Microrhin MccY mutant resistant to thermolysin and application of microrhin MccY mutant

Abstract

The invention belongs to the technical field of biological detection, and discloses an anti-thermolysin microrhin MccY mutant and application thereof.The anti-thermolysin microrhin MccY mutant is obtained by mutating the 11th amino acid of MccY from S into H, N or G and / or mutating the 16th amino acid of MccY from Q into A, the MccY mutant provided by the invention can keep structural and functional integrity for a long time under harsh protease challenge, and solves the core problem of insufficient stability of natural peptides.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to the microbesin MccY mutant against thermophilic proteases and its applications. Background Technology

[0002] With the booming development of intensive animal husbandry globally, foodborne gastrointestinal infections caused by Enterobacteriaceae pathogens such as Escherichia coli and Salmonella have become a major challenge restricting the development of animal husbandry and threatening public health. The long-term overuse and subtherapeutic use of antibiotics have directly led to the emergence of multidrug-resistant (MDR) and even extensively drug-resistant (XDR) strains, resulting in a gradual decline in the clinical efficacy of traditional antibiotics. Therefore, developing antibiotic alternatives with novel mechanisms of action that are less likely to induce resistance has become an urgent priority.

[0003] Lasso peptides are a class of natural antimicrobial peptides synthesized by ribosomes and modified through complex post-translational processes. Their unique "lasso"-like topology (composed of an N-terminal cyclic ring and a C-terminal tail passing through the ring, stabilized by disulfide bonds) endows them with excellent physicochemical stability, including significant resistance to heat, acid, and protease hydrolysis. Microcin Y (MccY), a class I lasso peptide encoded by the *Escherichia coli* AY25 plasmid, exhibits potent antibacterial activity at the nanomolar (nM) level against various Enterobacteriaceae pathogens, demonstrating enormous application potential.

[0004] However, like many peptide drugs, natural MccY is easily degraded by proteases in complex application environments, which severely limits its practical application. Thermolysin, a zinc-dependent metalloproteinase derived from Bacillus thermoproteolyticus, is a commonly used challenging model for assessing peptide stability due to its potent hydrolytic activity.

[0005] The problem this solution aims to solve is: how to provide a micromycin that is resistant to degradation by thermophilic proteases. Summary of the Invention

[0006] The purpose of this application is to provide a micromycin resistant to thermophilic protease degradation. By performing single and double mutation experiments on multiple sites in the MccY gene and screening, a MccY mutant with good resistance to thermophilic protease was obtained.

[0007] To achieve the above objectives, this application discloses a microbesin MccY mutant that resists thermophilic protease, wherein the 11th amino acid of MccY is mutated from S to H, N or G.

[0008] And / or mutate the 16th amino acid of MccY from Q to A.

[0009] Preferably, the 11th amino acid of MccY is mutated from S to N.

[0010] Preferably, the 16th amino acid of MccY is mutated from Q to A.

[0011] Furthermore, this application also discloses the role of the micromycin MccY mutant, which is resistant to thermophilic protease degradation, in preparing micromycin resistant to thermophilic Bacillus protease degradation.

[0012] In addition, this application also discloses a plasmid carrying the gene of the microbesin MccY mutant that resists thermophilic protease.

[0013] In addition, this application also discloses a genetically engineered bacterium capable of expressing the gene of the microbesin MccY mutant, which is an antithermophilic protease.

[0014] In addition, this application also discloses a method for constructing the above-mentioned genetically engineered bacteria, wherein the above-mentioned plasmid is transformed into competent cells to obtain genetically engineered bacteria.

[0015] The beneficial effects of this application are:

[0016] This application presents two key findings: first, the highly stable MccY-S11N variant, which maintains its structural and functional integrity for extended periods under demanding protease challenges, addressing the core issue of insufficient stability in natural peptides; and second, the remarkable MccY-Q16A variant, whose antibacterial efficacy significantly surpasses that of natural MccY, achieving functional optimization and enhancement. These findings demonstrate that our engineering strategy not only circumvents defects but also proactively enhances intrinsic biological activity. Attached Figure Description

[0017] Figure 1 Plasmid map of the MccY engineered strain;

[0018] Figure 2 This is a schematic diagram of the inhibition zone of McY before incubation with thermophilic protease.

[0019] Figure 3 This is a schematic diagram of the inhibition zone of McY after incubation with thermophilic protease.

