Composition for protecting a tight joint

Abstract

The present invention addresses the problem of providing a novel use of EPS in lactic acid bacteria. Another problem addressed by the present invention is to provide a composition for protecting tight ligation or a composition for promoting gene expression in tight ligation constituting molecules. According to the present invention, provided is a composition for protecting tight junction, or a composition for promoting expression of the tight junction protein-1 (ZO-1) gene, the composition comprising EPS of lactic acid bacteria.

Description

Technical Field

[0001] This invention relates to compositions for protecting tight connections. Background Technology

[0002] Tight junctions are intercellular adhesion mechanisms found in epithelial cells and vascular endothelial cells. They are primarily composed of transmembrane proteins such as occldin and claudin, and zonal occludens (ZOs) which are cytoskeletal proteins. Tight junctions form a barrier by mechanically connecting cells, playing a crucial role in preventing the invasion of pathogens, toxins, and other foreign substances.

[0003] Regarding the enhancement of barrier function, Patent Document 1 describes a composition comprising a species of *Lactobacillus* that serves as a biofilm proliferator and / or an extract of that biofilm. When this composition is applied to a surface, the biofilm and / or its extract enhance the barrier function, making the surface less susceptible to microbial, viral, and / or chemical contamination. Patent Document 3 describes a skin conditioner using *Lactobacillus rhamnosus* cells or cell extracts as active ingredients, demonstrating a reduction in transepidermal water evaporation from the skin upon application of a sterile powder cream containing *Lactobacillus rhamnosus* strain KO3. Non-Patent Document 1 describes how lactic acid bacteria act on intestinal immunity, acting on intestinal epithelial cells to increase the expression of tight junctions and mucin production, thereby improving intestinal barrier function. Non-Patent Document 2 reveals that *Lactobacillus rhamnosus* OLL2838 improves intestinal barrier dysfunction. Non-patent literature 3 reveals that *Lactobacillus fermentum*, *Lactobacillus helveticus*, *Lactobacillus salivarius*, or *Lactobacillus plantarum* can improve intestinal epithelial barrier dysfunction. Patent literature 4 describes *Lactobacillus plantarum* strain LOC1, disclosing that this strain increases the expression of specific tight junction-related genes in intestinal cells.

[0004] On the other hand, the various health benefits of extracellular polysaccharides (EPS) produced by lactic acid bacteria have been confirmed. Patent Document 2 describes a composition for the prevention or reduction of the risk of secondary infections following viral infection, comprising extracellular polysaccharides from lactic acid bacteria. In this document, the prevention or reduction of the risk of secondary infections following viral infection is described as being achieved by inhibiting the expression of carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM-1). Furthermore, it is described that under experimental conditions, EPS did not affect the mRNA expression of tight junction molecules.

[0005] Existing technical documents

[0006] Patent documents

[0007] Patent Document 1: Japanese Patent Application Publication No. 2023-503350

[0008] Patent Document 2: International Publication WO2023 / 120547

[0009] Patent Document 3: Japanese Patent Application Publication No. 2022-182870

[0010] Patent Document 4: Japanese Patent Application Publication No. 2022-73988

[0011] Non-patent literature

[0012] Non-patent literature 1: Tanaka Sachi, Can food that regulates immune function prevent disease? (Immunomodulatory effects based on food components: Can food that regulates immune function prevent disease?), Chemistry and Biology 56(7), 2018, 469-474

[0013] Non-patent literature 2: E Miyauchi, H Morita, S Tanabe, Lactobacillus rhamnosusalleviates intestinal barrier dysfunction in part by increasing expression ofzonula occludens-1 and myosin light-chain kinase in vivo. J Dairy Sci. 2009Jun;92(6):2400-8. doi: 10.3168 / jds.2008-1698.

[0014] Non-patent literature 3: Ruchi Jariwala, Hemanti Mandal and Tamishraha Bagchi, Indigenous lactobacilli strains of food and human sources reverseenteropathogenic E. coli O26: H11-induced damage in intestinal epithelial celllines: effect on redistribution of tight junction proteins. Microbiology2017;163:1263-1272 Summary of the Invention

[0015] The problem the invention aims to solve

[0016] The objective of this invention is to provide novel uses for the EPS of lactic acid bacteria. Furthermore, the objective of this invention is to provide compositions for protecting tight junctions or compositions for promoting gene expression of tight junction constituent molecules.

[0017] Solution for solving the problem

[0018] That is, the present invention relates to the following.

[0019] [1] A composition for protecting tight junctions, comprising extracellular polysaccharides of lactic acid bacteria.

[0020] [2] According to the composition of [1], the protection of tight junctions is to promote the recovery of damaged tight junctions or to inhibit damage to tight junctions.

[0021] [3] The composition according to [1] or [2], wherein the tight junction is a tight junction of lung cells.

[0022] [4] The composition according to [2] or [3], wherein the damage is caused by a viral infection.

[0023] [5] The composition according to [2] or [3], wherein the damage is a reduction in the expression of the tight junction protein-1 (Zonulaoccludens-1, ZO-1) gene.

[0024] [6] The composition according to [4], wherein the virus is an influenza virus.

[0025] [7] The composition according to any one of [1] to [6], wherein the lactic acid bacteria are exopolysaccharide-producing bacteria.

[0026] [8] The composition according to any one of [1] to [7], wherein the lactic acid bacteria are selected from bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus, bacteria classified as Lactococcus lactis subsp. lactic acid, and bacteria classified as Lactococcus lactis subsp. milk fat.

[0027] [9] The composition according to any one of [1] to [8], wherein the lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

[0028]

[10] The composition according to any one of [1] to [9] is intended for consumption by any person selected from the group consisting of persons aged 65 years or older, children, infants, newborns, persons with chronic respiratory diseases and smokers.

[0029]

[11] The composition according to any one of [2] to

[10] , wherein promoting the recovery of tight junctions or inhibiting the damage of tight junctions is achieved by promoting the expression of the ZO-1 gene.

[0030]

[12] A composition for promoting ZO-1 gene expression, comprising an extracellular polysaccharide of lactic acid bacteria.

[0031]

[13] The composition according to

[12] is used to promote the expression of the ZO-1 gene in damaged tight junctions.

[0032]

[14] The composition according to

[12] or

[13] , wherein the lactic acid bacteria are exopolysaccharide-producing bacteria.

[0033]

[15] The composition according to any one of

[12] to

[14] , wherein the lactic acid bacteria is a lactic acid bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus.

[0034]

[16] The composition according to any one of

[12] to

[14] , wherein the lactic acid bacteria are selected from bacteria classified as Lactococcus lactis subsp. lactic acid and bacteria classified as Lactococcus lactis subsp. lactis.

[0035]

[17] A method for manufacturing fermented milk for protecting tight connections, comprising: adding lactic acid bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus and lactic acid bacteria classified as Streptococcus thermophilus to a modified milk liquid containing raw milk and fermenting it.

[0036]

[18] A method for manufacturing fermented milk for protecting tight connections, comprising: adding lactic acid bacteria classified as Lactococcus lactis subsp. lactic acid or Lactococcus lactis subsp. lactic acid to a modified milk liquid containing raw milk and fermenting it.

[0037]

[19] An inhaler containing extracellular polysaccharides from lactic acid bacteria.

[0038]

[20] The inhalant according to

[19] , wherein the lactic acid bacteria are exopolysaccharide-producing bacteria.

[0039]

[21] In the inhaler according to

[19] or

[20] , wherein the lactic acid bacteria are selected from bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus, bacteria classified as Lactococcus lactis subsp. lactic acid, and bacteria classified as Lactococcus lactis subsp. milk fat.

[0040]

[22] The inhaler according to any one of

[19] to

[21] , wherein the lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

[0041]

[23] An extracellular polysaccharide of lactic acid bacteria or a composition comprising an extracellular polysaccharide of lactic acid bacteria for use in a method of protecting tight junctions. Use of the extracellular polysaccharide of lactic acid bacteria in the preparation of a composition for protecting tight junctions for therapeutic or non-therapeutic purposes. A method or non-therapeutic method for protecting tight junctions comprising the step of administering a composition comprising an extracellular polysaccharide of lactic acid bacteria or an extracellular polysaccharide of lactic acid bacteria to a subject. The use or non-therapeutic application of a composition comprising an extracellular polysaccharide of lactic acid bacteria for protecting tight junctions.

