Sheep aphtha virus double-antigen self-assembly nanoparticle vaccine as well as preparation and application thereof

By using a self-assembled ferritin carrier platform, ovine orthopnea virus ORFV 050 and ORFV 086 proteins were prepared into nanoparticle vaccines, which solved the problems of insufficient safety and immune protection of existing ovine orthopnea vaccines and achieved a highly efficient immune induction effect.

CN122011208APending Publication Date: 2026-05-12JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JILIN UNIVERSITY
Filing Date
2026-01-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing sheep pox vaccines suffer from incomplete exposure of antigenic determinants and safety risks. Conventional inactivated vaccines have low immunoprotective efficacy, and attenuated vaccines exhibit virulence reversion. There is a lack of efficient and safe vaccine preparation methods.

Method used

Using self-assembled Helicobacter pylori ferritin as a carrier, and linking sheep poxvirus ORFV 050 and ORFV 086 proteins with the linker peptide GGGGS, a self-assembled nanoparticle vaccine was prepared to express and display the antigen protein and induce durable immune protection.

Benefits of technology

High-titer serum antibodies and cytokines were induced in mice, achieving effective immune protection against sheep pox virus, and exhibiting good biocompatibility and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122011208A_ABST
    Figure CN122011208A_ABST
Patent Text Reader

Abstract

The invention provides an orf virus double-antigen self-assembled nanoparticle, the nanoparticle is a fusion protein containing orf virus protein and ferritin, and the orf virus protein comprises orf virus protein ORFV 050 and orf virus protein ORFV 086. The ORFV050-ORFV086-Fel fusion protein prepared by the invention is self-assembled into nanoparticles in vitro, and can induce the generation of high-titer serum antibodies and cell factors such as IFN-gamma, TNF-alpha and IL-6 of an organism, so that the ORFV050-ORFV086-Fel fusion protein can be used for preparing vaccines for preventing and / or treating orf. Based on ORFV 050-ORFV086-Fir fusion protein, the self-assembled protein nanoparticle vaccine provided by the invention is safe and effective, can induce immune mice to generate lasting immune protection, has good immune efficacy, and can be clinically used for prevention and / or treatment of orf virus infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of veterinary medicine and pharmaceutical technology, and in particular to a method for preparing a dual-antigen self-assembled nanoparticle vaccine carrying sheep poxvirus ORFV 050 protein and ORFV 086 protein and its uses. Background Technology

[0002] Orf, also known as contagious pustular dermatitis of sheep or sheep contact dermatitis, is an acute, highly contagious disease of sheep, goats, and other small to medium-sized ruminants caused by Orfvirus (ORFV). ORFV, a representative member of the Parapoxvirus genus in the Poxviridae family, is highly epitheliotropic. Affected animals are characterized by papules, vesicles, pustules, ulcers, and verrucous crusts on the skin / mucous membranes of the lips, around the nose, eyelids, ear roots, and udder. This leads to feeding difficulties, decreased growth / reproductive performance, and even death, severely hindering the development of sheep farming and related industries. Humans can also be infected through direct or indirect contact. Susceptible groups mainly include herders, veterinarians, butchers, feeders, fur processors, and those performing religious ceremonies, posing a potential threat to public health and safety.

[0003] The ORFV genome is large, containing approximately 134 genes, and is composed of a terminal region (ORFs 001-008 and ORFs 112-134) and a core region (ORFs 009-111). The viral core region genes are relatively conserved, mainly encoding factors related to viral morphogenesis, transcription, and replication, while the terminal regions are primarily responsible for encoding proteins related to viral virulence, immune regulation, and host range. The ORFV 050 and ORFV 086 genes are located in the viral genome core region and are relatively conserved across different strains. The viral particle core protein VP8, encoded by the ORFV 050 gene, is an essential late-stage protein for viral assembly; while the protein encoded by the ORFV 086 gene and its hydrolysis products are important structural proteins for assembling mature viral particles. Bioinformatics analysis of the ORFV 050 and ORFV 086 proteins shows that both are capsid proteins, highly stable and hydrophilic proteins, lacking transmembrane domains and signal peptides.

[0004] Due to the lack of specific drugs for the prevention and treatment of ovine pox, vaccination remains the most important means of prevention. Conventional inactivated vaccines have drawbacks such as incomplete exposure of antigenic determinants and the tendency for these determinants to change during the inactivation process, resulting in relatively low vaccine immunoprotective efficacy. Attenuated vaccines, on the other hand, pose safety risks such as virulence reversion. Subunit vaccines, because they do not contain the viral genome, have advantages such as high safety and the ability to induce T and B cell immunity, making them an important direction for the development of novel, safe, and highly effective ORFV vaccines.

[0005] Ferritin is an emerging carrier platform with high stability, good biocompatibility, and unique self-assembly capabilities, making it a flexible and reliable vaccine carrier platform. It typically consists of 24 subunits arranged in an octahedral symmetry around a hollow core, with eight triple and six quadruple symmetry axes on its surface. The N-terminus of each subunit is exposed on the outer surface of the spherical structure, which can be used to display antigen proteins. Using ferritin as a carrier to immobilize antigen proteins on ferritin to prepare ferritin nanoparticle vaccines is an important technical means for the creation of novel subunit vaccines. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art by using a self-assembled Helicobacter pylori ferritin 24-tetramer to fuse a fusion antigen carrying sheep poxvirus ORFV050 and ORFV086 proteins in series with the linker peptide GGGGS and fuse it to the N-terminus of the ferritin. This process yields self-assembled nanoparticles with good assembly morphology. After immunization, these nanoparticles induce long-lasting immune protection in mice and are expected to be developed into a novel nanoparticle vaccine against sheep poxvirus.

