KpADH alcohol dehydrogenase mutant and application thereof in synthesis of syringol

Abstract

The invention provides a KpADH alcohol dehydrogenase mutant and application of the KpADH alcohol dehydrogenase mutant in syringol synthesis, under the condition that a recombinant expression vector pET28a-KpADH is used as a template, the 165 site and the 231 site of KpADH alcohol dehydrogenase with the amino acid sequence as shown in SEQ ID NO.1 are subjected to single-point or double mutation, and the KpADH alcohol dehydrogenase mutant is obtained. The mutant shows an enhanced catalytic rate. Wherein the KpADH alcohol dehydrogenase mutant C165F-V231D whole-cell catalyst can be used for reducing 20 mM of syringaldehyde into the syringyl alcohol within 24 hours, and the yield reaches 92.1 percent.

Description

Technical Field

[0001] This invention relates to the fields of enzyme catalysis engineering and protein modification engineering, specifically to a KpADH alcohol dehydrogenase mutant and its application in eugenol synthesis. Background Technology

[0002] Eugenol is an important chemical intermediate with wide applications in fragrance and pharmaceutical production. Clinically, eugenol exhibits significant inhibitory effects against various bacteria and fungi, disrupting microbial cell structure or interfering with their metabolism, thus reducing pathogen growth. It is often used as an adjunct treatment for infectious diseases caused by bacteria or fungi. It can be obtained through the reduction of eugenol, a compound derived from lignin.

[0003] Due to the low yield of plant extraction methods, Panyadee et al. provided a promising alternative: microbial biotransformation to prepare eugenol. Putra et al. used strain DALE-22 to catalyze the efficient conversion of 22.3 mM eugenol to 18.7 mM eugenol, highlighting the advantages of biosynthetic routes in terms of mild reaction conditions and environmental sustainability. However, the cell is complex, requiring consistent control of fermentation conditions over a short period.

[0004] KpADH is an NADPH alcohol dehydrogenase identified from KP. Recombinant Escherichia coli KPADH contains the reductase (ADH) of Kluyveromyces polysporus and the glucose dehydrogenase (GDH) of Bacillus subtilis. In recent years, GDH has been able to bioconvert NAD(P)+ to NAD(P)H, while the co-substrate glucose is oxidized to regenerate the coenzyme. The coupling of ADH with glucose dehydrogenase (GDH) for coenzyme regeneration has been effectively used to prepare bio-based alcohols. Wen et al. utilized the wild-type alcohol dehydrogenase KpADH to catalyze the de novo synthesis of (S)-N-Boc-3-hydroxypiperidine ((S)-NBHP), but the catalytic activity was low and unsuitable for industrial production. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a KpADH alcohol dehydrogenase mutant and its application in the synthesis of eugenol.

[0006] The present invention first provides a wild-type alcohol dehydrogenase, which is KpADH alcohol dehydrogenase derived from Kluyveromyces polyspor, and its amino acid sequence is shown in SEQ ID NO.1. It exhibits excellent catalytic activity in reducing large-volume ketone substrates.

[0007] Site-directed mutagenesis was performed on the amino acid sequence of the above-mentioned wild-type alcohol dehydrogenase to obtain alcohol dehydrogenase mutants; the mutations included one or more of the following:

[0008] (1) Mutate cysteine ​​(C) at position 165 to phenylalanine (F);

[0009] (2) Mutate valine (V) at position 231 to aspartic acid (D).

[0010] Preferably, the amino acid sequence of the above-mentioned wild-type alcohol dehydrogenase is mutated at position 165 to F and at position 231 to D to obtain mutant C165F-V231D, the amino acid sequence of which is shown in SEQ ID NO.2; or the amino acid sequence of the above-mentioned wild-type alcohol dehydrogenase is mutated at position 165 to F, the amino acid sequence of which is shown in SEQ ID NO.3; and the amino acid sequence of the above-mentioned wild-type alcohol dehydrogenase is mutated at position 231 to D to obtain mutant V231D, the amino acid sequence of which is shown in SEQ ID NO.4.