[0042]

[24] An extracellular polysaccharide of lactic acid bacteria or a composition comprising an extracellular polysaccharide of lactic acid bacteria, used in a method for promoting the recovery of damaged tight junctions or for inhibiting tight junction damage. Use of the extracellular polysaccharide of lactic acid bacteria in the preparation of a composition for promoting the recovery of damaged tight junctions or for inhibiting tight junction damage. A method for promoting the recovery of damaged tight junctions, or a method or non-therapeutic method for inhibiting tight junction damage, comprising the step of administering a composition comprising an extracellular polysaccharide of lactic acid bacteria or an extracellular polysaccharide of lactic acid bacteria to a subject. Use of a composition comprising an extracellular polysaccharide of lactic acid bacteria, or the use or non-therapeutic use of an extracellular polysaccharide of lactic acid bacteria, for promoting the recovery of damaged tight junctions or for inhibiting tight junction damage.

[0043]

[25] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of lactic acid bacteria according to

[23] or

[24] , wherein the tight junction is the tight junction of lung cells.

[0044]

[26] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic use of the lactic acid bacteria as described in

[24] or

[25] , wherein the damage is caused by viral infection.

[0045]

[27] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of lactic acid bacteria as described in

[24] or

[25] , wherein the damage is a reduction in ZO-1 gene expression.

[0046]

[28] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to

[26] , wherein the virus is an influenza virus.

[0047]

[29] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to any one of

[23] to

[28] , wherein the lactic acid bacteria is an extracellular polysaccharide-producing bacterium.

[0048]

[30] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to any one of

[23] to

[29] , wherein the lactic acid bacteria are selected from bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus, bacteria classified as Lactococcus lactis subsp. lactic acid, and bacteria classified as Lactococcus lactis subsp. milk fat.

[0049]

[31] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to any one of

[23] to

[30] , wherein the lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

[0050]

[32] The extracellular polysaccharide, composition, application, or non-therapeutic application of the lactic acid bacteria according to any one of

[23] to

[31] , for consumption by any of the following groups: persons aged 65 years or older, children, infants, newborns, persons with chronic respiratory diseases, and smokers. The method or non-therapeutic method according to any one of

[23] to

[31] , wherein the subject is any of the following groups: persons aged 65 years or older, children, infants, newborns, persons with chronic respiratory diseases, and smokers.

[0051]

[33] The extracellular polysaccharide, composition, application, method or non-therapeutic method or application or non-therapeutic application of any of the lactic acid bacteria according to any one of

[24] to

[32] , wherein promoting the restoration of tight junctions or inhibiting the damage of tight junctions is achieved by promoting ZO-1 expression.

[0052]

[34] An extracellular polysaccharide of lactic acid bacteria or a composition comprising an extracellular polysaccharide of lactic acid bacteria for use in a method of promoting ZO-1 gene expression. Use of the extracellular polysaccharide of lactic acid bacteria in the preparation of a composition for promoting ZO-1 gene expression for therapeutic or non-therapeutic purposes. A method or non-therapeutic method for promoting ZO-1 gene expression comprising the step of administering to a subject a composition containing an extracellular polysaccharide of lactic acid bacteria or an extracellular polysaccharide of lactic acid bacteria. An application or non-therapeutic use of a composition comprising an extracellular polysaccharide of lactic acid bacteria for promoting ZO-1 gene expression.

[0053]

[35] An extracellular polysaccharide of lactic acid bacteria or a composition comprising an extracellular polysaccharide of lactic acid bacteria, used in a method for promoting ZO-1 gene expression in damaged tight junctions. Use of the extracellular polysaccharide of lactic acid bacteria in the preparation of a composition for promoting ZO-1 gene expression in damaged tight junctions. A method or non-therapeutic method for promoting ZO-1 gene expression in damaged tight junctions, comprising the step of administering to a subject a composition comprising an extracellular polysaccharide of lactic acid bacteria or an extracellular polysaccharide of lactic acid bacteria. Use or non-therapeutic application of a composition comprising an extracellular polysaccharide of lactic acid bacteria for promoting ZO-1 gene expression in damaged tight junctions.

[0054]

[36] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to

[34] or

[35] , wherein the lactic acid bacteria are extracellular polysaccharide-producing bacteria.

[0055]

[37] The extracellular polysaccharide, composition, application, method or non-therapeutic method, or application or non-therapeutic application of the lactic acid bacteria according to any one of

[34] to

[36] , wherein the lactic acid bacteria is a lactic acid bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus.

[0056]

[38] The composition according to any one of

[23] to

[29] and

[32] to

[37] , wherein the lactic acid bacteria are selected from bacteria classified as Lactococcus lactis subsp. lactic acid and bacteria classified as Lactococcus lactis subsp. lactis.

[0057] The effects of the invention

[0058] According to the present invention, tight connections can be protected. Attached Figure Description

[0059] Figure 1The changes in intracellular viral counts based on each treatment are shown. non-IFV: Influenza virus (IFV) non-infection group; IFV: IFV infection + EPS non-addition group; IFV + EPS: IFV infection + EPS addition group; IFV + BXA: IFV infection + BXA (baloxavir acid) addition group. *p<0.05, **p<0.01.

[0060] Figure 2 The relative expression levels of the ZO-1 gene are shown based on each treatment. *p<0.05.

[0061] Figure 3 The results of the FITC-glucan permeability test based on each treatment are shown. *p<0.05. Detailed Implementation

[0062] This invention relates to compositions comprising extracellular polysaccharides (EPS) of lactic acid bacteria. More specifically, it relates to compositions for protecting tight junctions, using EPS of lactic acid bacteria as the active ingredient.

[0063] [Active Ingredients]

[0064] The composition of this invention contains EPS (extracellular polymeric substances) of lactic acid bacteria as an active ingredient. Lactic acid bacteria are a general term for microorganisms that assimilate glucose to produce lactic acid with a sugar yield of 50% or more. Physiologically, they are Gram-positive cocci or bacilli, characterized by non-motility, and in most cases, lack of spore-forming ability (although some lactic acid bacteria, such as Bacillus coagulans, do possess spore-forming ability), and catalase negativity. Lactic acid bacteria have been consumed worldwide since ancient times through fermentation of milk and other methods, and can be considered highly safe microorganisms. Lactic acid bacteria are classified into several genera. The EPS of lactic acid bacteria included in the composition of this invention is preferably produced by lactic acid bacteria classified as Leuconostoc, Lactococcus, or Lactobacillus.

[0065] It should be noted that "containing...as an active ingredient" means: in the composition, it is used in an effective amount to achieve the target function; or it is used as an ingredient identified through labeling as contributing to achieving the purpose. In functionally labeled foods, the active ingredient is sometimes referred to as a functionally related ingredient (meaning an ingredient that contributes to a specific health purpose (excluding purposes related to reducing the risk of disease)).

[0066] The EPS used in the compositions of the present invention is not particularly limited as long as it achieves the desired effect. EPS produced by lactic acid bacteria are structurally classified as EPS as homopolysaccharides and EPS as heteropolysaccharides (e.g., EPS composed of galactose and glucose), and are sometimes modified by phosphorylation, sulfation, etc., all of which can be used as active ingredients in the compositions of the present invention. One preferred example of EPS is EPS comprising at least one of neutral polysaccharides and acidic polysaccharides with phosphate groups added to the neutral polysaccharides. Such EPS is known to be produced by *Lactobacillus delbrueckii* subsp. bulgaricus, *Lactococcus lactis* subsp. lactis, and *Lactococcus lactis* subsp. cremoris. The EPS used in the present invention can be one type or a combination of two or more types.

[0067] Particularly preferred examples of EPS-producing lactic acid bacteria (exopolysaccharide-producing bacteria) used in the compositions of the present invention are Lactobacillus, Lactococcus, etc.

[0068] (Lactobacillus)

[0069] Examples of lactic acid bacteria belonging to the genus *Lactobacillus* include *Lactobacillus bulgaricus*, *Lactobacillus casei*, *Lactobacillus acidophilus*, and *Lactobacillus plantarum*. It should be noted that in this specification, "lactobacters belonging to the genus *Lactobacillus*" refers to those found in the paper "A taxonomic note on the genus *Lactobacillus*: Description of 23 novel genera, emended description of the genus *Lactobacillus* Beijerinck 1901," published on April 15, 2020, in the *INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY*, Volume 70, Issue 4.The 25 newly established genera of lactic acid bacteria, re-edited and published in the journal "and union of Lactobacillaceae and Leuconostocaceae", are: *Lactobacillus*, *Paralactobacillus*, *Holzapfelia*, *Amylolactobacillus*, *Bombilactobacillus*, *Companilactobacillus*, *Lapidilactobacillus*, *Agrilactobacillus*, and *Schleiferilactobacillus*. *Lactobacillus* genus, *Loigolactobacilus* genus, *Lactaseibacillus* genus, *Latilactobacillus* genus, *Dellaglioa* genus, *Liquorilactobacillus* genus, *Ligilactobacillus* genus, *Lactiplantibacillus* genus, *Furfurilactobacillus* genus, *Paucilactobacillus* genus, *Limosilactobacillus* Lactic acid bacteria belonging to any of the genera *Fructilactobacillus*, *Acetilactobacillus*, *Apilactobacillus*, *Levilactobacillus*, *Secundilactobacillus*, and *Lentilactobacillus*. Among these *Lactobacillus* species, in this invention, lactic acid bacteria classified as *Lactobacillus bulgaricus* (also known as *Lactobacillus bulgaricus*) are preferred. Furthermore, among *Lactobacillus* species, lactic acid bacteria classified as *Lactobacillus delbrueckii* subsp. *bulgaricus* are even more preferred. That is, one particularly preferred example of EPS used in the compositions of this invention is EPS of lactic acid bacteria classified as *Lactobacillus delbrueckii* subsp. *bulgaricus*.