[0007] This invention provides a dual-antigen self-assembled ferritin nanoparticle vaccine carrying sheep poxvirus ORFV 050 and ORFV 086 proteins, its preparation method, and its applications. The sheep poxvirus capsid proteins ORFV 050 and ORFV 086 are tandemly fused to the N-terminus of ferritin using the linker peptide GGGGS. Preferably, the fusion protein gene is inserted into an expression vector (preferably pET-28a vector) to construct the pET-28a-ORFV050-ORFV086-Fer protein recombinant plasmid. The fusion protein obtained by recombinant expression self-assembles into nanoparticles in vitro. Based on the characteristic of ferritin self-assembling into nanoparticles, the nanoparticles formed by ferritin self-assembly have a dome structure, allowing the antigen protein to be displayed on their surface.

[0008] To achieve the above objectives, the present invention provides a sheep poxvirus dual antigen self-assembled nanoparticle, wherein the nanoparticle is a fusion protein containing sheep poxvirus protein and ferritin, wherein the sheep poxvirus protein includes sheep poxvirus protein ORFV 050 and sheep poxvirus protein ORFV 086.

[0009] Preferably, the ferritin is a monomeric ferritin subunit.

[0010] Preferably, the monomeric ferritin subunits include, but are not limited to, any one of bacterial ferritin, plant ferritin, algal ferritin, fungal ferritin, or mammalian ferritin.

[0011] Preferably, the ferritin nucleotide sequence is selected from the NCBI GenBank database, accession number WP000949190.1; the base sequence of the ferritin is optimized according to the codon preference of E. coli, and fusion expression is performed using the E. coli system.

[0012] In any of the above-mentioned preferred embodiments, the C-terminus of the ORFV 050 protein is tandemly linked to the N-terminus of the ORFV 086 protein, and the C-terminus of the ORFV 086 protein is linked to the N-terminus of ferritin (preferably, a monomeric ferritin subunit) via a linker peptide GGGGS.

[0013] In any of the above-mentioned preferred embodiments, the fusion protein comprises ORFV 050 protein, ORFV 086 protein, and monomeric ferritin subunit in series, with connecting peptides respectively disposed at the C-terminus of ORFV 050 protein, between the N-terminus of ORFV 050 protein and the C-terminus of ORFV 086 protein, and between the N-terminus of ORFV 086 protein and the C-terminus of monomeric ferritin subunit.

[0014] Preferably, the linker peptide is GGGGS.

[0015] Preferably, the amino acid sequence of the orthopnea virus protein ORFV 050 is as shown in SEQ ID NO: 6.

[0016] Preferably, the amino acid sequence of the orthopnea virus protein ORFV 086 is as shown in SEQ ID NO: 7.

[0017] Preferably, the amino acid sequence of the ferritin is as shown in SEQ ID NO: 5.

[0018] Preferably, the fusion protein containing sheep poxvirus protein ORFV 050 and sheep poxvirus protein ORFV 086 and the ferritin is ORFV 050-ORFV086-Fer, with the amino acid sequence shown in SEQ ID NO: 8.

[0019] The amino acid sequences of the ORFV 050 and ORFV 086 proteins of this invention are selected from amino acids 50643 to 51422 and 89653 to 92370, respectively, as shown in NCBI Genbank:PV126639.2.

[0020] The present invention also provides a vaccine of self-assembled nanoparticles of orthopnea virus dual antigen according to any of the preceding claims.

[0021] The present invention also provides a method for preparing self-assembled nanoparticles of sheep poxvirus dual antigens according to any one of the above claims, wherein the encoding nucleotides of a fusion protein comprising sheep poxvirus proteins ORFV 050 and ORFV 086 and the ferritin are inserted into an expression vector, and after recombinant expression, the fusion protein self-assembles to form nanoparticles; wherein the fusion protein is referred to as ORFV 050-ORFV086-Fer.

[0022] Preferably, the encoding nucleotides of the fusion protein ORFV 050-ORFV086-Fer include the nucleotides encoding the ORFV050 protein as shown in SEQ ID NO: 2.

[0023] Preferably, the encoding nucleotides of the fusion protein ORFV050-ORFV086-Fer include the nucleotides encoding the ORFV086 protein as shown in SEQ ID NO: 3.

[0024] Preferably, the encoding nucleotides of the fusion protein ORFV050-ORFV086-Fer include nucleotides encoding ferritin as shown in SEQ ID NO: 1.

[0025] Preferably, the nucleotides encoding the fusion protein ORFV050-ORFV086-Fer are as shown in SEQ ID NO: 4.

[0026] The present invention also provides nucleotides encoding the self-assembled nanoparticles of the herpes simplex virus dual antigen as described in any of the preceding claims.

[0027] Preferably, the encoding nucleotides of the herpes simplex virus dual antigen self-assembled nanoparticles include nucleotides encoding ferritin as shown in SEQ ID NO: 1.

[0028] Preferably, the encoding nucleotides of the herpes simplex virus dual antigen self-assembled nanoparticles include nucleotides encoding the ORFV050 protein as shown in SEQ ID NO: 2.

[0029] Preferably, the encoding nucleotides of the herpes simplex virus dual antigen self-assembled nanoparticles include nucleotides encoding the ORFV086 protein as shown in SEQ ID NO: 3.

[0030] Preferably, the encoding nucleotides of the herpes simplex virus dual antigen self-assembled nanoparticles comprise nucleotides as shown in SEQ ID NO: 4.

[0031] The present invention also provides the use of the self-assembled nanoparticles of the sheep pox virus dual antigen according to any one of the foregoing claims in the preparation of vaccines for the treatment and / or prevention of sheep pox.

[0032] This invention provides a method for efficiently expressing monomeric ferritin subunits using an *E. coli* system. The monomeric ferritin subunit includes, but is not limited to, any one of bacterial ferritin, plant ferritin, algal ferritin, fungal ferritin, or mammalian ferritin. Preferably, the monomeric ferritin subunit is a *Helicobacter pylori* ferritin monomer, with accession number WP000949190.1 in the NCBI GenBank database. Optimizing the *E. coli* codons enhances the expression efficiency of ferritin.

