Gossypol specific nucleic acid aptamer as well as preparation method and application thereof

Abstract

The invention provides a gossypol specific nucleic acid aptamer as well as a preparation method and application thereof. The nucleotide sequence of the aptamer is shown as SEQ ID NO. 1. A Capture-SELEX technology is adopted, a screening system is optimized, high-throughput sequencing and DNAMAN homology and secondary structure analysis are combined, the gossypol specific nucleic acid aptamer is obtained, ThT fluorescence determination and ITC verification show that the aptamer still keeps high affinity after truncation, and the gossypol specific nucleic acid aptamer can be used for preparing the gossypol specific nucleic acid aptamer. Molecular docking further defines that key basic groups such as G-26, C-27, G-28 and G-46 form a hydrogen bond-hydrophobic effect with gossypol, and a foundation is laid for construction of a subsequent gossypol rapid detection system.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a gossypol-specific nucleic acid aptamer, its preparation method, and its application. Background Technology

[0002] Gossypol is a naturally occurring naphthalene aldehyde polyphenol compound found in cottonseed, a plant belonging to the Malvaceae family and the genus Gossypium. The active aldehyde and hydroxyl groups in its molecular structure are both the core of its chemical properties and the source of its strong biotoxicity. Cottonseed oil is one of my country's important vegetable oil varieties, and gossypol from the raw material cottonseed remains in the finished oil during the oil extraction process. Because cottonseed oil contains proteins, fatty acids, and pigments, gossypol easily binds with trace amounts of protein in the oil to form bound gossypol. Simultaneously, some free gossypol dissolves in the oil, forming a complex system of "free and bound states coexisting." Long-term intake of cottonseed oil with excessive gossypol can lead to damage to organs such as the heart, liver, and kidneys, and in severe cases, cause reproductive system dysfunction, posing a significant threat to edible oil safety. my country's national food safety standard for vegetable oils (GB2716-2018) clearly stipulates a limit of ≤200 mg / kg for gossypol. However, in actual production and distribution, due to the lack of efficient detection methods, products exceeding the limit are still frequently detected, highlighting the urgent need for specialized testing technology for gossypol in cottonseed oil. In particular, the products of small processing enterprises lack rapid testing methods, making it difficult to achieve real-time quality control before leaving the factory; grassroots regulatory departments are also unable to carry out efficient screening in the circulation process due to the limitations of existing testing technologies, resulting in the inflow of risky oil products into the market, highlighting the urgent need for specialized testing technology for gossypol in cottonseed oil.

[0003] The three main detection techniques for gossypol currently are high-performance liquid chromatography (HPLC), simplified chemical methods, and immunoassay, but all of them have unavoidable limitations: While high performance liquid chromatography (HPLC) can provide accurate quantification, it relies on complex sample pretreatment (1-2 hours per sample) and requires specialized instruments and personnel, which cannot meet the needs of on-site real-time detection. The simplified chemical method is easy to operate, but the detection accuracy is extremely low and it is difficult to achieve accurate quantitative standards. Even if the gossypol removal is completed, other methods are still needed to verify the effect, which further increases the complexity and cost of the process. Immunoassay, with its advantage of specific antigen-antibody binding, is an ideal choice for initial screening of batches of samples. However, it is limited by antibody defects—the preparation cycle is as long as 2-3 months, the stability at 4°C is only 6 months, it is prone to cross-reaction with structural analogs, and the long-term use is costly, making it difficult to balance the stability and economy of the test results.

[0004] To overcome the bottlenecks of existing technologies, finding novel molecular recognition elements to replace antibodies has become crucial, and nucleic acid aptamers (single-chain oligonucleotides known as "chemical antibodies") offer an ideal solution. They are obtained through systematic evolution of ligands using exponential enrichment (SELEX) screening, possessing target-specific binding capabilities comparable to antibodies, but also offering advantages unmatched by antibodies: they can recognize multiple targets such as proteins, small molecules, and cells; they are chemically stable and resistant to denaturation; they support modification with various functional groups such as fluorescein and nanomaterials; they can be chemically synthesized in large quantities at only 1 / 10 the cost of antibodies, and they are non-immunogenic. However, conventional SELEX screening for gossypol still faces two major bottlenecks: first, gossypol, as a small molecule target (molecular weight 518 Da), easily masks active aldehyde / hydroxyl sites when directly immobilized, preventing screened aptamers from recognizing native gossypol; second, proteins and fatty acids in the cottonseed oil matrix readily bind non-specifically to library sequences, reducing the efficiency of specific sequence enrichment. To date, no research reports on specific nucleic acid aptamers for gossypol have been published domestically or internationally. Summary of the Invention

[0005] In view of this, the present invention aims to propose a gossypol-specific nucleic acid aptamer, its preparation method and application, and to screen nucleic acid aptamers that can specifically recognize gossypol by using Capture-SELEX technology, thereby constructing a rapid detection system based on aptamers.

[0006] To achieve the above objectives, the technical solution of the present invention is implemented as follows: In a first aspect, the present invention provides a gossypol-specific nucleic acid aptamer, the nucleotide sequence of which is shown in SEQ ID NO.1 (GCATAGGGAGGTCACACCGATAGTGGCGCAATCTAGTTGGTTAGCGCCCTATGC).

[0007] In a second aspect, the present invention provides a method for screening gossypol-specific nucleic acid aptamers as described in the first aspect, the screening method comprising the following steps: S1. Design the initial library, mix the initial library with the capture strand, and use a PCR instrument to perform renaturation treatment on the mixed mixture to obtain ssDNA-Capture. S2. Mix ssDNA-Capture with streptavidin magnetic beads, incubate, separate the magnetic beads, perform library positive screening, and obtain positive screening solution. S3. Perform PCR amplification, centrifugation, denaturation, concentration, and dialysis on the positive screening solution, and use the collected single-stranded library as a secondary nucleic acid aptamer library. S4. Repeat steps S1-S3 for 14 rounds of screening, and perform high-throughput sequencing analysis on the single-stranded libraries obtained from the screening to obtain the gossypol-specific nucleic acid aptamer.

