IgA.

38. The method of claim 36, wherein the method comprises detecting the concentration or distribution of the constant regions of the immunoglobulin light chain (Igkc and / or Iglc).

39. The method of any one of claims 33-38, wherein the sample is selected from samples of the liver, lungs, lymph nodes, spleen, digestive tract, testes, spinal cord, and brain.

40. The method of any one of claims 33-39, wherein the presence of the Ig molecule is detected by a protein-binding molecule.

41. The method of claim 40, wherein the protein-binding molecule is selected from the receptor or ligand-binding portion of an Ig molecule, such as pIgR, FcαRI, FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), or FcγRIV, and an anti-Ig antibody or its antigen-binding portion and derivative thereof.

Images