[0033] Another aspect of the present invention provides a method for preparing ORFV dual-antigen self-assembled ferritin nanoparticles. This is achieved by linking the C-terminus of ORFV050 protein to the N-terminus of ORFV086 protein, and by linking the C-terminus of ORFV086 protein to the N-terminus of a monomeric ferritin subunit.

[0034] Ferritin is a widely distributed iron-storing protein in organisms, possessing high stability, good biocompatibility, and unique self-assembly capabilities. It is a highly promising carrier platform in the field of recombinant vaccines, enabling the display of multivalent and multiple antigens. Immunization of mice with self-assembled ferritin nanoparticles based on ORFV 050 and ORFV 086 proteins induced the production of high-titer serum antibodies and cytokines such as IFN-γ, TNF-α, and IL-6, thus making it suitable for the preparation of vaccines for the prevention and / or treatment of pox. Attached Figure Description

[0035] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings:

[0036] Figure 1 The purified ferritin was analyzed by SDS-PAGE electrophoresis in the preferred embodiment 1 of the present invention.

[0037] Figure 2 Transmission electron microscopy observation of the purified ferritin in preferred embodiment 1 of the present invention.

[0038] Figure 3 This is a particle size analysis of the purified ferritin in the preferred embodiment 1 of the present invention.

[0039] Figure 4 The purified ORFV 050-086-Fer protein in the preferred embodiment of the present invention was analyzed by SDS-PAGE electrophoresis.

[0040] Figure 5 Transmission electron microscopy observation of the purified ORFV 050-086-Fer protein in preferred embodiment 2 of the present invention.

[0041] Figure 6 Particle size analysis of the purified ORFV 050-086-Fer protein in preferred embodiment 2 of the present invention.

[0042] Figure 7 This serves as a verification of the specificity of the purified ORFV 050-086-Fer and the ORFV polyclonal antibody in the preferred embodiment 2 of the present invention.

[0043] Figure 8 The titer of ORFV 050-086 protein-specific IgG antibody in the serum of immunized mice in the preferred embodiment 3 of the present invention is shown.

[0044] Figure 9 The level of ORFV-specific IgG antibody in the serum of immunized mice in the preferred embodiment 3 of the present invention.

[0045] Figure 10 Analysis of T lymphocyte subsets in the spleen of immunized mice in preferred embodiment 3 of the present invention.

[0046] Figure 11 This is the spleen lymphocyte proliferation response in immunized mice in the preferred embodiment 3 of the present invention.

[0047] Figure 12 The cytokine secretion level of the immunized mice on day 28 in the preferred embodiment 3 of the present invention.

[0048] Figure 13 The cytokine secretion level of the immunized mice on day 35 in the preferred embodiment of the present invention is shown.

[0049] Figure 14 The weight change of the immunized mice in the preferred embodiment 4 of the present invention.

[0050] Figure 15 The variation in average food intake of immunized mice in preferred embodiment 4 of the present invention.

[0051] Figure 16 The change in body weight of immunized mice after challenge with the virus is shown in the preferred embodiment 4 of the present invention.

[0052] Figure 17 The histopathological observation results of the heart, liver, spleen, lungs and kidneys of immunized mice after challenge with the virus in the preferred embodiment 4 of the present invention are shown. Detailed Implementation

[0053] The present invention will be described more clearly and completely through the following embodiments, but the described embodiments are only some embodiments of this application, and not all embodiments. The embodiments are provided to help understand the present invention and should not be construed as limiting the scope of protection of the present invention.

[0054] The present application will be described in detail below with reference to specific embodiments.

[0055] Sources of materials used in the embodiments:

[0056] Virus and cells: ORFV-CL24 strain (GenBank: PV126639.2), which is a strain disclosed in the prior art; OFTu cells were prepared, identified and preserved by our laboratory, and the preparation method is described in a number of patents and literature in the prior art, which will not be repeated here.

[0057] Reagents: DL2000 DNA Marker, DL5000 DNA Marker, DL15000 DNA Marker, PrimeSTAR® Max DNA polymerase, restriction endonucleases, and RNA lysis buffer were purchased from Takara Bio Inc.; Viral genomic DNA / RNA extraction kit was purchased from Tiangen Biotech Co., Ltd.; Agarose gel DNA / PCR product mini-recovery kit was purchased from Biomiga Biotechnology Co., Ltd.; Seamless cloning kit, E. coli TransT1 competent cells, and BL21(DE3) competent cells were purchased from TransGen Biotech Co., Ltd.; 5× protein loading buffer and protein molecular weight standard marker were purchased from Yageo Biotechnology Co., Ltd.; Gradient gel preparation kit was purchased from Zhongke Tongyi Co., Ltd.; 0.45 μm filter was purchased from Jetech Co., Ltd.; BCA protein quantification kit was purchased from Beyotime Biotechnology Co., Ltd.; Freund's complete adjuvant and Freund's incomplete adjuvant were purchased from MP Biomedicals Co., Ltd.; Bovine serum albumin and isopropyl-β-D-D-C were also purchased. Glucosinosteroids (IPTG), urea, TMB two-component chromogenic solution, ELISA chromogenic solution, ELISA stop solution, erythrocyte lysis buffer, and Coomassie Brilliant Blue R-250 were purchased from Solarbio Science & Technology. Endotoxin-free plasmid miniprep kits were purchased from Omega Biotek. HRP-labeled goat anti-mouse IgG and HRP-labeled monkey anti-goat IgG were purchased from Proteintech. Anti-mouse CD3, CD4, and CD8 flow cytometry antibodies were purchased from Biolegend. Enhanced ECL chemiluminescence solution was purchased from Biosharp. RPMI 1640 medium and fetal bovine serum were purchased from Mellentech. All-in-one reverse transcription reagent and SYBR Green qPCR Master Mix were purchased from Abm. All other reagents not mentioned in this invention are commercially available products.

[0058] Example 1

[0059] Example 1 describes the purification and characterization of the ferritin nanocarrier platform.