[0008] Further, in step S1, the nucleotide sequence of the initial library is as shown in SEQ ID NO.2 (ATTGGCACTCCACGCATAGG-N40-CCTATGCGTGCTACCGTGAA); The nucleotide sequence of the capture chain is shown in SEQ ID NO.3 (CCTATGCGTGGAGTGCCAAT-C3 Spacer-biotin).

[0009] Further, in step S1, the PCR instrument program during the renaturation treatment is as follows: 95℃, 10min; 60℃, 5min; 25℃, 30min; 4℃, forever, with a cooling rate of 0.1℃ / s.

[0010] Furthermore, step S2 also includes a step of blocking non-specific binding sites on the surface of the separation magnetic beads before library positive screening: herring sperm DNA, Mg... 2+ After mixing the solution and screening buffer, add the magnetic beads and incubate with shaking at room temperature. Preferably, the screening buffer is a phosphate buffer containing dimethyl sulfoxide, and the screening buffer does not contain Ca. 2+ Mg 2+ More preferably, the concentration of dimethyl sulfoxide in the screening buffer is 2%.

[0011] Furthermore, step S2 also includes a reverse screening step before positive screening of the library: incubating with magnetic beads at room temperature using screening buffer and / or gossypol acetate with shaking. Preferably, reverse screening is performed in rounds 1, 2-6, 9, and 12; more preferably, reverse screening is performed using screening buffer in round 1, and reverse screening is performed using gossypol acetate in rounds 2-6, 9, and 12. Preferably, the positive sieving method includes the following steps: mixing gossypol with magnetic beads and incubating with shaking at room temperature.

[0012] Further, in step S3, the primers used for PCR amplification include a forward PCR primer and a reverse PCR primer. The nucleotide sequence of the forward PCR primer is shown in SEQ ID NO.4 (FAM-ATTGGCACTCCACGCATAGG), and the nucleotide sequence of the reverse PCR primer is shown in SEQ ID NO.5 ((15A)-Spacer 18-TTCACGGTAGCACGCATAGG). Preferably, in step S3, the PCR instrument program during PCR amplification is: 95℃, 2min; 95℃, 30s; 60℃, 30s; 72℃, 30s; cycle; 72℃, 1min; 4℃, forever, where the number of cycles = Ct value of the positive sieve solution + 7.

[0013] Furthermore, in step S3, the centrifugation method includes the following steps: mixing the PCR amplification product with ultrapure water and n-butanol, and centrifuging; Preferably, in step S3, the method for depolymerization is to use 8% urea denaturing gel electrophoresis; Preferably, in step S3, the concentration method includes the following steps: mixing the depolymerization product with n-butanol, separating the layers, and removing the supernatant.

[0014] Thirdly, the present invention provides a kit for detecting gossypol, the kit comprising a nucleic acid aptamer as described in the first aspect or a nucleic acid aptamer obtained by the screening method described in the second aspect.

[0015] Fourthly, the present invention provides a biosensor, the biosensor comprising a nucleic acid aptamer as described in the first aspect or a nucleic acid aptamer obtained by the screening method described in the second aspect.

[0016] Fifthly, the present invention provides the application of nucleic acid aptamers as described in the first aspect or nucleic acid aptamers obtained by the screening method as described in the second aspect in the detection of gossypol.

[0017] Furthermore, the application is in the preparation of sensors, probes, test strips or kits for detecting gossypol.

[0018] Furthermore, the application is the detection of gossypol in food, feed, and pharmaceuticals.

[0019] In a sixth aspect, the present invention provides a method for detecting gossypol, which utilizes a nucleic acid aptamer as described in the first aspect, a nucleic acid aptamer obtained by the screening method as described in the second aspect, a reagent kit as described in the third aspect, or a biosensor as described in the fourth aspect.

[0020] Compared with existing technologies, the gossypol-specific nucleic acid aptamer, its preparation method, and its application described in this invention have the following advantages: This invention employs Capture-SELEX technology, combining an optimized screening system with high-throughput sequencing and DNAMAN homology and secondary structure analysis to obtain gossypol-specific nucleic acid aptamers. ThT fluorescence assay and ITC verification showed that the aptamer maintains high affinity even after truncation. Molecular docking further clarified that it forms hydrogen bonds with gossypol through key bases such as G-26, C-27, G-28, and G-46, creating a hydrophobic interaction that lays the foundation for the subsequent construction of a rapid gossypol detection system. Attached Figure Description

[0021] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings: Figure 1 A schematic diagram illustrating the principle of the method for screening gossypol-specific nucleic acid aptamers; Figure 2 A schematic diagram of the library design and target structure; Figure 3 The absorbance-concentration curve of gossypol is shown, with DPBS containing 2% DMSO as the solvent. Figure 4 Schematic diagram of PCR annealing temperature optimization results; Figure 5 This is a schematic diagram illustrating the effects of targets and organic reagents on PCR amplification. Figure 6 The results show the progress monitoring of the first round of screening. The left figure shows the Ct values ​​of each elution buffer, the middle figure shows the qPCR amplification curve, and the right figure shows the qPCR melting curve. Figure 7 The results show the progress monitoring of screening rounds 2-6, where a and e represent rounds 2-6 respectively. The left figure for each round shows the Ct value of each elution buffer, the middle figure shows the qPCR amplification curve, and the right figure shows the qPCR melting curve. Figure 8 The results show the progress monitoring of screening rounds 7-10, where ad represents rounds 7-10 respectively. The left figure for each round shows the Ct value of each elution buffer, the middle figure shows the qPCR amplification curve, and the right figure shows the qPCR melting curve. Figure 9 The results show the progress monitoring of screening rounds 11-14, where ad represents rounds 11-14 respectively. The left figure for each round shows the Ct value of each elution buffer, the middle figure shows the qPCR amplification curve, and the right figure shows the qPCR melting curve. Figure 10 A diagram illustrating the changes in library retention rate throughout the screening process; Figure 11 This is a schematic diagram of sequencing results and sequence alignment, where identical sequences are marked with the same color. Figure 12 This is the result of DNAMAN multiple sequence alignment; Figure 13 This is a schematic diagram of a sequence evolutionary tree; Figure 14 A schematic diagram of the secondary structure classification results for candidate sequences; Figure 15-19The diagram shows the results of affinity analysis for different aptamers, where (a) is a schematic diagram of the secondary structure of the aptamer, (b) is the fluorescence emission spectrum of the ThT and aptamer mixture in the presence of different concentrations of gossypol, and (c) is the ThT fluorescence titration response curve of gossypol to the aptamer. Figure 20 The diagram shows the results of the APTL1-14-1 affinity analysis, where (a) is a schematic diagram of the secondary structure of APTL1-14-1, (b) is the fluorescence emission spectrum of the mixed system of ThT and APTL1-14-1 in the presence of different concentrations of gossypol, and (c) is the ThT fluorescence titration response curve of gossypol to APTL1-14-1. Figure 21 The results of ITC determination are for APTL1-14-1. Figure 22 This is a schematic diagram showing the docking results of APTL1-14-1 with gossypol molecules. Detailed Implementation