[0070] (Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1)

[0071] In a particularly preferred embodiment, the lactic acid bacteria is *Lactobacillus delbrueckii* subsp. *bulgaricus* OLL1073R-1 (accession number: FERM BP-10741) (sometimes referred to as "*Lactobacillus bulgaricus R-1* strain). That is, one particularly preferred example of the EPS used in the compositions of the present invention is EPS of *Lactobacillus bulgaricus* strain R-1.

[0072] Lactobacillus bulgaricus R-1 strain was internationally deposited at the International Patent Biological Collection Center (IPOD, NITE) of the National Institute of Advanced Industrial Science and Technology (Room 120, 2-5-8 Kazusa-Kamazu, Kisarazu City, Chiba Prefecture, Japan, based on the Budapest Treaty (Depositor: Meiji Co., Ltd., Deposit Date: November 29, 2006, Deposit Number: FERM BP-10741).

[0073] A strain that is taxonomically equivalent to a certain strain (hereinafter referred to as strain S) refers to any of the following species.

[0074] • A strain belonging to the same genus as strain S, preferably a strain belonging to the same species as strain S, whose 16S rRNA gene sequence, or a characteristic portion thereof (V1 region, V2 region, or all or part of V1 region and V2 region, or including part of V1 region and V2 region, etc.), has a sequence identity of 90% or more, preferably 95% or more, more preferably 98% or more, further preferably 98.5% or more, further preferably higher than 98.7%, further preferably 99% or more, further preferably 100% with the sequence of strain S;

[0075] • It belongs to the same genus as strain S, preferably to the same species as strain S, and has the same bacteriological properties as strain S.

[0076] It should be noted that, for the criteria for judging species similarities and differences based on 16S rRNA gene sequences, those skilled in the art can refer to Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today 2006; 33: 152-155.

[0077] The sequence of the V1–V3 region of the 16S rRNA gene of OLL1073R-1 (corresponding to the base sequence from position 34 to position 535 in the full-length sequence of the 16S rRNA gene) is shown in sequence number 1 of the sequence listing.

[0078] 16S rRNA gene. Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (Sequence No. 1)

[0079] GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0080] The following shows the bacteriological properties of OLL1073R-1.

[0081] (1) Morphological characteristics

[0082] Cell shape: Bacillus

[0083] Mobility: None

[0084] Presence or absence of spores: None

[0085] Gram staining: positive

[0086] (2) Growth status on the culture medium

[0087] The strain was spread on BL agar plates (Rongyan Chemical) and cultured at 37°C for 48 hours using the steel wool method, resulting in opaque, rough-textured colonies.

[0088] (3) Physiological characteristics

[0089] Nitrate reduction: negative

[0090] Indole formation: negative

[0091] Gelatin liquefaction: negative

[0092] Catalase: Negative

[0093] Adaptability to oxygen: facultative anaerobic

[0094] Glucose is converted to D(-) lactic acid via homolactic fermentation, without producing gas. In BL liquid medium, growth is negative at 10°C and positive at 45°C.

[0095] Arginine degradation: negative

[0096] Gas produced by malic acid: Negative

[0097] The decomposability of various carbohydrates (positive, negative)

[0098] Arabic sugar -

[0099] Xylose -

[0100] Rhamnose -

[0101] Ribose -

[0102] glucose+

[0103] Mannose+

[0104] Fructose+

[0105] Galactose-

[0106] sucrose-

[0107] maltose-

[0108] Cellobiose -

[0109] Lactose+

[0110] Trehalose -

[0111] Melibiose -

[0112] Raffinose -

[0113] Ginsenosides -

[0114] dextrin-

[0115] starch-

[0116] Glycogen -

[0117] Inulin -

[0118] Mannitol -

[0119] Sorbitol -

[0120] Inositol-

[0121] Aescin-

[0122] Salicylic acid -

[0123] (4) Nature of EPS production

[0124] This strain has the property of producing EPS and is characterized by producing polysaccharides containing galactose and glucose and phosphorus outside the cell.

[0125] (EPS)

[0126] In addition to this strain, the following lactic acid bacteria are also known to exist as lactobacilli that produce polysaccharides containing galactose and glucose as components outside the cell.

[0127] Lactobacillus plantarum C88 (Non-Patent Literature 4); Lactobacillus johnsonii strain 151 (Non-Patent Literature 5); Lactobacillus delbrueckii subsp. bulgaricus NCFB2074 (Non-Patent Literature 6); Lactobacillus casei CG11 (Non-Patent Literature 7); Lactobacillus rhamnosus E / N (Non-Patent Literature 8); Lactobacillus fermentum TDS030603 (Non-Patent Literature 9); Lactobacillus gasseri FR4 (Non-Patent Literature 10).

[0128] Therefore, it is believed that EPS produced by lactic acid bacteria of the family Lactobacillus that produce polysaccharides containing galactose and glucose as components of sugars extracellularly, preferably by lactic acid bacteria of the family Lactobacillus that produce polysaccharides containing galactose and glucose as components of sugars extracellularly and containing phosphorus, will have the effect of the present invention. Lactobacilli are classified into several genera, including *Lactobacillus*, *Parasitella*, *Holzapufil*, *Lactobacillus amyloliquefaciens*, *Lactobacillus bee*, *Lactobacillus concomitantus*, *Lactobacillus stearothermica*, *Lactobacillus agrostis*, *Lactobacillus schleifera*, *Lactobacillus putrefactiveus*, *Lactobacillus casei*, *Lactobacillus extensively*, *Lactobacillus delagliobolus*, *Lactobacillus liquidus*, *Lactobacillus assemblica*, *Lactobacillus lactis*, *Lactobacillus furfur*, *Lactobacillus oligophaga*, *Lactobacillus myxobolus*, *Lactobacillus fruitii*, *Lactobacillus acetobolus*, *Lactobacillus beesii*, *Lactobacillus thuringiensis*, *Lactobacillus hypoplasia*, *Lactobacillus sulphureus*, *Lactobacillus fructobacillus*, *Leuconostoc*, *Oenococcus*, and *Weissella*.

[0129] (Lactococcus spp. lactic acid bacteria)

[0130] Examples of lactic acid bacteria in the genus *Lactococcus* include *Lactococcus lactis*, *Lactococcus plantarum*, and *Lactococcus raffinosus*. Among these *Lactococcus* species, in this invention, lactic acid bacteria classified as *Lactococcus lactis* are preferred. Furthermore, among *Lactococcus* species, lactic acid bacteria classified as *Lactococcus lactis subsp. lactis* or *Lactococcus lactis subsp. cremoris* are more preferred. That is, one particularly preferred example of EPS used in the compositions of this invention is EPS of lactic acid bacteria classified as *Lactococcus lactis subsp. lactis* or *Lactococcus lactis subsp. cremoris*.

[0131] It is known that EPS produced by *Lactococcus* species also contains galactose and glucose. For example, the repeating units of EPS produced by *Lactococcus lactis* NIZOB40 consist of glucose, galactose, rhamnose, and phosphate in a ratio of 2:2:1:1 (Non-Patent Literature 11, Non-Patent Literature 12). Furthermore, *Lactococcus lactis* subsp. *milk fat* FC (which can be isolated from "Fijiko Caspi Hai Yogurt (registered trademark)") produces phosphoproteosaccharides containing rhamnose, galactose, and glucose in a molar ratio of 1:1:3 (Non-Patent Literature 13). *Lactococcus lactis* subsp. *lactate* YZ1 produces polysaccharides containing mannose, galactose, and glucose (Non-Patent Literature 14). Therefore, it is believed that EPS produced by *Lactococcus* species also contains galactose and glucose, thus achieving the effects of the present invention.

[0132] (Components of EPS, such as sugar)

[0133] In one embodiment, the EPS of the lactic acid bacteria included in the composition of the present invention may comprise an acidic extracellular polysaccharide having a repeating structure formed by linking repeating units as shown in formula (I).