[0060] Based on the Helicobacter pylori ferritin sequence (WP_000949190.1), the host codon of Escherichia coli was optimized to obtain the ferritin nucleotide sequence shown in SEQ ID NO: 1, which was then inserted between the HindⅢ and NotⅠ restriction sites of pET28a. The constructed pET28a-Fer ferritin expression vector plasmid was synthesized by Jilin Kumei Biotechnology Co., Ltd.

[0061] Add 3 μL of plasmid to 50 μL of E. coli BL21(DE3) competent cells, mix gently, incubate on ice for 30 min, heat shock at 42℃ for 90 s, incubate on ice for 3 min, add 1 mL of antibiotic-free LB medium, and incubate at 37℃ on a shaker at 180 rpm for 1.5 h. Centrifuge at 3000 ×g for 5 min, discard 800 μL of supernatant, resuspend the remaining culture, and spread evenly on solid LB medium. Incubate overnight at 37℃. The next day, pick single clones for expansion culture and incubate at 37℃ on a shaker at 180 rpm for 12 h. Dilute the bacterial culture 1:100 to a large volume of LB liquid medium and continue culturing under the same conditions until OD. 600 The concentration was approximately 0.6-0.8. IPTG was added to a final concentration of 1.0 mM. After inducing expression at 37 ℃ for 12 h, the bacterial cells were collected by centrifugation at 5000 ×g for 30 min. The bacterial cells were resuspended in PBS, centrifuged at 10000 ×g for 10 min, and the supernatant was discarded. The washing was repeated twice. The bacterial cells were thoroughly resuspended in denaturing lysis buffer (8 M urea, 20 mM Tris, 500 mM NaCl, pH 7.5). 80 ml of lysis buffer was added to every 1 L of expression bacteria. The bacteria were lysed by sonication on ice at 200 W for 5 s each time, with a 5 s interval between each sonication, until the bacterial solution was clear and transparent. The bacterial lysis buffer was centrifuged at 10000 ×g for 20 min at 4 ℃. The supernatant of the bacterial lysis buffer was collected, filtered through a 0.45 μm filter, and heated in a water bath at 60 ℃ for 15 min to denature and precipitate most of the heat-sensitive contaminating proteins. The denatured protein precipitate was removed by centrifugation at 10000 ×g for 10 min, yielding the crude ferritin extract.

[0062] Add 5× protein loading buffer to the crude ferritin extract to a final concentration of 1×, mix well, boil in water for 10 min, centrifuge at 12000 rpm for 10 min, add to the upper layer of a 4-20% gradient protein gel, load 1 mL onto each gel, and perform SDS-PAGE electrophoresis. Once the sample reaches the appropriate position, remove the gel, stain with pre-cooled 0.3 M KCl for 30 s; the thick white band is the ferritin band. Carefully cut and grind the band, place it in a centrifuge tube, add an appropriate amount of PBS to submerge the gel block, freeze-thaw at -80 ℃ and 4 ℃ three times, centrifuge at 12000 rpm for 5 min, and collect the supernatant, which is the purified ferritin.

[0063] SDS-PAGE electrophoresis was used to verify whether the position of the purified ferritin band matched the predicted protein size: 20 μL of purified ferritin solution was added to 5 μL of 5× protein loading buffer, mixed well, boiled for 10 min, centrifuged at 12000 rpm for 10 min, and the entire amount was added to the wells of a 4-20% gradient protein gel for SDS-PAGE electrophoresis. Once the sample reached the appropriate position, the gel was removed, stained with Coomassie Brilliant Blue solution on a shaker at room temperature, and washed thoroughly with ddH2O after 3 h. A suitable amount of destaining solution was added until the bands were clearly visible. Figure 1 As shown, the position of the purified ferritin band is basically consistent with the predicted protein size, which is 26 kDa.

[0064] To observe the correct assembly of purified ferritin using transmission electron microscopy: A drop of purified ferritin solution was placed on a copper grid and allowed to stand for 5 minutes to allow for full adsorption of the particles. A 1% phosphotungstic acid negative stain was added to cover the grid. After 3 minutes, excess stain was absorbed from the edges of the copper grid using filter paper. After drying, the grid was placed in the transmission electron microscope sample chamber, and the particle morphology was observed and recorded. Figure 2 As shown, the purified ferritin is a spherical nanoparticle structure with uniform size and stable structure and morphology.

[0065] Particle size analysis of purified ferritin: 500 μL of the sample was added to a quartz cuvette, and the scattering angle was fixed at 90°. The particle size distribution of the nanoparticles was evaluated by dynamic light scattering, and the measurement was repeated three times. Figure 3 As shown, the nanoparticles formed by the self-assembly of ferritin have a uniform particle size distribution with an average diameter of approximately 10 nm, consistent with previous reports. This indicates that monomeric ferritin can form uniformly sized self-assembled structures under in vitro conditions.

[0066] Example 2

[0067] Example 2 provides the purification and characterization of the ORFV 050-086-Fer recombinant protein.

[0068] ORFV genomic DNA was extracted using the viral DNA / RNA extraction kit from Tiangen Biotech Co., Ltd. The extracted viral genomic DNA was then used as a template for PCR amplification of the ORFV 050 gene. The primer sequences are as follows:

[0069] The ORFV 050-F shown in SEQ ID NO: 9:

[0070] TGGGTCGCGGATCCGAATTCATGACCAATCTGCTTTCGTTGGT

[0071] The ORFV 050-R shown in SEQ ID NO: 10: GCTTCCTCCGCCTCCGCTTCCGCCTCCGCCCGGCGCGGCCTCGGCGCCGGCGGA

[0072] The ORFV 086 gene was amplified by PCR using extracted ORFV genomic DNA as a template. Primer sequences were as follows:

[0073] The ORFV 086-F shown in SEQ ID NO: 11: GGAGGCGGAGGAAGCGGCGGTGGCGGCAGCACGGCCCCAAACGTGCACATG

[0074] The ORFV 086-R shown in SEQ ID NO: 12:

[0075] TGGTGGTGGTGGTGCTCGAGCTCACTGTCAAAAGAAACGGC

[0076] The PCR reaction system was as follows (25 μL): 12.5 μL PrimeSTAR Max Premix (2×), 1 μL each of F and R (10 μmol / L), 1 μL template, and 9.5 μL water. Reaction conditions: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 15 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles, followed by a final extension at 72 ℃ for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis. After successful alignment using a gel imaging system, the target gene band was excised and purified using a DNA purification kit to recover the target fragment.