[0022] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0023] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0024] Example

[0025] like Figure 1 As shown, the method for screening gossypol-specific nucleic acid aptamers in this embodiment includes the following steps: (1) Library design The initial library ssDNA length was 80 nt, as shown in Table 1 and Figure 2 As shown in (a), it consists of three parts: the middle part consists of 40 random bases, sufficient to provide an effective binding motif; one side of the 5' end is the forward primer region (20 nt) required for PCR amplification, providing the function of complementary hybridization with the capture strand; one side of the 3' end is the reverse primer region (20 nt) required for PCR amplification. The 3' end of the capture strand is modified with biotin, which can be used to fix the library through biotin-avidin interaction. In this embodiment, gossypol was selected as the screening model, and gossypol acetate, which has a similar structure, was selected as the reverse screening molecule. The chemical structures of gossypol and gossypol acetate are as follows: Figure 2 (b) and Figure 2 As shown in (c).

[0026] Table 1 Nucleotide sequence list

[0027] (2) Oligonucleotide pretreatment Before opening all oligonucleotides, centrifuge at 8000 rpm for 10 min using a high-speed centrifuge. Carefully open the tube caps, add an appropriate amount of screening buffer as needed for the required concentration, and then mix thoroughly on a micro vortex mixer to dissolve. Finally, centrifuge and anneal (95℃, 5 min → room temperature). Store the treated oligonucleotides at -20℃.

[0028] (3) Determination of the content of organic reagents Gossypol has a solubility of less than 10 mg / L and cannot be directly dissolved in phosphate-buffered saline (DPBS). An organic solvent must be added to the buffer as a co-solvent to ensure that gossypol is soluble in the screening buffer and does not precipitate during the screening process. Based on the principle of "like dissolves like," dimethyl sulfoxide (DMSO) was selected as the co-solvent in this invention. First, 100 μm target molecules were dissolved in DPBS with different organic reagent concentrations. The dissolution of gossypol was observed visually in 200 mL centrifuge tubes. Based on the visual judgment, DPBS containing 2% DMSO was selected, and a series of gossypol solutions of different concentrations (30 μM, 60 μM, 125 μM, 250 μM) were designed. The absorbance values ​​of the solutions were further measured using a UV spectrophotometer, and each experiment was performed in triplicate.

[0029] According to Beer-Lambert law, molecular concentration is positively correlated with absorbance; the relationship between the concentration and absorbance of a completely dissolved small molecule solution should also obey this law. Tests have shown that... Figure 3 As shown, this invention selects DPBS containing 2% DMSO as the screening buffer. The relationship between the prepared series of gossypol solutions and their absorbance is as follows. Figure 3 As shown. According to the fitting results, the concentration of gossypol solution has a high linear correlation with absorbance. The gossypol sample with a concentration as high as 250 μM did not deviate from the standard curve. Therefore, the solvent DPBS containing 2% DMSO can ensure that 100 μM gossypol does not precipitate during the screening process and can be used as the screening buffer of this invention.

[0030] The main solvent used in this embodiment is configured as follows: Screening Buffer (Buffer I): Phosphate-buffered saline (DPBS) without Ca 2+ Mg 2+ The pH value is 7.4±0.1. Add 1 mL of dimethyl sulfoxide (DMSO) to DPBS, bring the volume to 50 mL with DPBS, and store at 4 °C.

[0031] Washing buffer (Buffer II): Add 100 μL of Tween20 to DPBS, bring the volume up to 50 mL with DPBS, and store at 4 °C.

[0032] (4) Library hybridization incubation In each round of screening, the libraries and capture strands at each stage were mixed thoroughly. The mixture was then subjected to renaturation treatment using the following PCR program: 95℃, 10 min; 60℃, 5 min; 25℃, 30 min; 4℃, forever; cooling rate 0.1℃ / s. The A260 value of the ssDNA-Capture was then recorded using a microplate reader and denoted as C1. The entire renaturation process was performed on the PCR instrument using a set cooling program to obtain the hybrid (ssDNA-Capture) formed by the library and capture strand. In the first round of screening, 32.5 µL of 100 µM capture strand was added to 130 µL of 5 µM primary library. In rounds 2 to 9, the library volume was 45 µL and the capture strand volume was 5 µL of 100 µM. In rounds 10 to 14, the library volume was 25 µL and the capture strand volume was 3 µL of 100 µM.