[0020] Figure 4 This is a liquid chromatography-mass spectrometry (LC-MS) analysis of MccY before enzyme digestion.

[0021] Figure 5 The image shows the liquid chromatography-mass spectrometry (LC-MS) analysis of MccY after enzyme digestion.

[0022] Figure 6 The figure shows the inhibition zone test results of 21 mutants against Salmonella typhimurium.

[0023] Figure 7 A schematic diagram illustrating the antibacterial activity of different concentrations of natural McY over time.

[0024] Figure 8 A schematic diagram illustrating the antibacterial activity of different concentrations of McY-S11G over time.

[0025] Figure 9 A schematic diagram illustrating the antibacterial activity of different concentrations of McY-S11H over time.

[0026] Figure 10 A schematic diagram illustrating the antibacterial activity of different concentrations of McY-S11N over time.

[0027] Figure 11 A schematic diagram illustrating the antibacterial activity of different concentrations of McCY-S11H-Q16P over time.

[0028] Figure 12 A schematic diagram illustrating the antibacterial activity of different concentrations of McCY-Q16A over time.

[0029] Figure 13 A bar chart showing the degradation trend of different samples at different time points; Detailed Implementation

[0030] The present application will be clearly and completely described below with reference to its embodiments. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0031] Before introducing the embodiments, the following information is provided regarding the raw materials and consumables involved in the embodiments:

[0032] Escherichia coli DH5α was used for plasmid cloning and amplification and was purchased from (Nanjing Novozymes Biotechnology Co., Ltd.).

[0033] Escherichia coli BL21(DE3) was used for protein expression and was purchased from (Nanjing Novozymes Biotechnology Co., Ltd.).

[0034] Plasmid: pET-28a(+) as expression vector, purchased from (Nanjing Novizan Biotechnology Co., Ltd.);

[0035] Gene synthesis: The MccY expression gene cluster (full length 4464bp, including McsA, McsB, McsC, and McsD) was synthesized by Guangzhou Aiji Biotechnology Co., Ltd.

[0036] The ncbi number of the MccY expression gene cluster is AAFABO010000013.1;

[0037] The amino acid sequence of MccY; GGRGHIAEYFSGPITQVSFYG

[0038] Enzymes and reagents: Restriction endonucleases (Nde I, Xho I), T4 DNA ligase, DpnI endonuclease, DNA Marker, T4 PNK phosphatase, and homologous recombination kit were all purchased from NEB.

[0039] DNA gel extraction kit and plasmid miniprep kit were purchased from OMEGA.

[0040] Thermophilic protease (≥2000 U / mg) was purchased from Maclean's.

[0041] Culture medium components such as peptone and yeast extract were purchased from Oxoid.

[0042] Primer synthesis and sequencing services were provided by Sangon Biotech (Shanghai) Co., Ltd.

[0043] The indicator strain of Salmonella Typhimurium is ATCC14028.

[0044] Example 1: Construction of MccY engineered bacteria and design of mutation sites

[0045] 1.1 Construction of MccY engineered strain

[0046] 1.1.1 Plasmid construction:

[0047] 1) Synthesizing gene fragments: Based on NCBI number AAFABO010000013.1, Guangzhou Aiji Biotechnology Co., Ltd. was commissioned to synthesize the MccY expression gene cluster. The full length of the gene cluster is 4464bp (including mcsA, mcsB, mcsC, and mcsD). The sequence of the mcsA gene was reversed, and an Nde I site was introduced at the front end of the synthesized fragment, which already contains the gene's start codon ATG. An Xho I restriction site was introduced at the back end of the synthesized fragment.

[0048] 2) Preparation of the vector and insert fragment:

[0049] Expression vector linearization: The target expression vector pET-28a(+) was double-digested with Nde I and Xho I enzymes, and the linearized large fragment of the vector was recovered by agarose gel electrophoresis;

[0050] Insert preparation: The DNA fragment containing the optimized MccY gene coding sequence was recovered by double digestion with Nde I and Xho I enzyme genes MccY cluster and recovered by agarose gel electrophoresis.

[0051] 3) Ligation and transformation: The recovered McY fragment was mixed with the linearized pET-28a(+) vector at a molar ratio of 3:1, and T4 DNA ligase was added. Ligation was carried out at 16°C for 3 hours. All ligation products were transformed into 100 μL of DH5α competent cells. After transformation by heat shock (42°C, 90 seconds), the cells were plated on LB agar plates containing kanamycin (50 μg / mL) and incubated upside down at 37°C for 12–16 hours.