[0077] Using the ORFV 050 gene amplified from SEQ ID NO: 9 and SEQ ID NO: 10 as templates, the ORFV 050 gene with a C-terminal linker peptide was amplified by PCR. The primer sequences are as follows:

[0078] The ORFV 050-FC shown in SEQ ID NO: 13: TGGGTCGCGGATCCGAATTCATGACCAATCTGCTTTCGTTGGT

[0079] The ORFV 050-RC shown in SEQ ID NO: 14: GCTGCCGCCACCGCCGCTTCCTCCCGCCTCCGCTTCCGCCTCCGCC

[0080] Using the ORFV 086 gene amplified by SEQ ID NO: 11 and SEQ ID NO: 12 as a template, the ORFV 086 gene with an N-terminal linker peptide was amplified by PCR. The primer sequences are as follows:

[0081] The ORFV 086-FN shown in SEQ ID NO: 15: GGCGGAGGCGGAAGCGGAGGCGGAGGAAGCGGCGGTGGCGGCAGC

[0082] The ORFV 086-RN shown in SEQ ID NO: 16:

[0083] TGGTGGTGGTGGTGCTCGAGCTCACTGTCAAAAGAAACGGC

[0084] The PCR reaction system was as follows (25 μL): 12.5 μL PrimeSTAR Max Premix (2×), 1 μL each of F and R (10 μmol / L), 1 μL template, and 9.5 μL water. Reaction conditions: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 15 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles, followed by a final extension at 72 ℃ for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis. After successful alignment using a gel imaging system, the target gene band was excised and purified using a DNA purification kit to recover the target fragment.

[0085] Using a mixture of recovered ORFV 050 and ORFV 086 genes with linked peptides as templates, PCR amplification was performed on the ORFV 050-086 genes linked by the GGGGS linker. Primer sequences are as follows:

[0086] The ORFV 050-086-F shown in SEQ ID NO: 17: TGGGTCGCGGATCCGAATTCATGACCAATCTGCTTTCGTTGGT

[0087] The ORFV 050-086-R shown in SEQ ID NO: 18: TTTACTCAGCATCCCAAGCTTGCTGCCGCCTCCGCCCTCACTGTCAAAAG

[0088] The PCR reaction system was as follows (25 μL): 12.5 μL PrimeSTAR Max Premix (2×), 1 μL each of F and R (10 μmol / L), 2 μL template, and 8.5 μL water. Reaction conditions: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 15 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 45 s, 35 cycles, followed by a final extension at 72 ℃ for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis. After successful alignment using a gel imaging system, the target gene band was excised and purified using a DNA purification kit to recover the target fragment.

[0089] It should be noted that due to the conservation of the ORFV 050 and ORFV 086 genes, all ORFV viruses disclosed in existing technologies such as journal articles are applicable to this invention, and their genomes can all be used as templates for amplifying the ORFV 050 gene shown in SEQ ID NO: 2 and the ORFV 086 gene shown in SEQ ID NO: 3. Furthermore, the method for obtaining the ORFV 050 gene shown in SEQ ID NO: 2, the ORFV 086 gene shown in SEQ ID NO: 3, and the ferritin gene shown in SEQ ID NO: 1 is not limited to PCR; they can also be directly synthesized by a biotechnology company according to the above gene sequences through commercial means.

[0090] The pET28a-Fer plasmid was digested with restriction endonucleases EcoRI and HindIII. The digestion system (50 μL) was as follows: 1000 ng plasmid, 1 μL each of the two restriction endonucleases, 5 μL 10×Qc buffer, and water to make up the remainder. The reaction was carried out at 37 ℃ for 3 h. The digestion products were subjected to 1% agarose gel electrophoresis. After the gel imaging system confirmed that the target gene band was correct, the target fragment was excised and purified using a DNA purification kit.

[0091] According to the instructions of the TransGen Seamless Cloning Kit, the target gene, after PCR, was cloned into a double-digested vector. The ligation system (10 μL) consisted of: 5 μL of 2×Basic Assembly Mix, 50 ng of vector, 100 ng of fragment, and water to make up the remainder. The mixture was incubated at 50°C for 15 min. 10 μL of the ligation product was added to 50 μL of E. coli TransT1 competent cells, gently mixed, incubated on ice for 30 min, heat-shocked at 42°C for 90 s, incubated on ice for 3 min, and then 1 mL of antibiotic-free LB medium was added. The cells were incubated at 37°C on a shaker at 180 rpm for 1.5 h, centrifuged at 3000 ×g for 5 min, discarded 800 μL of supernatant, and the remaining resuspended cells were evenly spread onto solid LB medium and incubated overnight at 37°C. The recombinant protein plasmid obtained in this example was named pET-28a-ORFV050-ORFV086-Fer. The next day, single clones of the bacterial strain were selected for expansion culture. The recombinant plasmid, which had been correctly sequenced, was added to 50 μL of E. coli BL21(DE3) competent cells. Transformation was performed using the same method as above. Single clones were then selected for expansion culture and incubated at 37 ℃ and 180 rpm for 12 h on a shaker. The bacterial culture was then diluted 1:100 to a large volume of LB liquid medium and cultured under the same conditions until OD (October Expiratory Time). 600 The concentration was approximately 0.6-0.8. IPTG was added to a final concentration of 1.2 mM. After inducing expression at 37 ℃ for 12 h, the bacterial cells were collected by centrifugation at 5000 ×g for 30 min. The bacterial cells were resuspended in PBS, centrifuged at 10000 ×g for 10 min, and the supernatant was discarded. The washing was repeated twice. The bacterial cells were thoroughly resuspended in denaturing lysis buffer (8 M urea, 20 M m Tris, 500 mM NaCl, pH 7.5). 80 ml of lysis buffer was added to every 1 L of expression bacteria. The bacteria were lysed by sonication on ice at 200 W for 5 s each time, with a 5 s interval between each sonication, until the bacterial solution was clear and transparent. Centrifuge at 10000 ×g for 20 min at 4 ℃, collect the supernatant of bacterial lysate, filter through a 0.45 μm filter, heat in a 60℃ water bath for 15 min to denature and precipitate most of the heat-sensitive impurities, centrifuge at 10000 ×g for 10 min to remove the denatured protein precipitate, and obtain the crude extract of ORFV 050-086-Fer recombinant protein.