[0011] The present invention further provides genes encoding the above-mentioned wild-type alcohol dehydrogenase and alcohol dehydrogenase mutant.

[0012] Preferably, the nucleotide sequence of the wild-type alcohol dehydrogenase is shown in SEQ ID NO.5, and the nucleotide sequence of the alcohol dehydrogenase mutant is shown in SEQ ID NO.6~8.

[0013] The present invention further provides a recombinant vector containing the above-mentioned coding gene, and an expression strain containing the coding gene or the recombinant vector.

[0014] Specifically, the preparation method of the above-mentioned recombinant vector and expression strain is as follows: the nucleotide sequence of the alcohol dehydrogenase KpADH mutant is ligated to the pET vector through the enzyme cleavage site to obtain the recombinant vector; the recombinant vector is transformed into the expression system by heat shock method to obtain the mutant expression strain.

[0015] This invention also provides the application of the above-mentioned wild-type alcohol dehydrogenase and alcohol dehydrogenase mutant in the catalytic synthesis of eugenol from the substrate eugenaldehyde.

[0016] Specifically, the enzyme catalytic system includes the substrate syringaldehyde, the co-substrate glucose, NADPH, and alcohol dehydrogenase.

[0017] Furthermore, the alcohol dehydrogenase is added in the form of wet cells prepared by high-density fermentation of the expression strain.

[0018] Furthermore, in the enzyme catalytic system, the concentration of syringaldehyde is 20 mM, and the concentration of wet bacterial cells is 0.05 g / mL. The molar ratio of syringaldehyde, glucose, and NADPH in the enzyme catalytic system is 20:40:0.002.

[0019] The conditions for the catalytic reaction are: 30°C, pH 7.0.

[0020] In some specific embodiments of the present invention, wet cells of the C165F mutant of alcohol dehydrogenase (0.05 g / mL), wet cells of the V231D mutant (0.05 g / mL), wet cells of the C165F-V231D mutant (0.05 g / mL), and wild-type wet cells (0.05 g / mL) were mixed in phosphate buffer (pH 7.0) and subjected to syringaldehyde bioreduction at 30 °C. The double mutant C165F-V231D achieved a yield of 92.1%, which was 1.62 times higher than that of the wild-type enzyme (yield of 57.0%). The mutant C165F-V231D obtained by the present invention exhibits an enhanced catalytic rate. Attached Figure Description

[0021] Figure 1 This is a diagram of the recombinant plasmid. Detailed Implementation

[0022] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of this invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0023] Example 1: Construction of recombinant Escherichia coli KpADH and its mutants

[0024] The nucleotide sequence of the alcohol dehydrogenase KpADH from *Kluyveromyces cerevisiae* is shown in SEQ ID NO. 5. The amino acid sequences of the alcohol dehydrogenase mutants are shown in SEQ ID NOs 2–4, and the nucleotide sequences are shown in SEQ ID NOs 6–8. Primers used for PCR amplification were designed based on the desired mutation sites, and their sequences are listed in Table 1. High-fidelity DNA polymerase was used during PCR to ensure amplification accuracy. After amplification, the PCR products were treated with the restriction endonuclease DpnI to selectively degrade the parental methylated plasmid DNA while retaining the newly synthesized unmethylated mutant DNA.

[0025] The PCR product after DpnI digestion was introduced into *E. coli* TOP10 competent cells via heat shock transformation. Transformed cells were seeded on LB agar plates containing appropriate antibiotics and cultured overnight. The next day, single colonies were picked for expansion. Plasmid DNA was extracted and Sanger sequencing was performed to verify the presence and accuracy of the expected mutation. The confirmed mutant construct was then transformed into the expression host strain *E. coli* BL21(DE3).