[0033] (5) Coupling of streptavidin magnetic beads with library In the first round, mix the magnetic beads thoroughly by inverting them. Add 200µL of streptavidin magnetic beads (with a biotin binding concentration of 500 pm / mg) to a centrifuge tube, place it on a magnetic rack, and wait for the solution to clarify before discarding the protective solution. Wash the streptavidin magnetic beads 3-4 times with 5 times the volume of washing buffer, and then wash them 3-4 times with 5 times the volume of selection buffer. Temporarily store the magnetic beads in 200µL of selection buffer for later use. Add all of the ssDNA-Capture solution to the washed magnetic beads and mix well. Incubate at room temperature for 50 minutes using a rotary mixer. Use a magnetic rack to separate the magnetic beads and record the A260 value of the supernatant using a multi-microplate reader for cell imaging, denoted as C2. If C2 / C1 > 0.30, it indicates that the library is not sufficiently fixed, and the incubation time needs to be extended to 70 minutes. Detect the A260 value after 70 minutes of incubation, denoted as C3. The C3 / C1 ratio was used to determine whether the magnetic beads had successfully immobilized the ssDNA library. The amount of magnetic beads used was 40 µL in rounds 2 to 9, and 20 µL in rounds 10 to 14.

[0034] (6) Non-specific binding sites on the surface of pre-sealed magnetic beads Take 4 µL of 10 mg / mL herring sperm DNA (HsDNA) and 2 µL of 500 mM Mg 2+ Add to 194 µL of selection buffer (maintaining a final herring sperm DNA concentration of 0.2 mg / mL, Mg...) 2+ (Final concentration: 5 mM). Add to centrifuge tube containing magnetic beads, mix well by pipetting, and incubate at room temperature for 1 hour.

[0035] (7) Cleaning of the library Use a magnetic rack to separate the magnetic beads, aspirate the supernatant (retain the sample for qPCR detection, denoted as supernatant-pool), take 200 μL of selection buffer (400 μL selection buffer for the first round) and add it to the magnetic beads to suspend them, then transfer to a new centrifuge tube and let stand for 2 min. Use a magnetic rack to separate the magnetic beads again, denoting the supernatant as wash1. Repeat this step 3 times to obtain wash2, wash3, and wash4 respectively.

[0036] (8) Document back-screening In the first round, a blank reverse screening was performed for 20 minutes using 400 µL of screening buffer to remove self-hybridized sequences, which can cause false positives during the screening process. From rounds 2 to 6, 9, and 12, reverse screening was performed using 200 µL of 100 µM gossypol acetate (the hydroxyl groups of gossypol are replaced with acetate groups, effectively excluding non-specific aptamers that recognize the hydroxyl groups of gossypol). The solution was added to magnetic beads and incubated at room temperature in a rotary shaker for 20 minutes. The beads were then separated using a magnetic rack, and the supernatant was recorded as the reverse screening solution. The magnetic rack was removed, and 200 µL of screening buffer was added to a centrifuge tube. The magnetic beads were gently resuspended, transferred to a new 1.5 mL centrifuge tube, and allowed to stand for 2 minutes. The beads were then separated using a magnetic rack, and the supernatant was recorded as wash6. Gossypol was promptly added for positive screening to prevent the magnetic beads from drying out and becoming inactive.

[0037] (9) Library positive screening Using 100µM gossypol for positive sieving, add 200µL of gossypol to the magnetic beads, mix well, and incubate at room temperature with shaking for 45 min. Use a magnetic rack to lift the magnetic beads, transfer the supernatant to a new centrifuge tube, wash the magnetic beads once with 100µL of sieving buffer, lift the magnetic beads again with a magnetic rack, and add the supernatant to the same centrifuge tube, which is called the positive sieving solution.

[0038] (10) Screening endpoint monitoring Dissolve the QPCR mix slowly at low temperature (4~20℃) (add 5μL of 100μM forward primer and 5μL of 100μM reverse primer to a 900μL system, with a final primer concentration of approximately 0.56μM), and centrifuge at 5000rpm for 30s. Add 18μL of QPCR mix and 2μL each of the supernatant-pool, forward screening solution, reverse screening solution, and wash1-4 or wash6 sample to each well of an eight-tube real-time PCR tube. The negative control consists of 18μL of QPCR mix and 2μL of screening buffer. After capping the tubes, centrifuge the samples briefly and record the Ct values ​​using a real-time PCR instrument. Set the PCR program to: 95℃, 2min; 95℃, 30s; 60℃, 30s; 72℃, 30s; 40 cycles. Based on the Ct values ​​of the supernatant-pool, forward screening solution, reverse screening solution, wash1-4, and wash6 samples, the library washing and forward / reverse screening results for that round can be determined. Based on the Ct values ​​of the forward and reverse sieve solutions, according to the formula P=(C 样品 V 正筛 The enrichment degree for each round of screening is calculated as ) / m, where C 样品 V represents the concentration of the target template in the eluent from the positive sieve (unit: nM). 正筛 is the total volume of the positive sieve eluent (unit: μL), and m is the initial amount of library added (unit: nmol).

[0039] like Figure 6 As shown, in the first round of screening, after blank reverse screening, more template sequences were collected from the supernatant than from wash4, proving that some self-hybridization sequences were removed after blank reverse screening. Subsequently, the target molecule gossypol was added for further positive screening, and the enrichment degree was calculated using Ct values.

[0040] like Figure 7 As shown, during the second to sixth rounds of screening, the eluted DNA concentration in each round decreased systematically with the increase of elution times, demonstrating the effectiveness of the elution. The elution efficiency could also be judged based on the difference in Ct values ​​after each elution. Analysis of the qPCR amplification curves of the reverse screening solution revealed that the Ct values ​​did not increase as expected with each round, but rather decreased, indicating that the strong binding sequence of gossypol acetate was also being enriched. Simultaneously, analysis of the qPCR amplification curves of the positive screening solution from the second to sixth rounds showed that the Ct values ​​of the positive screening solution decreased with each round, consistent with expectations, indicating that the strong binding sequence of the target molecule gossypol had been gradually enriched, allowing for continued screening.

[0041] like Figure 8As shown, during rounds 7-10 of screening, the decrease in Ct value in round 7 compared to the positive screening solution in round 6 indicates that a further enriched library was obtained. While the Ct values ​​of the reverse screening solutions fluctuated in rounds 7-10, they gradually leveled off, indicating that the sequences binding to the non-target molecule gossypol acetate were no longer enriched as in rounds 2-5. However, differences in the Ct values ​​of the positive screening solutions still existed between rounds, necessitating continued screening.