[0092] Add 5× protein loading buffer to the crude extract of ORFV 050-086-Fer recombinant protein to a final concentration of 1×, mix well, boil in water for 10 min, centrifuge at 12000 rpm for 10 min, add to the upper layer of a 4-20% gradient protein gel, load 1 mL onto each gel, and perform SDS-PAGE electrophoresis. Once the sample reaches the appropriate position, remove the gel, stain with pre-cooled 0.3 M KCl for 30 s; the thick white band is the ORFV 050-086-Fer recombinant protein band. Carefully cut and grind the band, place it in a centrifuge tube, add an appropriate amount of PBS to submerge the gel, freeze-thaw at -80 ℃ and 4 ℃ three times, centrifuge at 12000 rpm for 5 min, and collect the supernatant, which is the purified ORFV 050-086-Fer recombinant protein.

[0093] SDS-PAGE electrophoresis was used to verify whether the position of the purified ORFV 050-086-Fer recombinant protein band matched the predicted protein size: 20 μL of purified recombinant protein was added to 5 μL of 5× protein loading buffer, mixed, boiled for 10 min, centrifuged at 12000 rpm for 10 min, and the entire amount was added to the wells of a 4-20% gradient protein gel for SDS-PAGE electrophoresis. Once the sample reached the appropriate position, the gel was removed, stained with Coomassie Brilliant Blue solution on a shaker at room temperature, and rinsed thoroughly with ddH2O after 3 h. A suitable amount of destaining solution was added until the bands were clearly visible. Figure 4 As shown, the position of the purified ORFV 050-086-Fer recombinant protein band is basically consistent with the predicted protein size, which is 155 kDa.

[0094] Transmission electron microscopy was used to observe whether the purified ORFV 050-086-Fer recombinant protein was correctly assembled: A drop of purified recombinant protein solution was placed on a copper grid, and allowed to stand for 5 min to allow for full adsorption of the particles. 1% phosphotungstic acid negative staining solution was added to cover the grid, and after 3 min, excess staining solution was blotted off with filter paper at the edge of the copper grid. After drying, the grid was placed in the transmission electron microscope sample chamber, and the morphological characteristics of the particles were observed and recorded. Figure 5 As shown, the purified ORFV 050-086-Fer recombinant protein is a spherical nanoparticle structure with uniform size and stable structure and morphology.

[0095] The particle size of purified ORFV 050-086-Fer recombinant protein was determined using a particle size analyzer: 500 μL of the sample was added to a quartz cuvette, and the scattering angle was fixed at 90°. The particle size distribution of the nanoparticles was evaluated by dynamic light scattering, and the measurement was repeated three times. Figure 6As shown, the nanoparticles formed by the self-assembly of ORFV 050-086-Fer recombinant protein have a uniform particle size distribution with an average diameter of 515 nm. This indicates that ORFV 050-086, after recombination with ferritin, can also form uniformly sized self-assembled particles under in vitro conditions, although the size increases and aggregation occurs.

[0096] Western blot identification of the ORFV 050-086-Fer recombinant protein: The purified recombinant protein was used as the sample, sheep serum infected with pox disease was used as the primary antibody, and monkey anti-sheep antibody was used as the secondary antibody. Figure 7 As shown, a single band was observed at the target location, indicating that the ORFV 050-086-Fer recombinant protein reacted with the serum of sheep infected with pox tetanus, demonstrating good specificity.

[0097] Example 3

[0098] Example 3 is an evaluation of the immunogenicity of mice immunized with ORFV 050-086-Fer recombinant protein.

[0099] Six-week-old female BALB / c mice were immunized with 100 μg of recombinant ORFV 050-086-Fer protein via subcutaneous injection at multiple sites on the back. The initial immunization was performed by mixing the protein with Freund's complete adjuvant at a 1:1 ratio and thoroughly shaking to emulsify. A booster immunization was performed on day 21 after the initial immunization by mixing the protein with Freund's incomplete adjuvant at a 1:1 ratio and thoroughly shaking to emulsify. Simultaneously, PBS, Fer (based on the ferritin shown in SEQ ID NO: 5), and ORFV 050-086 (based on the ORFV 050-086 protein shown in SEQ ID NO: 19) were established, with the same immunization schedule as above.

[0100] Serum from mice was collected on days 14, 21, and 28 post-immunization. The level of specific antibodies against the ORFV 050-086 recombinant protein in the serum was detected by indirect ELISA. The optimal antigen coating concentration of 8 μg / mL was pre-selected using the checkerboard titration method. The purified ORFV 050-086 recombinant protein was diluted to 8 μg / mL with coating buffer, and 100 μL was added to each well of a 96-well plate and incubated overnight at 4 °C. The plate was washed three times with 200 μL of PBST, shaking for 5 min each time, and then blotted dry. 100 μL of 10% bovine serum albumin was added to each well, and the plate was blocked at 37 °C for 1 h. Mouse serum was serially diluted 1:50, with 100 μL added to each well, and incubated at room temperature for 1 h. The plate was washed three times with PBST and blotted dry. 100 μL of HRP-labeled goat anti-mouse IgG diluted 1:10000 was added to each well, and the plate was incubated at room temperature for 1 h. Wash the plate three times with PBST and blot dry. Add 100 μL of chromogenic solution to each well, incubate at 37 °C in the dark for 15 min, then add 100 μL of stop solution. Measure the OD of each well using a microplate reader. 450 Value. For example... Figure 8 As shown, on day 7 after booster immunization, specific IgG antibodies against the recombinant ORFV 050-086 protein were detected in both the ORFV 050-086 group and the ORFV 050-086-Fer group. Compared with the PBS control group, the specific antibody titer of ORFV 050-086 protein induced in the ORFV 050-086 group was approximately 1:7467 (P<0.001), and the specific antibody titer of ORFV 050-086 protein induced in the ORFV 050-086-Fer group was approximately 1:9600 (P<0.001). Mice in the PBS and Fer control groups did not produce specific antibodies. The results indicate that both ORFV 050-086-Fer and ORFV 050-086 immunization can induce the production of specific ORFV 050-086 antibodies, with the ORFV 050-086-Fer immunization showing a slightly stronger effect.