[0026] Table 1 Primer Sequences

[0027] Primer Sequence pET28a-F ctcgagcaccaccaccacc pET28a-R tgcggccgcaagcttgt KpADH-F acaagcttgcggccgcaATGAGTGTGCTGATTATGCAG KpADH-R tggtggtggtgctcgagTCACACGCGACCTTCTTTATGCAG K-C165F-F GCCTATGAAAATGTTTTTACCGCCTATtttGCAAGCAAAACCTTTGCAG K-C165F-R CCATTGCACAGCAGGCGCTGATTAATCAGTTC K-V231D-F GCTGCATGCACCGTTTGATACCAAAgatGAAAAAACCCATTTTAGCCAG K-V231D-R CACACGCGACCTTCTTTATGCAGAATCTGGTAAACGGTATCATG

[0028] Example 2: Culture of alcohol dehydrogenase mutant

[0029] Transformed BL21 cells were seeded into Terrific Broth (TB) medium containing 50 μg / mL kanamycin and cultured at 37 ℃ and 220 rpm in a shaker. The optical density (OD) at 600 nm was measured at mid-log phase. 600 The concentration was 0.6-0.8. At this point, protein expression was induced by adding isopropyl-β-D-1-thiogalactoside (IPTG) to the culture medium to a final concentration of 0.2 mM. The cells were then continuously shaken at 25 °C for 16 hours to promote soluble expression of the target protein and reduce inclusion body formation. After induction, cells were collected by centrifugation.

[0030] Example 3: Catalytic effect of mutant on syringaldehyde

[0031] Syringaldehyde (20 mM), glucose (40 mM), NADPH (0.002 mM), and wet cells containing the C165F mutant, V231D mutant, C165F-V231D mutant, and wild-type wet cells (0.05 g / mL) of alcohol dehydrogenase were mixed in phosphate buffer (pH 7.0) and subjected to bioreduction at 30 °C. The yields of single mutants C165F and V231D were 87.5% and 89.9%, respectively, while the double mutant C165F-V231D achieved a yield of 92.1%, which was 1.62 times higher than that of the wild-type enzyme (yield of 57.0%).

[0032] Although the present invention has been described in detail with reference to preferred embodiments, it is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and all such modifications or substitutions should be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the protection scope of the present invention. Therefore, the protection scope of the present invention should be determined by the scope of the claims.

Claims

1. An alcohol dehydrogenase mutant, characterized in that, The mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1, and the mutation is one or more of the following: (1) Mutate cysteine ​​at position 165 to phenylalanine; (2) Mutate valine at position 231 to aspartic acid.

2. The alcohol dehydrogenase mutant according to claim 1, characterized in that, The amino acid sequences of the alcohol dehydrogenase mutants are shown in SEQ ID NO.2~4.

3. A gene encoding a gene, characterized in that, The encoding gene encodes the alcohol dehydrogenase mutant as described in claim 1 or 2.

4. The encoding gene according to claim 3, characterized in that, The nucleotide sequence of the alcohol dehydrogenase mutant according to claim 2 is shown in SEQ ID NO. 6-8.

5. A recombinant vector, characterized in that, It includes the coding gene as described in claim 3 or 4.

6. An expression strain, characterized in that, It contains the coding gene as described in claim 3 or 4, or the recombinant vector as described in claim 5.

7. The application of an alcohol dehydrogenase in the enzymatic synthesis of eugenol from eugenol by eugenol, characterized in that, The amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO.1~4.

8. The application according to claim 7, characterized in that, The alcohol dehydrogenase in the enzyme catalytic system was added in whole-cell form of the expression strain.

9. The application according to claim 7, characterized in that, The enzyme catalytic system also includes syringaldehyde, glucose, and NADPH; wherein the concentration of syringaldehyde is 20 mM and the concentration of the whole cells of the expression strain is 0.05 g / mL.

10. The application according to claim 9, characterized in that, The molar ratio of eugenol, glucose, and NADPH is 20:40:0.002.

Images