[0042] like Figure 9 As shown, during rounds 11-14 of screening, the Ct value of the positive screening solution in round 11 continued to decrease compared to the Ct value of the positive screening solution in round 10, indicating that the library was still being enriched. From rounds 11 to 14, the Ct value of the reverse screening solution no longer decreased, indicating that the sequence binding to the non-target molecule gossypol acetate was no longer enriched. At this point, the difference in Ct values ​​between each round of positive screening was very small, and after the reverse screening was repeated in round 14, the Ct value of the positive screening solution only showed slight fluctuations. It was decided to determine the endpoint by comparing retention rates.

[0043] like Figure 10 As shown, the retention rates from round 2 to round 14 were calculated using the Ct values ​​of the forward screening solution for comparison. Starting from round 11, the library retention rate no longer increased significantly, and even in round 14, the addition of a dephenolized cottonseed oil matrix for reverse screening only resulted in a slight decrease. In conclusion, the inventors believe that after 14 rounds, the endpoint for gossypol nucleic acid aptamer screening has been reached, and further action should be taken.

[0044] (11) PCR amplification Dissolve the PCR mix slowly at low temperature (4~20℃) (add 5μL of 100μM forward primer and 5μL of 100μM reverse primer to a 900μL system, with a final primer concentration of approximately 0.56μM), and centrifuge at 5000rpm for 30s. Add 18μL of PCR mix and 2μL of positive screening solution to each well of an eight-tube PCR system. PCR program settings: 95℃, 2min; 95℃, 30s; 60℃, 30s; 72℃, 30s; cycles, cycle number = positive screening solution Ct value + 7; 72℃, 1min; 4℃, forever.

[0045] The inventors experimentally verified the optimal PCR annealing temperature: using the built-in program of a PCR thermal cycler, 12 annealing temperatures were generated within the temperature range of 55℃ to 65℃. Maintaining other conditions identically, 15 rounds of PCR amplification were performed, and the results were finally characterized using 2.5% agarose gel electrophoresis. Figure 4As shown, after the same PCR amplification, different PCR annealing temperatures lead to different PCR amplification efficiencies. The optimal annealing temperature can be directly determined from the band intensity; it should be between 61.0℃ and 59.3℃. Therefore, 60℃ was used as the PCR annealing temperature in the subsequent screening process.

[0046] The inventors also experimentally verified that gossypol and DMSO did not adversely affect the PCR amplification reaction: At the optimal annealing temperature of 60℃, while keeping other conditions the same, the content of the target and organic reagents was varied, and 15 rounds of PCR amplification were performed. Finally, the results were characterized using 2.5% agarose gel electrophoresis. Figure 5 As shown, the agarose gel electrophoresis results indicate that the presence of gossypol and DMSO has almost no effect on PCR amplification efficiency.

[0047] (12) Single chain preparation (12-1) Concentrated PCR product with n-butanol Collect the PCR product and add 100-200 μL of ultrapure water and 5.5 times the total volume of n-butanol. Cap the tube and invert it approximately 10 times to mix thoroughly. Centrifuge at 7500 rpm for 10 min. After centrifugation, the solution should become clear and separate into layers (if the solution is not clear, centrifuge for another 5-10 min). Discard the supernatant and the oily middle layer, and collect the lower layer of product in a 1.5 mL centrifuge tube. Freeze 5 μL of the product at -80℃ for later use; use the remaining product for the next step.

[0048] (12-2) Preparation of 8% denaturing nucleic acid gel Weigh 2.52g of urea and dissolve it completely in a mixture of 1.2mL of 5×TBE and 1.6mL of 30% Acr-Bis. Then, bring the volume to 6mL with ultrapure water, add 75μL of 10% APS and 4μL of TEMED, and immediately pour the mixed gel solution into a cleaned and prepared 0.75mm gel casting plate. Insert a comb and place it in a 37℃ constant temperature incubator to solidify, obtaining an 8% denatured nucleic acid gel.

[0049] (12-3) Pre-electrophoresis and sample loading Pre-electrophoresis was performed on an 8% denaturing nucleic acid gel at a constant voltage of 300V for 20-30 minutes. After electrophoresis, the urea precipitate in the sample wells was gently dispersed using a 1mL pipette. During pre-electrophoresis, an equal volume of 2×TBE urea loading buffer was added to the concentrated PCR product sample obtained in step (12-1), heated in a boiling water bath for 15 minutes, centrifuged, and immediately loaded onto the large wells while still hot. 1.5μL of fluorescent single-stranded DNA molecular weight standard was added to the small wells, and the sample was heated at 300V for approximately 30-40 minutes to denature and separate the target band.

[0050] (12-4) Rubber cutting and recycling After electrophoresis, under handheld or projected UV light, the gel was placed on a clean EP glove, and the target band was cut with a clean blade. The target band was placed into a 0.5 mL gel fragmentation tube, which was then transferred to a 2 mL centrifuge tube. The tube was centrifuged at 12000 rpm for 2 min, and all fragments were collected at the bottom of the centrifuge tube. The fragmentation tube was discarded, and 1 mL of DPBS was added to the centrifuge tube. The tube was boiled in water for 10 min, followed by centrifugation at 12000 rpm for 1 min. The supernatant was collected into a 50 mL centrifuge tube, and another 1 mL of DPBS was added to the fragmented gel. The boiling process was repeated, and all the resulting single-chain solutions were transferred to the same centrifuge tube.

[0051] (12-5) Concentrate ssDNA with n-butanol Add n-butanol to a 50mL centrifuge tube containing the single-chain solution at 5.5 times the volume of the original solution. Invert the tube and observe the liquid state. If the liquid is completely clear, too much n-butanol has been added, and 50-100μL of DPBS needs to be added. Centrifuge at 7500rpm for 5 minutes. A clear solution with separate layers will appear. If the upper layer is turbid, the centrifugation time can be extended appropriately. Aspirate the supernatant and transfer the lower layer to a 2mL centrifuge tube.