[0134]

[0135] In formula (I),

[0136] n is 0 or 1;

[0137] α-D-Galp represents pyranose-type α-D-galactose residues;

[0138] β-D-Galp represents β-D-galactose residues of the pyranose type;

[0139] β-D-Galf represents a furanose-type β-D-galactose residue;

[0140] Gro3P represents glycerol-3-phosphate group;

[0141] (1-2), (1-3), (1-5) and (1-6) represent the 1-2 bond (i.e., the carbon-2 bond), 1-3 bond, 1-5 bond and 1-6 bond between residues, respectively.

[0142] In one embodiment, in the acidic extracellular polysaccharide, in the repeating structure formed by linking repeating units as shown in formula (I), it is preferred that each repeating unit has an average of about one (e.g., one (n=1) or zero relative to each repeating unit, and about one per repeating unit on a weighted average basis for the acidic EPS as a whole) glycerol-3-phosphate group, but is not limited thereto.

[0143] The EPS of lactic acid bacteria included in the compositions of the present invention may be contained in the form of lactic acid bacteria fermentation products. In addition to the lactic acid bacteria fermentation products themselves, the fermentation products also include their processed products. The lactic acid bacteria fermentation products themselves include, for example, fermented milk (specifically, yogurt, etc.). Processed products include, for example, crude purified products, culture filtrates obtained by sterilizing the fermentation products through filtration, centrifugation, or membrane separation, culture supernatants, concentrates obtained by concentrating the culture filtrate / culture supernatant, and dried concentrates. In one embodiment, the compositions of the present invention do not contain bacterial cells.

[0144] The preparation method of EPS from lactic acid bacteria can utilize existing technology. For more detailed conditions, please refer to the examples in this specification. Furthermore, in the case of preparing EPS from lactic acid bacteria in the form of lactic acid bacteria fermentation product, the EPS-producing lactic acid bacteria are added to the raw milk as a starter culture, allowing fermentation to produce EPS in the fermentation product, thereby preparing fermented milk containing EPS. The fermentation conditions, such as the raw milk, fermentation temperature, and fermentation time, are not particularly limited as long as the lactic acid bacteria used can produce EPS, and those skilled in the art can set them appropriately.

[0145] [use]

[0146] (Function)

[0147] In one embodiment, the composition is a composition for protecting tight junctions. Tight junctions, as referred to, are intercellular junctions that connect adjacent cells (particularly epithelial cells and endothelial cells) to each other, located at the apical side. By utilizing tight junctions to physically connect cells to form a barrier, the invasion of foreign substances such as pathogens and toxins can be prevented. The protected tight junctions can be tight junctions of any cells (particularly epithelial cells or endothelial cells), preferably tight junctions of lung cells, and more preferably tight junctions of alveolar epithelial cells. Tight junctions contain various constituent molecules. Examples of tight junction constituent molecules include ocludin, claudin, and zonal occludens (ZO).

[0148] The composition can also be used to assist tight connection protection, to aid tight connection protection, to regulate tight connection protection, to maintain tight connection protection, to regulate the function of tight connections, and to maintain the function of tight connections. Additionally, the composition can be used to mitigate the reduction of tight connection protection, to reduce the risk of reduced tight connection protection, to mitigate the reduction of tight connection function, and to reduce the risk of reduced tight connection function.

[0149] Tight junction protection includes: promoting the recovery of damaged tight junctions, inhibiting tight junction damage, maintaining tight junctions, inhibiting tight junction disruption, inhibiting tight junction permeability hyperactivity, strengthening tight junctions, and reducing the risk of tight junction impairment. Tight junction damage may include, for example, a decrease in gene expression of tight junction constituent molecules in cells and an increase in tight junction permeability. The decrease in gene expression of tight junction constituent molecules and the increase in tight junction permeability can be determined, for example, by comparison with healthy cells, cells obtained from healthy subjects, cells without external factors such as viral infection, and cells obtained from subjects without external factors such as viral infection.

[0150] Protecting tight junctions also includes regulating or assisting in regulating one or more of the following: promoting the recovery of damaged tight junctions, inhibiting damage to tight junctions, maintaining tight junctions, inhibiting the occurrence of tight junction breakdown, inhibiting tight junction permeability hyperactivity, strengthening tight junctions, and reducing the risk of tight junction disorders.

[0151] Promoting the recovery of damaged tight junctions can be achieved, for example, by increasing the gene expression of genes that constitute tight junction molecules that have been reduced in cells. This includes maintaining tight junctions, inhibiting tight junction breakdown, and inhibiting increased tight junction permeability, for example, by reducing tight junction permeability and inhibiting increased permeability of damaged tight junctions. Tight junction permeability can be evaluated, for example, by the FITC-glucan (4kDa) permeability assay described in Example 2. Inhibiting tight junction damage can be achieved, for example, by inhibiting the reduction in gene expression of tight junction molecules in cells; reducing tight junction permeability during the FITC-glucan (4kDa) permeability assay described in Example 2; and inhibiting increased permeability of damaged tight junctions. Strengthening of tight junctions includes, for example, enhancing the function of tight junctions (e.g., barrier function, function of inhibiting foreign invasion) by increasing gene expression of tight junction constituent molecules; promoting tight junction formation; reducing tight junction permeability during the FITC-glucan (4kDa) permeability test described in Example 2; and inhibiting the over-permeability of damaged tight junctions. That is, protecting tight junctions can promote the recovery of damaged tight junctions, inhibit damage to tight junctions, and strengthen tight junctions by influencing their structure and function. In one embodiment, promoting the recovery of tight junctions, inhibiting damage to tight junctions, or strengthening tight junctions involves promoting the recovery of ZO-1 gene expression or inhibiting the reduction of ZO-1 gene expression. Furthermore, the compositions of the present invention are, in one embodiment, compositions for promoting ZO-1 gene expression or compositions for reducing tight junction permeability; in a preferred embodiment, compositions for promoting ZO-1 gene expression in damaged tight junctions or compositions for reducing the permeability of damaged tight junctions.

[0152] The compositions of the present invention can also be used to assist, aid, improve, or maintain one or more of the following: ZO-1 gene expression promotion and tight junction permeability reduction. Additionally, the compositions can also be used to mitigate one or more of the following: ZO-1 gene expression reduction and tight junction permeability hyperpermeability, or to reduce the risk of one or more of them.

[0153] Damage to tight junctions can occur due to various external factors such as infection by fungi, bacteria, viruses, smoking, ultraviolet radiation, and particulate matter, as well as internal factors such as oxidative stress and the effects of cytokines. The composition can protect tight junctions from damage caused by all these factors. That is, the composition can promote the recovery of tight junctions damaged by all causes and inhibit damage to tight junctions caused by all causes, such as the reduction in gene expression of tight junction constituent molecules. In a preferred embodiment, the damage is caused by viral infection. The virus can be any virus that may damage tight junctions, preferably influenza virus, more preferably influenza A virus (A / H1N1).

[0154] The degree of cell infection can be represented, for example, by the multiplicity of infection (MOI). MOI represents the ratio of infectious material to the infected object, such as the ratio of viral particles in a well to cultured cells. For example, when 10 million viruses are added to 1 million cells, the MOI is 10, representing the probability that one cell is infected with 10 viral particles. In this embodiment, MOI can be calculated using the following formula.

[0155] MOI = Number of virus particles / Number of cells

[0156] For example, in cases where damage to tight junctions is caused by influenza virus infection, the MOI can be below 10, or below 9, 8, 7, 6, 5, 4, 3, or 2, or above 1.

[0157] Those skilled in the art can appropriately evaluate whether a component has a protective effect on tight junctions in cells. For example, when treating epithelial cells for damage to tight junctions due to viral infection, an evaluation can be made by adding the target component and analyzing the expression of tight junction constituent molecules. The expression analysis of tight junction constituent molecules can be performed by quantifying the expression of genes of tight junction constituent molecules through mRNA analysis, or by analyzing the expression level of constituent molecules in the form of protein levels.

[0158] (object)

[0159] The compositions of the present invention are suitable for ingestion or administration to any person desiring protection of lung tightness. There are no particular limitations on such persons (preferably humans), as long as they are persons who desire or require the effect of protecting lung tightness (including healthy persons and patients). Examples of such persons include those with weakened lungs and bronchi, persons over 65 years of age, young children (1-6 years old), infants (less than 1 year old), newborns (less than 28 days after birth), persons suffering from chronic respiratory diseases (e.g., chronic obstructive pulmonary disease, bronchial asthma, pulmonary fibrosis, interstitial pneumonia, etc.), persons infected with influenza viruses, and smokers.