[0052] 4) Positive clone identification: Single colonies were picked and colony PCR was performed using universal vector primers T7-F (TAATACGACTCACTATAGGG) / T7-R (GCTAGTTATTGCTCAGCGG). Colonies that were correctly verified by PCR were inoculated with culture medium, plasmids were extracted, and sequencing was performed for further verification, yielding the recombinant plasmid pET-28a(+)-MccY.

[0053] 1.1.2 Construction of expression strains

[0054] The correctly sequenced pET-28a(+)-MccY plasmid was transformed into BL21(DE3) competent cells using a heat shock method. The cells were then plated on kanamycin (30 μg / mL) LB agar plates, and the MccY engineered strain was obtained through screening. The plasmid is shown below. Figure 1 As shown.

[0055] 1.2 Analysis of the sensitivity of natural McY to thermophilic proteases and its degradation mechanism

[0056] Natural MccY before incubation with thermophilic protease, Figure 2 Before the reaction, Figure 3 After the reaction (labeled as 1 for the original sample containing 30 μg / ml MccY, 2 for half the original sample containing 15 μg / ml MccY, 3 for one-quarter the original sample containing 7.5 μg / ml MccY, 4 for one-eighth the original sample containing 3.75 μg / ml MccY, and 5 for one-sixth the original sample containing 1.875 μg / ml MccY), clear and gradient inhibition zones were observed for all dilutions of *Salmonella typhimurium*. However, after incubation at 42°C for 24 hours, its antibacterial activity decreased significantly, indicating that natural MccY is highly sensitive to thermophilic proteases.

[0057] To elucidate its degradation mechanism, HPLC analysis was performed on samples before and after enzymatic digestion;

[0058] refer to Figure 4-5Before enzyme digestion, MccY exhibits a single main peak at a specific retention time (25 minutes). After digestion, the area of ​​this main peak significantly decreases, and a new dominant peak appears at 16.2 minutes. Mass spectrometry sequencing analysis of this new peak identified its amino acid sequence as GGRGHIAEYFVSFYG. Comparison with the corresponding sequence of native MccY (GGRGHIAEYFSGPITQVSFYG) revealed the absence of the six amino acids "SGPITQ". This result conclusively demonstrates that the thermophilic protease cleaves MccY at two specific sites: the F10-S11 peptide bond and the Q16-V17 peptide bond.

[0059] 1.3 Mutation design at F10, S11, Q16 and V17 sites and construction of mutant engineered bacteria

[0060] Based on the above mechanism, a series of mutations were designed targeting the F10, S11, Q16, and V17 sites. The first round of mutations focused on single mutation sites, resulting in the construction of 76 single mutants. The construction method was as follows: using pET-28a(+)-MccY as a template, overlap extension PCR was performed using high-fidelity DNA polymerase, introducing the required mutation primers. The PCR product was treated with DpnI (37℃, 30 minutes) to eliminate the template plasmid, followed by gel recovery. The recovered mutant gene fragment was ligated with a linearized pET-28a(+) vector digested with the same enzymes using homologous recombinase (according to the kit instructions) at 50℃ for 1 hour. The ligation product was transformed into BL21(DE3) competent cells, expressed, and purified to obtain the engineered strains of each mutant.

[0061] In addition, it should be noted that the specific methods for expression and purification of the engineered bacteria are as follows:

[0062] The correctly identified engineered strain was inoculated into LB liquid medium containing kanamycin (30 μg / mL) and cultured at 37°C with shaking at 220 rpm until OD600 ≈ 0.5-0.6. Isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mM, and expression was induced for another 24 h at 37°C. After centrifugation at 5000×g for 20 minutes at 4°C, the supernatant was collected and filtered through a 0.22 μm microporous membrane to obtain the crude extract of McY and its variant protein solutions, which were stored at -20°C for later use.

[0063] Results analysis:

[0064] Through initial screening (expression and basic antibacterial activity), 21 mutants that still maintained antibacterial activity against Salmonella Typhimurium were obtained. Figure 6 The above figure shows the inhibition zone test results of the 21 mutants against Salmonella typhimurium.

[0065] Q16A indicates that the 16th amino acid of MccY is mutated from Q to A;

[0066] Where Q16M indicates that the 16th amino acid of MccY is mutated from Q to M;

[0067] Where Q16V indicates that the 16th amino acid of MccY is mutated from Q to V;

[0068] Q16R indicates that the 16th amino acid of MccY is mutated from Q to R;

[0069] Q16L indicates that the 16th amino acid of MccY is mutated from Q to L;

[0070] Q16P indicates that the 16th amino acid of MccY is mutated from Q to P.