[0052] (12-6) ssDNA desalting Rinse the dialysis membrane with ultrapure water. Add the solution obtained in step (12-5) to the microdialysis apparatus and symmetrically cover the container opening with the dialysis membrane. Then, place the dialysis apparatus in 40 mL of screening buffer, ensuring that the dialysis membrane is as perpendicular as possible to the liquid surface and submerged in the liquid. Dialyze overnight at 4°C. The next day, remove the dialysis apparatus and collect the dialyzed ssDNA. Record the A260 data of the obtained library using a multi-mode microplate reader for the next round of screening. Store the remaining single strands at -20°C or -80°C.

[0053] (13) High-throughput sequencing High-throughput sequencing of the libraries from rounds 12 and 14 was performed using the Illumina MiSeq platform.

[0054] (13-1) Sequence Analysis and Selection The top 20 sequences with the most sequencing reads in the 12th round library are shown in Table 2, and the top 20 sequences with the most sequencing reads in the 14th round library are shown in Table 3. The table shows the sequencing results of the middle 40 random bases of the candidate aptamer sequence. The same forward primer region 5'ATTGGCACTCCACGCATAGG3' and reverse primer region 5'CCTATGCGTGCTACCGTGAA3' are not shown. The complete nucleic acid aptamer sequence is forward primer region - sequencing result - reverse primer region.

[0055] Table 2. High-throughput sequencing results of the 12th round of libraries.

[0056] Table 3. High-throughput sequencing results of the 14th round of libraries.

[0057] (13-2) Enrichment Analysis Nucleic acid aptamer screening is a process of continuously enriching sequences with high affinity. Theoretically, sequences with high affinity will achieve higher enrichment folds and a higher number of sequencing reads. Therefore, the degree of sequence enrichment and the number of sequencing reads are important criteria for selecting candidate aptamer sequences. The sequences with the highest number of sequencing reads in rounds 12 and 14 were compared and analyzed. Identical sequences were marked with the same color. The results are shown below. Figure 12 As shown.

[0058] according to Figure 10 The sequence alignment results, as shown in the figure, indicate that candidate sequences APTL1-14-1, APTL1-14-2, APTL1-14-3, APTL1-14-4, APTL1-14-5, APTL1-14-6, APTL1-14-7, APTL1-14-9, APTL1-14-10, APTL1-14-11, APTL1-14-12, APTL1-14-13, APTL1-14-14, and APTL1-14-20 all showed repeat enrichment, suggesting these sequences may be potential high-quality nucleic acid aptamers. However, according to the literature, enriched candidate sequences are not necessarily the best nucleic acid aptamers; therefore, we also analyzed these sequences using other methods.

[0059] (13-3) Family homology analysis The results above show that after 14 rounds of screening, the library achieved a certain degree of enrichment. Analysis of these sequences using DNAMAN software yielded the following homology alignment results: Figure 12 As shown, the red highlighted bases represent fully conserved repetitive sequences, while the blue highlighted bases represent partially conserved repetitive sequences. The homology among these sequences with high sequencing counts is clearly visible. Subsequently, a sequence phylogenetic tree was automatically generated using DNAMAN software, as shown below. Figure 13As shown, higher numbers at the nodes indicate higher family homology between sequences. Therefore, based on the multiple sequence alignment results from DNAMAN software, the sequences with the highest sequencing counts were divided into four families: Family 1 includes APTL1-14-1 and APTL1-14-9; Family 2 includes APTL1-14-2, APTL1-14-4, APTL1-14-7, APTL1-14-10, APTL1-14-3, APTL1-14-5, APTL1-14-6, and APTL1-14-13; Family 3 includes APTL1-14-16, APTL1-14-20, APTL1-14-14, APTL1-14-15, APTL1-14-11, and APTL1-14-12; and Family 4 includes APTL1-14-8, APTL1-14-17, APTL1-14-18, and APTL1-14-19.

[0060] (13-4) Secondary structure classification The online software DNAMAN was used to predict and analyze the secondary structure and Gibbs free energy of sequences with a large number of sequencing entries. The results are as follows: Figure 14 As shown. These sequencing entries, with their top 20 positions, share similar ΔG values, and structurally, all these candidate sequences contain the same polybasic complementary main stem and different flanking loops. Therefore, they are classified according to the different flanking loops: the first category, long flanking stems + multi-branched loops, includes APTL1-14-1, APTL1-14-5, APTL1-14-13, APTL1-14-19, and APTL1-14-20; the second category, short flanking stems + single large loops, includes APTL1-14-2, APTL1-14-6, APTL1-14-9, and APTL1-14-16; the third category, flanking stems... The sequences with double / nested loops include APTL1-14-3, APTL1-14-4, APTL1-14-7, APTL1-14-10, and APTL1-14-11; the fourth type with multi-branched lateral stems includes APTL1-14-8, APTL1-14-12, APTL1-14-14, APTL1-14-15, and APTL1-14-18; and the fifth type without long lateral stems is APTL1-14-17. Five sequences, APTL1-14-1, APTL1-14-2, APTL1-14-3, APTL1-14-8, and APTL1-14-17, were initially selected. Taking into account various methods such as sequencing count, enrichment analysis, family homology analysis, and secondary structure classification, APTL1-14-1, APTL1-14-2, APTL1-14-3, APTL1-14-8, and APTL1-14-11 were ultimately selected as the first batch of samples for characterization.