[0160] [Composition]

[0161] (Food compositions, pharmaceutical compositions)

[0162] The compositions of this invention can be food compositions or pharmaceutical compositions. Except as specifically described, food and pharmaceuticals include not only food and pharmaceuticals for human use, but also food and pharmaceuticals for use in animals other than humans.

[0163] Food, except where specifically stated otherwise, includes general food, functional food, nutritional compositions, and includes therapeutic food (dietary preparations for therapeutic purposes; meals prepared according to menus created by nutritionists based on prescriptions written by doctors), dietary therapy food, ingredient-adjusted food, care food, therapeutic adjunct food, and precision nutrition (personalized nutrition, appropriate diets (nutrition) tailored to an individual's constitution). Except where specifically stated otherwise, food includes not only solids but also liquids, such as beverages, health drinks, liquids, and soups. Functional food refers to food that imparts a prescribed function to an organism, including, for example, foods for specific health purposes (including conditionally specified foods for specific health purposes), functionally labeled foods, health foods including nutritional functional foods, foods for special purposes, nutritional supplements, health supplements, dietary supplements, food supplements, medical foods (as defined by the U.S. Food and Drug Administration (FDA)), supplements (e.g., foods in various dosage forms such as tablets, coated tablets, sugar-coated tablets, capsules, liquids, etc.), beauty foods (e.g., weight-loss foods), and all other health foods. Furthermore, in this invention, "functional food" includes health foods with health claims conforming to applicable Codex Alimentarius Commission (FAO / WHO) food standards. Food supplements refer to substances that supplement a normal diet, either alone or in combination, by concentrating nutrients or other substances with nutritional or physiological effects; these substances are described as food supplements in the product label. Dietary supplements refer to products (excluding tobacco) intended to supplement a diet, containing one or more target ingredients, and are described as dietary supplements in the product label.

[0164] Except where specifically stated otherwise, medicines include medicines for medical use, medicines requiring guidance, medicines for general use, and medicines for quasi-medical use that comply with the laws relating to the assurance of the quality, effectiveness, and safety of medicines, medical devices, etc.

[0165] (Provide assistance, etc.)

[0166] The compositions of the present invention can be administered orally or non-orally, for example, by inhalation, via a tube (gastric fistula, intestinal fistula), or via the nose, with oral administration being preferred.

[0167] In one approach, the composition is preferably used before or immediately after damage to tight junctions. This is because, for example, in cases where the damage is caused by an infection (e.g., a viral infection), it is believed that the protective effect of EPS on tight junctions is more readily obtained by ingesting or administering the composition before damage to tight junctions is caused by viral replication over time. In cases where the risk of tight junction damage is high (e.g., infection with fungi, bacteria, viruses, etc., chronic respiratory diseases, smoking, exposure to dust, chemicals, gases, or environmental pollutants, etc.) or where tight junction damage is suspected (e.g., suspected infection with fungi, bacteria, viruses, etc., or chronic respiratory diseases), immediate ingestion or administration of the composition can be expected to yield a greater effect.

[0168] (Content / Dosage of Active Ingredient)

[0169] The EPS content of the lactic acid bacteria in the composition of the present invention only needs to be the amount required to achieve the target effect. Various factors such as the age, weight, symptoms, metabolic / excretory function, and concurrent medications of the test subject can be taken into consideration to appropriately set the dosage or intake of the composition. For example, the daily EPS amount of lactic acid bacteria can be set to 0.1 mg or more, preferably 0.6 mg or more, more preferably 1 mg or more, and particularly preferably 3 mg or more. While the lower limit is arbitrary, the upper limit of the daily EPS amount can be set to 500 mg or less, preferably 300 mg or less, and particularly preferably 250 mg or less.

[0170] The EPS (experimental excipients) of each lactic acid bacteria administration or each meal, i.e., each single dose, can be set to 0.03 mg or more, preferably 0.2 mg or more, and more preferably 1 mg or more. While the lower limit is arbitrary, the upper limit of the EPS per single dose can be set to 200 mg or less, preferably 100 mg or less, more preferably 70 mg or less, and particularly preferably 30 mg or less.

[0171] When the EPS of the lactic acid bacteria in the composition of the present invention is used as a fermented milk composition, the daily amount of the composition can be set to 30g or more, preferably 50g or more, more preferably 60g or more, and particularly preferably 100g or more. While the lower limit is arbitrary, the upper limit of the daily amount of fermented milk can be set to 1500g or less, preferably 1200g or less, more preferably 900g or less, and even more preferably 600g or less.

[0172] The amount of the composition at one time can be set to 10g or more, preferably 20g or more, and more preferably 30g or more. While the lower limit is arbitrary, the upper limit of the amount of the composition at one time can be set to 500g or less, preferably 400g or less, more preferably 200g or less, and particularly preferably 125g or less.

[0173] The composition can be administered / taken once daily or multiple times daily, such as three times a day with meals. The composition uses EPS (extracellular enzymes) of a long-established lactic acid bacteria as its active ingredient. Therefore, the active ingredient in the composition of the present invention is EPS with a long dietary history, making it suitable for long-term consumption. Thus, it can be consumed repeatedly or over a long period, for example, continuously administered / taken for more than 3 days, preferably more than 1 week, more preferably more than 4 weeks, and particularly preferably more than 1 month.

[0174] (Other ingredients, additives)

[0175] The compositions of the present invention may also contain other active ingredients and nutrients acceptable as food or pharmaceuticals. Examples of such ingredients include amino acids (e.g., lysine, arginine, glycine, alanine, glutamic acid, leucine, isoleucine, valine), carbohydrates (glucose, sucrose, fructose, maltose, trehalose, erythritol, maltitol, palaginose, xylitol, dextrin), electrolytes (e.g., sodium, potassium, calcium, magnesium), vitamins (e.g., vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, biotin, folic acid, pantothenic acid, and niacin), minerals (e.g., copper, zinc, iron, cobalt, manganese), antibiotics, dietary fiber, proteins, lipids, etc.

[0176] In addition, the composition may further comprise additives acceptable as food or pharmaceutical additives. Examples of such additives include inactive carriers (solid or liquid carriers), excipients, surfactants, binders, disintegrants, lubricants, solubilizers, suspending agents, coating agents, colorants, preservatives, buffers, pH adjusters, isotonic agents, emulsifiers, stabilizers, sweeteners, antioxidants, flavorings, acidulants, and natural substances. More specifically, it includes water, other aqueous solvents, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium alginate, water-soluble dextran, water-soluble dextrin, sodium carboxymethyl starch, pectin, xanthan gum, gum arabic, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sodium chloride, propylene glycol, glycerin, benzalkonium chloride, methylparaben, lactose, starch, maltose, sorbitol, lactose, sucralose, steviol glycosides, aspartame, acesulfame potassium, citric acid, lactic acid, malic acid, tartaric acid, phosphoric acid, acetic acid, fruit juice, vegetable juice, etc.

[0177] (Dosage form / form)

[0178] The food compositions of the present invention can be prepared in any form, such as solid, liquid, mixture, suspension, powder, granules, paste, jelly, gel, capsule, etc. Furthermore, the food compositions of the present invention can be prepared in any form, such as dairy products, supplements, snacks, beverages, health drinks, seasonings, processed foods, side dishes, soups, etc. More specifically, the compositions of the present invention can be prepared in the form of fermented milk, lactic acid bacteria beverages, milk beverages, dairy drinks, soft drinks, ice cream, tablets, cheese, bread, biscuits, crackers, pizza, formula milk powder, liquid foods, patient foods, nutritional foods, frozen foods, processed foods, etc. Additionally, they can be prepared in the form of granules, powders, pastes, concentrates, etc., for mixing into beverages and foods for ingestion. Fermented milk refers to fermented milk and lactic acid bacteria beverages as defined in the "Ministry Ordinance Concerning Standards for the Composition of Milk and Dairy Products" (hereinafter referred to as the "Milk Ordinance"). Fermented milk, as defined in the Milk Classification Code, refers to fermented milk or milk containing an equal or greater amount of non-fat milk solids, produced by fermenting it with lactic acid bacteria or yeast to form a paste or liquid state, or by freezing it.

[0179] One preferred embodiment of the food composition is fermented milk obtained by fermenting raw milk using lactic acid bacteria that produce EPS as a starter culture. The fermented milk may contain microorganisms such as yeast in addition to the target lactic acid bacteria. In a preferred embodiment, the fermented milk contains one or more types of lactic acid bacteria, and may or may not contain other microorganisms, such as yeast. The raw milk includes animal-derived milk and its processed products, such as cow's milk, skim milk, skim milk powder, skim milk concentrate, milk filter concentrate or permeate, condensed milk, whey, milk protein concentrate (MPC), whey protein concentrate (WPC), buttermilk, and fresh cream. Additionally, the raw milk may include plant-based milk, such as soy milk, almond milk, oat milk, coconut milk, and rice milk, or may not.