[0071] Where Q16S indicates that the 16th amino acid of MccY is mutated from Q to S;

[0072] Where Q16T indicates that the 16th amino acid of MccY is mutated from Q to T;

[0073] Q16F indicates that the 16th amino acid of MccY is mutated from Q to F;

[0074] Q16C indicates that the 16th amino acid of MccY is mutated from Q to C;

[0075] S11I indicates that the 11th amino acid of MccY is mutated from S to I;

[0076] S11A indicates that the 11th amino acid in MccY is mutated from S to A.

[0077] S11T indicates that the 11th amino acid in McCY is mutated from S to T.

[0078] S11N indicates that the 11th amino acid in MccY is mutated from S to N;

[0079] S11G indicates that the 11th amino acid in MccY is mutated from S to G.

[0080] S11H indicates that the 11th amino acid in MccY is mutated from S to H;

[0081] S11M indicates that the 11th amino acid of MccY is mutated from S to M;

[0082] S11Y indicates that the 11th amino acid in MccY is mutated from S to Y.

[0083] S11C indicates that the 11th amino acid in MccY is mutated from S to C.

[0084] F10W indicates that the 10th amino acid of MccY is mutated from F to W;

[0085] V17I indicates that the 17th amino acid of MccY is mutated from V to I;

[0086] One variant, MccY-Q16A (amino acid sequence: GGRGHIAEYFSGPITAVSFYG), exhibited superior antibacterial efficacy compared to natural MccY and all other variants. Agar diffusion assays showed that the inhibition zone diameter produced by MccY-Q16A was on average 20% larger than that of natural MccY. Further quantitative analysis confirmed that its minimum inhibitory concentration (MIC) against Salmonella typhimurium was consistent with that of natural MccY, but its yield was 1.5 times higher than that of natural MccY under the same expression conditions. The thermophilic protease stability test (42℃, 24h) was performed on these 21 active variants, and three single mutants that still showed significant antibacterial activity after enzyme treatment were finally screened out: MccY-S11H (amino acid sequence: GGRGHIAEYFHGPITQVSFYG), MccY-S11N (amino acid sequence: GGRGHIAEYFNGPITQVSFYG), and MccY-S11G (amino acid sequence: GGRGHIAEYFGGPITQVSFYG). This result indicates that replacing the easily cleaved S11 with a larger amino acid or one with a different charge can effectively resist protease degradation.

[0087] In addition, it should be noted that the primers corresponding to the mutants (MccY-S11H, MccY-S11N, MccY-S11G, MccY-Q16A) with good antibacterial ability are shown in Table 1.

[0088] Table 1: Examples of site-directed mutagenesis primers

[0089] Mutant name mutation site Primer sequence (5' -> 3') MccY-S11H The 11th amino acid is mutated from F to H. -GAGTATTTTCACGGCCCTATCACACAAGTCAGCTTTT--ACTTGTGTGATAGGGCCGTGAAAATACTCCGCAATGTG- MccY-S11N The 11th amino acid is mutated from F to N. -GAGTATTTTAATGGCCCTATCACACAAGTCAGCTTTT--ACTTGTGTGATAGGGCCATTAAAATACTCCGCAATGTG- MccY-S11G The 11th amino acid is mutated from F to G. -GAGTATTTTGGTGGCCCTATCACACAAGTCAGCTTTT--GACTTGTGTGATAGGGCCACCAAAATACTCCGCAATGTG- MccY-Q16A The 16th amino acid is mutated from Q to A. -GAGTATTTTAGTGGCCCTATCACAGCCGTCAGCTTTT--ACGGCTGTGATAGGGCCACTAAAATACTCCGCAATGTG- MccY-S11H-Q16P The 11th amino acid is mutated from S to H, and the 16th amino acid is mutated from Q to P. -ATCGCGGAATATTTTCATGGTCCGATCACCCCAGTATCGTTCTACG--GATACTGGGGTGATCGGACCATGAAAATATTCCGCGATATGCCCCCGACCACC-

[0090] Example 2: Stability test of thermophilic protease in mutant engineered bacteria

[0091] 2.1 Thermophilic Protease Stability Test Method

[0092] The thermophilic protease stability test was conducted on MccY-S11H, MccY-S11N, MccY-S11G, and MccY-Q16A, which exhibited good antibacterial activity and properties as described in Example 1 above. The specific experimental method was as follows: 25 mg of the thermophilic protease expressed by McLean was resuspended in 25 ml of thermophilic protease buffer (50 mM Tris [pH 8.0], 0.5 mM CaCl2). 160 μL of a 30 μg / ml MccY solution and 20 μL of a 1 mg / ml thermophilic protease solution were reacted at 42°C for 24 h, and 10 μL of 50 mM EDTA was added to terminate the reaction.