[0061] (14) Aptamer affinity analysis (14-1) THT fluorescence determination of the dissociation constant of full-length candidate nucleic acid aptamers The dissociation constants of APTL1-14-1, APTL1-14-2, APTL1-14-3, APTL1-14-8, and APTL1-14-11 were determined using the ThT method, and the secondary structures of the aptamers were predicted using the online software DNAMAN. First, dissolve the aptamer in screening buffer, denature it by heating at 95°C for 5 min, then immediately anneal it by incubating it on ice for 10 min, and return it to room temperature to ensure the formation of a stable secondary structure. Simultaneously, dilute the target with screening buffer to a gradient concentration covering the expected dissociation constant (Kd) by 0.1-10 times. Dilute the THT stock solution to the appropriate working concentration and prepare fresh for use. Then, according to a fixed total system volume, add screening buffer, annealed aptamer, and THT working solution sequentially, incubate at room temperature for 10-15 min to allow THT to fully bind to the aptamer, and then add different concentrations of target, simultaneously setting up a blank control. Control (no target, only buffer, aptamer, and THT) and negative control (no aptamer) were set up in triplicate for each group. After the system was equilibrated, the excitation and emission wavelengths corresponding to THT were set on the fluorescence detection instrument, the detection environment temperature was stabilized, and the fluorescence intensity of each system was measured and the raw data were recorded. Background interference was subtracted using the blank control value. Finally, the relative fluorescence intensity (F / F0, where F is the fluorescence value of the experimental group and F0 is the fluorescence value without target) at each target concentration was calculated. The dissociation constant (Kd) was obtained by nonlinear fitting with the target concentration as the x-axis and the relative fluorescence intensity as the y-axis, and this constant was used to characterize the affinity between the aptamer and the target.

[0062] The results are as follows Figure 15 As shown in (a)-19(a), Figure 15 (b)-19(b) shows the fluorescence emission spectra of the ThT-aptamer mixture system in the presence of different concentrations of gossypol as an aptamer. Figure 15 (c)-19(c) shows the dissociation constants (Kd) obtained by nonlinear fitting of each aptamer using Graphpad Prism 8. As shown in the figure, the aptamers with the best dissociation constants are APTL1-14-1 and APTL1-14-2, with dissociation constants of 4.505 μM and 2.718 μM, respectively. Considering multiple methods including sequencing count, family homology analysis, and secondary structure classification, APTL1-14-1 was chosen as the target for our truncation optimization.

[0063] (14-2) Determination of the dissociation constant of truncated candidate nucleic acid aptamers The application of nucleic acid aptamers with a length of 80 nt is limited, mainly due to the following reasons: (1) the longer the DNA length, the higher the synthesis and purification costs; (2) excessively long nucleic acid aptamer sequences lead to complex tertiary structures, which adversely affect the sensing process of aptamer sensors; and (3) excessively long nucleic acid aptamer sequences make the chain design process of aptamer sensors difficult. Therefore, shorter nucleic acid aptamers have greater application value.

[0064] The inventors truncated the candidate sequence APTL1-14-1, removing the main stem of APTL1-14-1, resulting in a 54nt truncated APTL1-14-1. The secondary structure after truncation is as follows: Figure 20 As shown in (a), the ThT fluorescence test results of APTL1-14-1 are as follows: Figure 20 (b) and Figure 20 As shown in (c).

[0065] The inventors also conducted ITC measurements on the APTL1-14-1 section: The candidate aptamer sequence solution, target molecule solution, and ultrapure water were degassed in a vacuum pump for at least 90 minutes, with the temperature set to the aptamer-target molecule binding reaction temperature (typically 25℃ or 37℃). Before the experiment, the cleaning kit and vacuum pump were connected, and the sample cell was cleaned sequentially with 100 mL of 1% SDS and at least 1 L of ultrapure water. After degassed the sample and ultrapure water, the injection needle and syringe were rinsed 3-5 times with degassed ultrapure water. Then, the syringe was loaded with degassed ultrapure water and rinsed the reference cell and sample cell 3-5 times. After removing the ultrapure water from the reference cell and sample cell, the injection handle was installed, the computer and software were turned on, and the instrument self-check was completed before removing the injection handle. Slowly inject 300 μL of degassed ultrapure water into the reference cell, and insert the reference needle after cleaning with degassed ultrapure water. Slowly inject 300 μL of degassed nucleic acid sample (candidate aptamer sequence) into the sample cell, and load 50 μL of target molecule (gossypol) sample into the injection needle. Install the injection needle into the injection handle, and finally install the injection handle.

[0066] Set parameters such as stirring rate, reaction temperature, syringe volume, and titration program. Start stirring and monitor heat changes on the monitoring panel. After the heat stabilizes, begin the experiment and collect heat data. The cleaning steps for the sample cell, injection needle, and syringe must be repeated between each sample test, before loading the sample and starting the titration experiment. After the experiment, clean the sample cell with 100 mL of 1% SDS and then with at least 1 L of ultrapure water, removing the reference needle and ultrapure water. Finally, use the ITC's accompanying analysis software to process the experimental data, perform model fitting, and analyze the data.

[0067] The ITC measurement results of APTL1-14-1 are as follows: Figure 21As shown, the dissociation constant of APTL1-14-1 measured by ThT fluorescence assay is 4.359 μM, while the dissociation constant measured by ITC is 5.32 μM. Therefore, APTL1-14-1 is confirmed as the selected gossypol aptamer.

[0068] (14-3) Analysis of molecular docking results of truncated candidate nucleic acid aptamers First, the three-dimensional structure of gossypol was obtained from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ), and energy minimization was performed. The structure was saved as a .pdb file. Secondary structures of the gossypol aptamer were obtained using Mfold (mfold.org). The generated gossypol aptamer secondary structure CT format file was imported into RNAComposer (https: / / rnacomposer.cs.put.poznan.pl / ) to predict its tertiary structure, and energy minimization was performed. The tertiary structure was then saved as a .pdb file. Finally, molecular docking experiments between gossypol and the aptamer were performed using HDOCK (http: / / hdock.phys.hust.edu.cn / ). The docking results are as follows Figure 22 The results show that gossypol molecules mainly bind to the conserved region of the main stem truncated by APTL1-14-1, with C13, G-26, C-27, G-28, and G-46 being the key binding bases. This region is the "main stem-branch loop junction region" in the secondary structure of the aptamer, and is the core functional region of the "long lateral wing stem + multi-branch loop" predicted in the previous secondary structure analysis. The retention of this region during the truncation process is the structural basis for the high affinity maintained by APTL1-14-1 truncated, proving that this region is an "essential structural domain" for the binding of aptamer to gossypol.