[0180] In one embodiment, the pharmaceutical composition of the present invention is an inhaler. By using the pharmaceutical composition of the present invention as an inhaler, an effect on the tight junctions of lung cells can be expected. The form of the inhaler may be, for example, a dry powder suitable for dry powder metered-dose inhalation (DPI) or the like, or a liquid suitable for pressurized metered-dose inhalation spray (pMDI), soft mist metered-dose inhalation (SMI), nebulizers, etc., and is not particularly limited as long as it can be administered to the lungs or respiratory tract.

[0181] Inhalants can be prepared using various methods known to those skilled in the art. When the inhalant is in liquid form, its preparation method may include, for example, dissolving the active ingredient and other components such as excipients, isotonic agents, and preservatives in a suitable solvent such as purified water, water for injection, or sterile purified water. Alternatively, when the inhalant is in dry powder form, its preparation method may include, for example, freeze-drying a liquid mixture containing the active ingredient and other components such as excipients using a spray freeze-drying method.

[0182] In addition to the active ingredient of this invention, the inhaler may also contain one or more pharmacologically active ingredients. Alternatively, the inhaler may be a kit formulation containing the active ingredient of this invention and one or more pharmacologically active ingredients other than the active ingredient of this invention. Examples of pharmacologically active ingredients other than the active ingredient of this invention include bronchodilators such as salmeterol, indacaterol, tiotropium, and glycopyrronium, and antiviral agents such as zanamivir and laninamivir, but are not limited to these.

[0183] The pharmaceutical compositions of the present invention can also be formulated into any dosage form suitable for oral administration, such as tablets, granules, powders, pills, capsules, etc., liquid preparations, suspensions, syrups, gels, aerosols, etc.

[0184] (other)

[0185] In the manufacture of the compositions of the present invention, the stage of compounding the EPS of lactic acid bacteria can be appropriately selected. There are no particular limitations on the compounding stage as long as it does not significantly impair the characteristics of the EPS of the lactic acid bacteria. For example, a culture containing EPS obtained by culturing lactic acid bacteria that produce EPS, its crude purified product, and its purified product can be mixed with the raw materials for compounding. Alternatively, when the compositions of the present invention are implemented as fermented milk, a culture containing EPS, its crude purified product, and its purified product can be mixed with the raw materials and the fermented milk after fermentation, or lactic acid bacteria that produce EPS can be added as a starter culture to the raw milk to ferment and produce EPS, thereby producing fermented milk containing EPS.

[0186] The compositions of the present invention may be labeled with their intended use (purpose) and may be labeled with the content recommended for a particular subject.

[0187] In the composition of this invention, it is possible to indicate content that can be used for tight connection protection, etc., and it is possible to indicate content recommended for specific individuals (including notifications for diet management applications, nutrition management applications, health applications, etc.). It should be noted that periods such as "temporary" or "long-term" can also be appropriately indicated at the beginning of each statement. The indication can be done directly or indirectly. Examples of direct indication are descriptions of tangible objects such as the product itself, packaging, containers, labels, hang tags, etc. Examples of indirect indication include advertising / promotional activities based on location or means, such as websites, stores, brochures, exhibitions, media seminars and other seminars, books, newspapers, magazines, television, radio, mail, emails, sales pitches, and voice messages.

[0188] This invention provides a method for protecting tight junctions (particularly pulmonary tight junctions), comprising the steps of administering an extracellular polysaccharide of lactic acid bacteria or a composition containing the extracellular polysaccharide. Such a method may include, after the administration of the active ingredient, a step of detecting the strength of pulmonary tight junctions in a subject. This detection includes confirmation of physical condition, medical history taking, vital capacity measurement, chest X-ray examination, and a medical history / questionnaire of lifestyle habits (smoking habits, allergy history, history of respiratory diseases, etc.). The detection can be performed by the subject themselves or by someone other than the subject.

[0189] [Methods for manufacturing fermented milk]

[0190] In one embodiment, the present invention provides a method for manufacturing fermented milk for protecting tightly bound milk, comprising: adding lactic acid bacteria classified as *Lactobacillus delbrueckii* subsp. *bulgaricus* and lactic acid bacteria classified as *Streptococcus thermophilus* to a formulated milk liquid containing raw milk and allowing it to ferment. It should be noted that *Streptococcus thermophilus* is used to manufacture yogurt conforming to Codex standards.

[0191] In another embodiment, the present invention provides a method for manufacturing fermented milk for protecting tightly bound milk, comprising: inoculating (1%) lactic acid bacteria classified as Lactococcus lactis subsp. lactis or Lactococcus lactis subsp. lactis into a modified milk liquid containing raw milk, and fermenting it at its optimal temperature (around 25°C to 30°C).

[0192] Raw milk is milk used as a raw material in processing. It can be fresh milk, or a mixture of skim milk powder, cream, water, etc., with fresh milk. In addition to these, raw milk may also contain sterilized milk, whole milk, skim milk, whole milk concentrate, skim milk concentrate, whole milk powder, buttermilk, salted butter, unsalted butter, whey, whey powder, whey protein concentrate (WPC), whey protein isolate (WPI), α-La (α-lactalbumin), β-Lg (β-lactoglobulin), lactose, etc. Furthermore, raw milk may appropriately contain preheated gelatin, agar, thickeners, gelling agents, stabilizers, emulsifiers, sucrose, sweeteners, flavorings, vitamins, minerals, etc.

[0193] In these manufacturing methods, fermented milk is obtained by adding specific lactic acid bacteria as a starter culture to a formulated milk liquid containing the aforementioned raw milk and allowing it to ferment. As starter cultures, lactic acid bacteria classified as *Lactobacillus delbrueckii* subsp. bulgaricus, lactic acid bacteria classified as *Lactococcus lactis* subsp. lactic acid, lactic acid bacteria classified as *Lactococcus lactis* subsp. milk fat, and lactic acid bacteria classified as *Streptococcus thermophilus* can be used. The lactic acid bacteria classified as *Lactobacillus delbrueckii* subsp. bulgaricus are not limited to specific strains and can be various lactic acid bacteria, with *Lactobacillus bulgaricus* strain R-1 being preferred. The lactic acid bacteria classified as *Streptococcus thermophilus* are not limited to specific strains and can be, for example, *Streptococcus thermophilus* 1131. *Streptococcus thermophilus* 1131 can be isolated from Meiji Bulgarian-style yogurt LB81 (Meiji Co., Ltd.) and is available from commercially available products. Lactic acid bacteria classified as *Lactococcus lactis* subsp. *lactocarcinoma* are not limited to specific strains and can be various types of lactic acid bacteria, preferably *Lactococcus lactis* subsp. *lactocarcinoma* strains JCM5805 and JCM20101. *Lactococcus lactis* subsp. *lactocarcinoma* strains JCM5805 and JCM20101 can be distributed from the RIKEN Bioresource Center. Lactic acid bacteria classified as *Lactococcus lactis* subsp. *lactocarcinoma* subsp. *lactocarcinoma* are not limited to specific strains and can be various types of strains, preferably *Lactococcus lactis* subsp. *lactocarcinoma* subsp. *lactocarcinoma* strain FC. *Lactococcus lactis* subsp. *lactocarcinoma* strain FC can be isolated from "Fujicco Caspita Yogurt" (registered trademark) manufactured and sold by Fujicco Co., Ltd., and can be obtained from commercially available products. The amount of lactic acid bacteria added can be in accordance with the amount added in the known manufacturing methods of fermented milk, for example, it can be set to 0.1 to 5% by weight, 0.5 to 4% by weight or 1 to 3% by weight relative to the modified milk liquid.

[0194] Fermentation can be carried out in accordance with methods known to those skilled in the art. For example, the modified emulsion containing lactic acid bacteria can be placed at 30°C to 50°C, preferably 33°C to 47°C, more preferably 35°C to 44°C for 1 hour to 30 hours, preferably 2 hours to 24 hours, more preferably 3 hours to 12 hours.

[0195] In addition to the above, the method for manufacturing fermented milk may further include: removing foreign matter using a filter; sterilizing by heating at 75–95°C for 5–15 minutes; and stirring.

[0196] Example

[0197] The present invention will be further illustrated below with examples, but the present invention is not limited to these examples.