[0093] In addition, to further discuss the relationship between mutation sites and the stability of thermophilic proteases, the following double-mutant engineered bacteria were obtained by combining the mutation cases with good antibacterial ability in Example 2. The construction method of the double-mutant engineered bacteria is the same as that of the engineered bacteria in section 1.3 of Example 1, except that the mutations were performed at two sites.

[0094] Results analysis:

[0095] refer to Figure 7-12 A time-gradient stability analysis (0-24 h) was performed on natural MccY and five preferred variants (MccY-S11H, MccY-S11N, MccY-S11G, MccY-Q16A, and MccY-S11H-Q16P). The antibacterial experiment showed that the activity of natural MccY essentially disappeared within 3 hours. In stark contrast, all mutants (except MccY-Q16A) exhibited varying degrees of increased stability throughout the 24-hour observation period. Figure 7-12 (Mark 1 indicates the original sample solution variant, Mark 2 indicates half concentration of the original solution variant, Mark 3 indicates 1 / 4 concentration of the original solution, Mark 4 indicates 1 / 8 concentration of the original solution, Mark 5 indicates 1 / 16 concentration of the original solution, and Mark 6 indicates 1 / 32 concentration of the original solution.)

[0096] 2.2 Quantitative analysis of residual micromycin

[0097] To achieve accurate quantification, HPLC was used to determine the remaining percentage of intact peptides in the samples at each time point, and a bar chart of degradation trend was plotted.

[0098] refer to Figure 13 The stability order of the mutants was: MccY-S11N > MccY-S11H > MccY-S11G > MccY-S11H-Q16P > wild-type MccY. Among them, the MccY-S11N variant showed the most outstanding stability, with approximately 20% of the intact peptide remaining after 24 hours.

[0099] Furthermore, it is speculated that the reason why the mutants of this application have good resistance to thermophilic protease degradation may be that when the serine (S) at position 11 is mutated to asparagine (N) or other amino acids, a new amide group may be introduced. This group may interact adversely with the zinc ions or surrounding amino acids at the active site of the protease, or stabilize the local conformation by forming a new hydrogen bond network, thereby sterically hindering or electrically repelling the protease attack. Surprisingly, these mutations significantly enhance protease resistance without sacrificing their core antibacterial function, suggesting that the selected mutation sites may not be directly involved in their interaction with targets (such as RNA polymerase).

[0100] Furthermore, during the experiment, this application not only obtained mutants resistant to thermophilic protease degradation, but also showed that the MccY-Q16A mutant, although relatively weak in its resistance to thermophilic protease degradation, exhibited antibacterial activity far exceeding that of the original strain and other mutants, which is equally astonishing.

Claims

1. A microinfectious mutant MccY resistant to thermophilic bacterial proteases, characterized in that, The 11th amino acid of MccY is mutated from S to H, N, or G; And / or by mutating the 16th amino acid of MccY from Q to A.

2. The microbesin MccY mutant against thermophilic protease according to claim 1, characterized in that, The 11th amino acid of MccY was mutated from S to N.

3. The microbesin MccY mutant against thermophilic protease according to claim 1, characterized in that, The 16th amino acid of MccY was mutated from Q to A.

4. The role of the McY mutant of the thermophilic protease-resistant microbes as described in any one of claims 1-3 in preparing microbes resistant to thermophilic Bacillus protease degradation.

5. A plasmid, characterized in that, Genes carrying the microbesin MccY mutant of any one of claims 1-3 against thermophilic proteases.

6. A genetically engineered bacterium, characterized in that, A gene capable of expressing the microbesin MccY mutant of any of the thermophilic proteases described in claims 1-3.

7. A method for constructing the genetically engineered bacteria according to claim 6, characterized in that, The plasmid described in claim 5 is transformed into competent cells to obtain genetically engineered bacteria.

Images