[0069] In summary, this invention focuses on the screening and application of gossypol-specific nucleic acid aptamers. Based on Capture-SELEX technology, the screening system was first optimized (DPBS containing 2% DMSO was selected as the screening buffer to solve the problem of poor water solubility of gossypol, and the PCR annealing temperature was optimized to 60℃ to ensure library enrichment efficiency). After 14 rounds of screening (Ct value and retention rate were monitored by qPCR, and the library retention rate tended to stabilize after the 11th round, and the screening endpoint was reached in the 14th round), the libraries in the 12th and 14th rounds were then subjected to high-throughput sequencing. Combined with DNAMAN homology analysis and secondary structure prediction, the candidate sequences were divided into 4 families. Among them, the family to which APTL1-14-1 belongs (including APTL1-14-9) was selected as the core candidate because its secondary structure is "long flanking stem + multi-branched loop" and its Gibbs free energy is stable. The dominant sequence APTL14-1 (ranked highest among 107 sequences in round 14 sequencing) was selected and truncated for optimization, resulting in a 54nt APTL1-14-1 truncated sequence. Verification using ThT fluorescence (Kd=4.359μM) and isothermal calorimetric titration (ITC, Kd=5.32μM) confirmed that it retained its specific binding ability to gossypol. Molecular docking results showed that the APTL1-14-1 truncated sequence binds to gossypol through hydrogen bonds and hydrophobic interactions via C13, G-26, C-27, G-28, and G-46. This successfully yielded a specific nucleic acid aptamer for rapid detection of gossypol in cottonseed oil, cottonseed meal, and other samples, providing technical support for meeting the on-site quality control needs of relevant food safety and feed hygiene standards.

[0070] The embodiments described above are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

Claims

1. A gossypol-specific nucleic acid aptamer, characterized in that: The nucleotide sequence of the aptamer is shown in SEQ ID NO.1 (GCATAGGGAGGTCACACCGATAGTGGCGCAATCTAGTTGGTTAGCGCCCTATGC).

2. The method for screening gossypol-specific nucleic acid aptamers as described in claim 1, characterized in that, The screening method includes the following steps: S1. Design the initial library, mix the initial library with the capture strand, and use a PCR instrument to perform annealing treatment on the mixed mixture to obtain ssDNA-Capture. S2. Mix ssDNA-Capture with streptavidin magnetic beads, incubate, separate the magnetic beads, perform library positive screening, and obtain positive screening solution. S3. Perform PCR amplification, centrifugation, destring, concentration, and dialysis on the positive screening solution, and use the collected single-stranded library as a secondary nucleic acid aptamer library. S4. Repeat steps S1-S3 for 14 rounds of screening, and perform high-throughput sequencing analysis on the single-stranded libraries obtained from the screening to obtain the gossypol-specific nucleic acid aptamer.

3. The screening method according to claim 2, characterized in that: In step S1, the nucleotide sequence of the initial library is shown in SEQ ID NO.2 (ATTGGCACTCCACGCATAGG-N40-CCTATGCGTGCTACCGTGAA); The nucleotide sequence of the capture chain is shown in SEQ ID NO.3 (CCTATGCGTGGAGTGCCAAT-C3 Spacer-biotin).

4. The screening method according to claim 2, characterized in that, In step S1, the PCR instrument program during the renaturation treatment is as follows: 95℃, 10min; 60℃, 5min; 25℃, 30min; 4℃, forever, with a cooling rate of 0.1℃ / s.

5. The screening method according to claim 2, characterized in that, Step S2 also includes a step of blocking non-specific binding sites on the surface of the separation magnetic beads before library positive screening: herring sperm DNA, Mg 2+ After mixing the solution and screening buffer, add the magnetic beads and incubate with shaking at room temperature. Preferably, the screening buffer is a phosphate buffer containing dimethyl sulfoxide, and the screening buffer does not contain Ca. 2+ Mg 2+ More preferably, the concentration of dimethyl sulfoxide in the screening buffer is 2%.

6. The screening method according to claim 2, characterized in that, Step S2 also includes a reverse screening step before positive screening of the library: incubating with magnetic beads at room temperature using screening buffer and / or gossypol acetate with shaking. Preferably, reverse screening is performed in round 1, rounds 2-6, and rounds 9-12; more preferably, reverse screening is performed using screening buffer in round 1, and reverse screening is performed using gossypol acetate in rounds 2-6 and rounds 9-12. Preferably, the positive sieving method includes the following steps: mixing gossypol with magnetic beads and incubating with shaking at room temperature.

7. The screening method according to claim 2, characterized in that, In step S3, the primers used for PCR amplification include a forward PCR primer and a reverse PCR primer. The nucleotide sequence of the forward PCR primer is shown in SEQ ID NO.4 (FAM-ATTGGCACTCCACGCATAGG), and the nucleotide sequence of the reverse PCR primer is shown in SEQ ID NO.5 ((15A)-Spacer 18-TTCACGGTAGCACGCATAGG). Preferably, in step S3, the PCR instrument program during PCR amplification is: 95℃, 2min; 95℃, 30s; 60℃, 30s; 72℃, 30s; cycle; 72℃, 1min; 4℃, forever, where the number of cycles = Ct value of the positive sieve solution + 7.

8. The screening method according to claim 2, characterized in that, In step S3, the centrifugation method includes the following steps: mixing the PCR amplification product with ultrapure water and n-butanol, and centrifuging; Preferably, in step S3, the method for depolymerization is to use 8% urea denaturing gel electrophoresis; Preferably, in step S3, the concentration method includes the following steps: mixing the depolymerization product with n-butanol, separating the layers, and removing the supernatant.

9. A kit for detecting gossypol, characterized in that: The kit includes the nucleic acid aptamer as described in claim 1 or the nucleic acid aptamer obtained by the screening method as described in any one of claims 2-8.

10. The application of the nucleic acid aptamer as described in claim 1 or the nucleic acid aptamer obtained by the screening method as described in any one of claims 2-8 in the detection of gossypol.

Images