[0198] <Example 1>

[0199] [Materials and methods]

[0200] (Cells, Viruses, EPS)

[0201] A549 cells (human alveolar basal epithelial adenocarcinoma cells) were purchased from the RIKEN Center for Biological Resources Cell Bank (Tsukuba, Japan). Cells were cultured in DMEM containing 10% FBS, 100 U / ml penicillin, 100 μg / ml streptomycin (Sigma, MO, USA), and MEM non-essential amino acids (Thermo Fisher Scientific, MA, USA) at 5% CO2 and 37°C. Influenza virus A / Puerto Rico / 8 / 34 (H1N1) was obtained from the University of Tokyo.

[0202] EPS produced by *Lactobacillus delbrueckii* subsp. bulgaricus OLL1073R-1 was purified from cultures of *Lactobacillus delbrueckii* subsp. bulgaricus OLL1073R-1 cultured in 10% (w / w) skim milk powder medium. Specifically, trichloroacetic acid was added to the culture cultured at 37°C for 18 hours to achieve a final concentration of 10% (w / w), denatured proteins were removed, cold ethanol was added, and the mixture was allowed to stand at 4°C for 2 hours to obtain a precipitate containing EPS. The precipitate was dialyzed against MilliQ water using a dialysis membrane (molecular weight cutoff 6,000-8,000), and after enzymatic digestion of nucleic acids and proteins, it was precipitated again with ethanol to obtain a precipitate. This precipitate was dissolved in MilliQ water, dialyzed again, and then freeze-dried to purify the EPS. The EPS was then dissolved in autoclaved distilled water. The EPS solution was filtered through a 0.22 μm syringe filter, and the filtered solution was frozen at -80°C until use.

[0203] (Influenza virus infection of A549 cells)

[0204] Twelve hours before viral infection, A549 cells were injected at a dose of 1×10⁻⁶. 5 A549 cells / 200 μl / well were cultured in 96-well plates. After 12 hours of culture, the culture medium for A549 cells was replaced with fresh medium, and EPS was added to each well at a concentration of 400 μg / ml. Simultaneously, the A549 cells were cultured at an MOI of 1 (1 × 10⁻⁶ cells / well). 5 Infected with influenza virus for 1 hour using pfu (per well).

[0205] The cells were washed three times with DMEM and then cultured in EPS-free DMEM at 37°C and 5% CO2 for 12 hours. RNA was then extracted from each A549 cell.

[0206] In some experiments, 250 nM baloxavir (BXA) (Shionogi, Osaka, Japan) was added to the wells as a positive control to inhibit viral replication. After incubation for 12 hours, RNA was extracted from each infected A549 cell.

[0207] (RNA purification and quantitative RT-PCR)

[0208] Using Power SYBR (registered trademark) Green Cell-to-CT TM The kit was used to purify RNA from infected A549 cells and synthesize cDNA, following the kit's instructions (Thermo Fisher Scientific).

[0209] Quantification of influenza virus in virus-infected cells was performed using quantitative RT-PCR with primers targeting the M gene region of influenza virus (5'-GGCAAATGGTACAGGCAATG-3' (Sequence No.: 4) and 5'-AGCAACGAGAGGATCACTTG-3' (Sequence No.: 5)) (Non-Patent Literature 15). The quantification was based on a 50% tissue culture infection dose (TCID). 50 cDNA made from influenza virus RNA with determined viral titer obtained by the method was used as the standard DNA for quantitative RT-PCR.

[0210] The primers used for quantitative RT-PCR of ZO-1 (tight junction gene) in A549 cells used in this study are shown in Table 1 below.

[0211] [Table 1]

[0212]

[0213] Quantitative RT-PCR was performed using LightCycler 480 probe premix and a LightCycler 480 device with its accompanying software (Roche Diagnostics, Mannheim, Germany). In some experiments, each sample was corrected using an internal control (β-actin) level and normalized to the mean of the control samples.

[0214] [result]

[0215] When A549 cells were infected with influenza virus and cultured for 12 hours, the expression of the ZO-1 gene, which is one of the main molecules constituting tight junctions, decreased significantly with increasing viral load.

[0216] When EPS was added during viral infection, the intracellular viral count was significantly reduced compared to when it was not added. Figure 1Significant restoration of ZO-1 gene expression was confirmed. Figure 2 ).

[0217] [Inspection]

[0218] Thus, when A549 cells (human alveolar basal epithelial adenocarcinoma cells) are infected with a virus, the expression of the ZO-1 gene is reduced. On the other hand, when EPS produced by *Lactobacillus delbrueckii* subsp. bulgaricus OLL1073 R-1 is added during viral infection, the restoration of ZO-1 gene expression is confirmed. Therefore, the EPS of lactic acid bacteria can be used as an active ingredient in compositions that protect tight junctions, such as those promoting the restoration of tight junctions, and can also be used as an active ingredient in compositions that promote the expression of tight junction constituent molecules, represented by ZO-1. Furthermore, such compositions are suitable for consumption by individuals whose lung cell (or alveolar epithelial cell) barrier is considered relatively weak (including those with subjective symptoms), such as individuals selected from groups consisting of those over 65 years of age, young children, infants, newborns, those with chronic respiratory diseases, and smokers.

[0219] <Example 2>

[0220] [Materials and methods]

[0221] The cells, viruses, and EPS used were the same substances as in Example 1.

[0222] (Influenza virus infection of A549 cells)

[0223] Twelve hours before viral infection, A549 cells were injected at a dose of 1×10⁻⁶. 5 A549 cells / 200 μl / well were cultured in 96-well plates. After 12 hours of culture, the culture medium for A549 cells was replaced with fresh medium, and EPS was added to each well at a concentration of 400 μg / ml. Simultaneously, the A549 cells were cultured at an MOI of 1 (1 × 10⁻⁶ cells / well). 5 Infected with influenza virus for 1 hour using pfu (per well).

[0224] (FITC-dextran permeability test using the Transwell system)

[0225] The cells were washed three times with DMEM and incubated for 12 hours in EPS-free DMEM at 5% CO2 and 37°C. After 12 hours of incubation, 50 μg of FITC-glucan (4 kDa) (Chondrex, WA, USA) was added to each apical chamber, and the cells were incubated for another 3 hours. After mixing the culture medium from the outer basal chamber, 50 μl of the medium was sampled three times from the outer basal chamber and transferred to black microplates (PerkinElmer, MA, USA). The fluorescence intensity was measured using a microplate reader with an excitation wavelength of 490 nm and an emission wavelength of 520 nm (TECAN, Switzerland, Menedov).

[0226] [result]

[0227] like Figure 3 As shown, the increased permeability of tight junctions caused by influenza virus infection tends to decrease in infected cells with added EPS during influenza virus infection.

[0228] [Inspection]

[0229] Thus, when A549 cells (human alveolar basal epithelial adenocarcinoma cells) were infected with a virus, tight junction permeability was increased. On the other hand, when EPS produced by *Lactobacillus delbrueckii* subsp. bulgaricus OLL1073 R-1 was added during viral infection, inhibition of increased tight junction permeability was confirmed. These results suggest that the EPS of lactic acid bacteria reduces tight junction permeability and inhibits the increased tight junction permeability caused by tight junction disruption, making it suitable for treatments aimed at maintaining the barrier function of epithelial cells such as alveolar epithelial cells. Therefore, the EPS of lactic acid bacteria can be used as an effective ingredient in compositions that protect tight junctions by inhibiting tight junction disruption, promoting tight junction recovery, and inhibiting increased tight junction permeability. Furthermore, such compositions are suitable for individuals whose lung cell (preferably alveolar epithelial cell) barrier is relatively weak (including those with subjective symptoms), such as those selected from groups consisting of individuals over 65 years of age, young children, infants, newborns, those with chronic respiratory diseases, and smokers.

[0230] [Manufacturing of Fermented Dairy Products (Plain Yogurt) 1]

[0231] A yogurt base mixture is prepared by mixing milk, dairy products (derived from milk), and water to a final product composition of 9.5% non-fat milk solids and 3.0% milk fat. The prepared yogurt base mixture is then homogenized, sterilized at 95°C for 5 minutes, and then cooled to approximately 40°C. The sterilized yogurt base mixture is then fermented with *Lactobacillus delbrueckii subsp. bulgaricus* OLL1073R-1 (a polysaccharide-producing bacterium) and a lactic acid bacteria strain belonging to *Streptococcus thermophilus*, or by adding a strain of *Lactococcus lactis subsp. cremoris* and a lactic acid bacteria strain belonging to *Streptococcus thermophilus* as starter cultures, and fermenting at 40–50°C to produce fermented milk. The resulting fermented milk can be used to protect tight junctions. It should be noted that Streptococcus thermophilus was formulated as a starter culture to meet Codex standards and to promote fermentation.