[0101] Serum from mice was collected on days 7, 14, 21, 28, and 35 post-initial immunization. The level of specific antibodies against whole ORFV virus in the serum was detected by indirect ELISA. The optimal ratio of coating buffer to virus was pre-selected using the checkerboard titration method to be 40:1, and the optimal serum dilution was 1:100. The coating buffer and virus were mixed at a 40:1 ratio and added to 100 μL per well of a 96-well plate, incubated overnight at 4 °C. Each well was washed three times with 200 μL of PBST, shaking for 5 min each time, and then blotted dry. Each well was blocked with 100 μL of 10% bovine serum albumin at 37 °C for 1 h. Mouse serum was diluted 1:100, with three replicates, 100 μL per well, and incubated at room temperature for 1 h. The remaining steps were the same as above, and the OD of each well was measured using a microplate reader.450 Value. For example... Figure 9 As shown, on days 21, 28, and 35 after the initial immunization, the OD values ​​of the PBS group and the Fer group were [data missing]. 450 The values ​​were all less than 0.5, showing no significant difference between them. Compared with the control group, both the ORFV 050-086 group and the ORFV 050-086-Fer group showed detectable specific IgG antibodies against ORFV, which was highly significant compared with the control group (P<0.001). OD in the ORFV050-086-Fer group after the second immunization was... 450 The value was significantly greater than that of the ORFV 050-086 group (P<0.001). The results indicate that ORFV 050-086-Fer immunization can induce the body to produce highly efficient and durable specific ORFV antibodies, which is superior to ORFV 050-086 immunization alone.

[0102] Spleens from mice were aseptically collected on day 35 post-immunization. The cells were gently homogenized using the inner core of a 20 mL syringe, washed with RPMI 1640 cell culture medium, filtered through 200-mesh gauze, centrifuged at 500 ×g for 10 min, and the supernatant was discarded. An appropriate amount of erythrocyte lysis buffer was added, and the cells were lysed on ice for 3 min. The cells were then centrifuged at 500 ×g for 10 min, and the supernatant was discarded. This process was repeated until the red color of the cell pellet faded. The cell pellet was resuspended in PBS containing 2% FBS to obtain the spleen cell suspension. Cells were counted at 1000 cells per day. 6-7 For the cells, CD3, CD4, and CD8 flow cytometry antibodies were added, and single-stain and blank cells were set up as compensation. Staining was carried out at 4 ℃ in the dark for 1 h. 1 ml FACS Buffer was added to each tube to stop staining, centrifuged at 500 ×g for 5 min, the supernatant was discarded, and the cells were washed twice with 200 μL FACS Buffer, filtered through 200 mesh gauze, and then loaded onto the instrument. Figure 10 In the image, A represents the results of flow cytometry analysis, and B represents CD3. + CD4 + T lymphocyte subset analysis, C represents CD3 + CD8 + T lymphocyte subset analysis. For example... Figure 10 As shown, CD3 in mice after protein immunization + CD4 + The percentage of T lymphocytes was significantly increased (P<0.001), while CD3... + CD8 + The percentage of T lymphocytes was significantly reduced (P<0.001), with a significant difference between ORFV 050-086-Fer and ORFV050-086 (P<0.001). These results indicate that ORFV 050-086-Fer immunostimulation significantly increased CD3+ in mice. + CD4 + Proportion.

[0103] An appropriate amount of the above-mentioned spleen cells were resuspended in RPMI 1640 cell culture medium containing 10% FBS, and the concentration was adjusted to 10. 6 Add 100 μL of 100 μg / mL ORFV 050-086 recombinant protein to each well of a 96-well plate, followed by 10 μL / well of 100 μg / mL ORFV 050-086 recombinant protein. A negative control group (untreated) and a blank control group (containing only RPMI 1640) were also included. After incubation at 37 ℃ and 5% CO2 for 72 h, 10 μL of CCK8 reagent was added to each well, and the plate was incubated for 2 h. The OD of each well was then measured using a microplate reader. 450 Value. Calculate the stimulus index (PI) = (OD) 实验组 -OD 空白组 ) / (OD 阴性对照组 -OD 空白 ).like Figure 11 As shown, the stimulation indices of the ORFV 050-086 group and the ORFV 050-086-Fer group were slightly higher than those of the PBS group and the Fer group, indicating that the two proteins stimulated the proliferation of splenic lymphocytes in mice.