[0232] [The Manufacturing of Fermented Dairy Products (Plain Yogurt) 2]

[0233] Milk, dairy products (derived from milk), and water are mixed to prepare a yogurt base mixture with a final product composition of 9.5% non-fat milk solids and 3.0% milk fat. The prepared yogurt base mixture is then homogenized, sterilized at 95°C for 5 minutes, and then cooled to approximately 20–30°C. A strain of *Lactococcus lactis* subsp. *milk fat* or a strain of *Lactococcus lactis* subsp. *lactolaccos* is added as a starter culture to the sterilized yogurt base mixture, and fermentation is carried out at 20–30°C to produce fermented milk. The resulting fermented milk can be used to protect tight junctions.

[0234] [Manufacturing of inhaled medications (liquid inhalers) 1]

[0235] EPS obtained by purification using the method described in Example 1 is dissolved in purified water at concentrations of 0.1% by mass, 0.3% by mass, and 0.5% by mass to manufacture an inhalation liquid. The manufactured inhalant is primarily intended for use in aerosol formulations.

[0236] [Manufacturing of Inhalants (Liquid Inhalers) 2]

[0237] EPS was purified using the method described in Example 1. EPS, sodium chloride, and benzalkonium chloride were dissolved in purified water at concentrations of 0.3%, 0.9%, and 0.01% by mass, respectively, to prepare an inhalation liquid. The prepared inhalant is primarily intended for use in aerosol formulations.

[0238] [Manufacturing of inhaled powder (inhalation powder) 3]

[0239] EPS was purified using the method described in Example 1. EPS and lactose hydrate were dissolved in purified water at concentrations of 0.3% by mass and 10% by mass, respectively. The resulting solution was sprayed into liquid nitrogen to instantly freeze the droplets. The solvent was then sublimated using a freeze dryer to obtain powder particles, thereby enabling the manufacture of inhalation powder. The manufactured inhalant is primarily suitable for use in dry powder formulations.

[0240] Industrial availability

[0241] According to the present invention, a food composition and a method for manufacturing a food that are useful for protecting tight bonds can be provided. Furthermore, according to the present invention, a food composition and a method for manufacturing a food that support the maintenance / improvement of human health can be provided. The present invention can support the maintenance / improvement of human health. Moreover, according to the present invention, nutritional improvements can be achieved for various population groups, ensuring healthy living and promoting well-being.

[0242] (References cited in the instruction manual)

[0243] Non-patent literature 4: Zhang, L., Liu, C., Li, D., Zhao, Y., Zhang, X., Zeng,X., Yang, Z., Li, S., 2013. Antioxidant activity on exopolysaccharideisolated from Lactobacillus plantarum C88. Int. J. Biol. Macromol. 54, 270-275.

[0244] Table 5:Gorska-Froczek, S., Sandstrom, C., Kenne, L., Paociak,M., Brzozowska, E., Strus, M., Heczko, P., Gamian, A., 2013. The structureand immunoreactivity of exopolysaccharide isolated from Lactobacillusjohnsonii strain 151. Carbohydr. Res. 378 , 148–153 .

[0245] Table 6:Harding, LP, Marshall, VM, Hernandez, Y., Gu, Y.,Maqsood, M., Mclay, N., Laws, AP, NCFB2074. Carbohydr. Res. 340, 1107–1111.

[0246] Material 7:JCMC Cerning, CMGC Renard, JF Thibault,C. Bouillanne, M. Landon, M. Desmazeaud & L. Topisirovic: Carbon SourceRequirements for Exopolysaccharide Production by Lactobacillus casei CG11 andPartial Structure Analysis of the Polymer Appl. Approx. Microbiol., 60, 3914(1994).

[0247] Non - Patent Document 8: M. Polak - Berecka, A. Wasko, D. Szwajgier & A. Choma: Bifidogenic and antioxidant activity of exopolysaccharides produced by Lactobacillus rhamnosus E / N cultivated on different carbon sources. Pol. J. Microbiol., 62, 181 (2013).

[0248] Non - Patent Document 9: K. Fukuda, T. Shi, K. Nagami, F. Leo, T. Nakamura, K. Yasuda, A. Senda, H. Motoshima & T. Urashima: Effects of carbohydrate source on physicochemical properties of the exopolysaccharide produced by Lactobacillus fermentum TDS030603 in a chemically defined medium. Carbohydr. Polym., 79, 1040 (2010).

[0249] Non - Patent Document 10; Rizwana Parveen Rani Marimuthu Anandharaj Abraham David Ravindran: Characterization of a novel exopolysaccharide produced by Lactobacillus gasseri FR4 and demonstration of its in vitro biological properties. International Journal of Biological Macromolecules Volume 109, 1 April 2018, Pages 772 - 783.

[0250] Non-patent literature 11: Van Casteren WHM, Dijkema C, Schols HA, Beldman G, Voragen AG J. Characterization and modification of the exopolysaccharideproduced by Lactococcus lactis subsp. cremoris B40. Carbohydr Polym. 1998;37:123-130.

[0251] Non-patent literature 12: Van Kranenburg R, Marugg JD, Van Swam II, Willem J, DeVos W M. Molecular characterization of the plasmid-encoded eps gene clusteressential for exopolysaccharide biosynthesis in Lactococcus lactis. MolMicrobiol. 1997;24:387-397.

[0252] Non-Patent Literature 13: Goto, Yayoi: Research on Lactococcus lactis subsp. cremoris FC, a lactic acid bacterium that produces polysaccharides in vitro 2021.11.19 https: / / doi.org / 10.24729 / 00017528

[0253] Non-patent literature 14: Y. Zakaria et al., A Polysaccharide Produced byLactococcus lactis subsp. lactis YZ1 Isolated from Traditional IndonesianFermented Milk, "Dadih". Milk Science Vol. 47, No.1 1998

[0254] Non-patent literature 15: Moradi MT, Karimi A, Fotouhi F, Kheiri S, Torabi A. Invitro and in vivo effects of Peganum harmala L. seeds extract against influenza A virus. Avicenna J Phytomed, 2017; 7 (6): 519-530.

[0255] [The sequence recorded in the sequence list]

[0256] Sequence number 1 16S rRNA gene. Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1

[0257] Sequence No. 2 ZO-1 RT-PCR forward primer

[0258] Sequence No. 3 ZO-1 RT-PCR Reverse Primer

[0259] Serial number 4 Influenza virus M gene region RT-PCR forward primer

[0260] Serial number 5 Influenza virus M gene region RT-PCR reverse primer

Claims

1. A composition for protecting tight junctions, comprising an extracellular polysaccharide of lactic acid bacteria, wherein the tight junctions are tight junctions of lung cells.

2. The composition according to claim 1, wherein, Protecting tight junctions involves promoting the recovery of damaged tight junctions or inhibiting further damage to tight junctions.

3. The composition according to claim 2, wherein, The injury was caused by a viral infection.

4. The composition according to claim 2, wherein, Damage is a reduction in the expression of the tight junction protein-1, or ZO-1 gene.

5. The composition according to claim 3, wherein, The virus is an influenza virus.

6. The composition according to claim 1, wherein, Lactic acid bacteria are bacteria that produce extracellular polysaccharides.

7. The composition according to claim 1, wherein, Lactic acid bacteria are selected from bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus, Lactococcus lactis subsp. lactic acid, and Lactococcus lactis subsp. milk fat.

8. The composition according to claim 1, wherein, The lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

9. The composition according to claim 1, for consumption by any person selected from the group consisting of persons aged 65 years or older, young children, infants, newborns, persons with chronic respiratory diseases, and smokers.

10. The composition according to claim 2, wherein, Promoting the restoration of tight junctions or inhibiting the damage to tight junctions is achieved by promoting the expression of the ZO-1 gene.

11. A composition for promoting ZO-1 gene expression, comprising an extracellular polysaccharide of lactic acid bacteria.

12. The composition of claim 11, used to promote the expression of the ZO-1 gene in damaged tight junctions.

13. The composition according to claim 11, wherein, Lactic acid bacteria are bacteria that produce extracellular polysaccharides.

14. The composition according to claim 11, wherein, Lactic acid bacteria are classified as Lactobacillus delbrueckii subsp. bulgaricus.

15. The composition according to claim 11, wherein, Lactic acid bacteria are selected from bacteria classified as Lactococcus lactis subsp. lactis and bacteria classified as Lactococcus lactis subsp. milk fat.

16. A method for manufacturing fermented milk for protecting tightly bound milk, comprising: Lactic acid bacteria classified as Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus thermophilus subsp. bulgaricus are added to a formulated milk liquid containing raw milk and then fermented.

17. An inhaler comprising an extracellular polysaccharide of lactic acid bacteria.

Images