[0104] Spleen cells were collected from mice on days 28 and 35 after the initial immunization. RNA was extracted and reverse transcribed into cDNA, and cytokine levels were detected by real-time quantitative PCR. Using the extracted cDNA as a template, IFN-γ, TNF-α, IL-6, and IL-10 genes were amplified. The RT-qPCR reaction system was as follows (20 μL): 5 μL SYBR Green qPCR Master Mix (2×), 1 μL each of F and R (10 μmol / L), 1 μL template, and 2 μL water. Reaction conditions: 95 ℃ pre-denaturation for 10 min, 95 ℃ denaturation for 15 s, 60 ℃ annealing for 30 s, 95 ℃ extension for 15 s, 50 cycles, 60 ℃ extension for 1 min. Figure 12 As shown, on day 28 after the initial immunization, compared with the PBS group and the Fer group, ORFV 050-086-Fer immunization significantly upregulated the relative mRNA expression levels of IFN-γ, TNF-α, and IL-6 (P<0.05), with TNF-α levels significantly higher than those in the ORFV 050-086 group (P<0.05); IL-10 expression levels showed no significant change. Figure 13 As shown, on day 35 after the initial immunization, the ORFV 050-086-Fer group maintained a relatively high TNF-α expression, which was significantly different from the Fer group (P<0.05). These results indicate that immunization of mice with ORFV 050-086-Fer induced higher levels of cellular and humoral immunity compared to immunization with ORFV 050-086 alone.

[0105] Example 4

[0106] Example 4: Safety evaluation of mice immunized with ORFV 050-086-Fer recombinant protein

[0107] Record mouse body weight and food intake weekly after immunization. Figure 14 As shown, the mice gradually gained weight, with no significant differences between groups. Figure 15 As shown, the average food intake of mice remained relatively stable, with no significant differences among groups. The results indicate that protein immunization does not affect the growth performance of mice.

[0108] On day 14 following booster immunization, a challenge protection test was conducted. 10 5.75 Mice were inoculated with 0.1 mL of TCID50 ORFV wild-type strain via lip pricking, and their body weight was observed daily. Figure 16 As shown, the body weight of mice in the PBS group and Fer group was lower than that in the ORFV 050-086-Fer group and ORFV 050-086 group, but the difference was not significant. In the challenge protection test of this invention, all ORFV wild-type strains described in the prior art are applicable to this invention, including but not limited to the following published ORFV wild-type strains, which the public can obtain through sharing: The identification and genetic characteristics of the Orf virus strain (ORFV-CL24) isolated from Jilin province, China; published in: Frontiers in Microbiology; ISSN: 1664-302X; page number: Volume 16-2025:1658326.

[0109] On day 14 post-challenge, heart, liver, spleen, lung, and kidney tissues from mice were collected for HE staining and observation. Fresh tissues were cut into appropriate sizes, fixed in 4% paraformaldehyde at room temperature for 48 h, trimmed into 3-5 mm thick sections, dehydrated by a gradient of 80%, 90%, 95%, and 100% ethanol for 2 h each, incubated overnight in 100% ethanol, cleared in xylene, embedded in paraffin, cut into 3 μm thick sections, placed in a 60 ℃ oven for 1 h, dewaxed, hydrated, stained with hematoxylin and eosin, mounted, and observed under an optical microscope. Figure 17 As shown, histological observation of various tissues and organs of mice revealed that, in both the control and immunized groups, cardiomyocytes were arranged normally; hepatocyte cords were arranged radially; the white and red pulp of the spleen were clearly visible; and no obvious pathological changes were observed in the lungs and kidneys. The results indicate that immunization with ORFV 050-086-Fer does not induce adverse reactions in mice.

[0110] In summary, a type of sheep poxvirus dual-antigen nanoparticle based on self-assembled ferritin can induce a specific immune response in the body, thereby inhibiting sheep poxvirus infection, and thus can be used to prepare a vaccine to prevent sheep poxvirus infection.

[0111] The above embodiments are merely illustrative examples and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A self-assembled nanoparticle containing sheep poxvirus dual antigens, wherein the nanoparticle is a fusion protein comprising sheep poxvirus protein and ferritin, characterized in that, The poxvirus proteins include poxvirus protein ORFV 050 and poxvirus protein ORFV 086.

2. The self-assembled nanoparticles of sheep poxvirus dual antigens as described in claim 1, characterized in that, The ferritin is a monomeric ferritin subunit; in the fusion protein, ORFV 050 protein, ORFV 086 protein and monomeric ferritin subunit are connected in series, and linking peptides are respectively provided at the C-terminus of ORFV 050 protein, between the N-terminus of ORFV 050 protein and the C-terminus of ORFV 086 protein, and between the N-terminus of ORFV 086 protein and the C-terminus of monomeric ferritin subunit.

3. The self-assembled nanoparticles of sheep pox virus dual antigen as described in claim 1 or 2, characterized in that, The amino acid sequence of the orthopnea virus protein ORFV 050 is shown in SEQ ID NO:

6.

4. The self-assembled nanoparticles of oropharyngeal thrush virus dual antigen as described in claim 1 or 2, characterized in that, The amino acid sequence of the orthopnea virus protein ORFV 086 is shown in SEQ ID NO:

7.

5. The self-assembled nanoparticles of ovine poxvirus dual antigens as described in claim 1 or 2, characterized in that, The amino acid sequence of the ferritin is shown in SEQ ID NO:

5.

6. The vaccine of sheep poxvirus dual antigen self-assembled nanoparticles according to any one of claims 1-5.

7. The method for preparing sheep poxvirus dual-antigen self-assembled nanoparticles according to any one of claims 1-5, characterized in that, The encoding nucleotides of a fusion protein consisting of sheep poxvirus proteins ORFV 050 and ORFV 086 and ferritin were inserted into an expression vector. After recombinant expression, the fusion protein self-assembled to form nanoparticles; wherein the fusion protein is referred to as ORFV050-ORFV086-Fer.

8. The preparation method according to claim 7, characterized in that, The nucleotides encoding the fusion protein ORFV050-ORFV086-Fer include nucleotides encoding the ORFV050 protein as shown in SEQ ID NO: 2; or, the nucleotides encoding the fusion protein ORFV050-ORFV086-Fer include nucleotides encoding the ORFV086 protein as shown in SEQ ID NO:

3.

9. The nucleotide encoded by the self-assembled nanoparticles of the herpes simplex virus dual antigen according to any one of claims 1-5.

10. The use of the sheep pox virus dual antigen self-assembled nanoparticles according to any one of claims 1-5 in the preparation of vaccines for the treatment and / or prevention of sheep pox.