Nucleic acid aptamer specifically combined with MMLV as well as preparation method and application of nucleic acid aptamer

By using SELEX technology to screen nucleic acid aptamers that bind to MMLV protein with high affinity, the problem of lack of specific MMLV binding enzymes in existing technologies has been solved, enabling efficient enrichment and detection of MMLV protein and promoting the research and application of MMLV enzymes.

CN122012513APending Publication Date: 2026-05-12THE UNIVERSITY-TOWN HOSPITAL AFFILIATED TO CHONGQING MEDICAL UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202610365200.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-24
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The lack of nucleic acid aptamers in the current technology that can bind to MMLV enzymes efficiently and specifically limits the research and application of MMLV enzymes.

Method used

SELEX technology was used to screen nucleic acid aptamers that specifically bind to MMLV. Through multiple rounds of screening and amplification, nucleic acid aptamers that can bind to MMLV protein with high affinity were prepared and applied to the enrichment, separation and detection of MMLV protein.

Benefits of technology

This technology enables efficient enrichment, separation, and detection of MMLV proteins, enhancing the research and application capabilities of MMLV enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012513A_ABST
    Figure CN122012513A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a nucleic acid aptamer specifically bound with MMLV, and the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO.1 or SEQ ID NO.2; the nucleic acid aptamer capable of being specifically bound with MMLV is obtained through screening on the basis of the SELEX technology, has high affinity for MMLV protein, can be applied to MMLV protein enrichment reagents, MMLV protein separation reagents, MMLV protein detection reagents, test paper and biosensors, and facilitates identification and activity research of the MMLV protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a nucleic acid aptamer that specifically binds to MMLV, its preparation method, and its application. Background Technology

[0002] Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotides obtained through artificial selection. They can bind to target molecules with high affinity and high specificity through their specific three-dimensional spatial structures. Compared with antibodies, they have many outstanding advantages, such as high affinity and high specificity, the ability to distinguish proteins of different conformations; they can be synthesized in vitro and are easy to modify; they have a wide target range, and can screen for corresponding aptamers for ions, small molecules, proteins, or cells; and they have good stability.

[0003] SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is an in vitro method for screening specific nucleic acid aptamers. Classical SELEX typically involves incubation, isolation, and amplification. Since Tuerk et al. first used this technique to screen for specific oligonucleotide ligands that specifically adsorb bacteriophage T4 DNA polymerase and organic dye molecules, SELEX has become an important research method and tool after more than a decade of development.

[0004] MMLV (Moloney Murine Leukemia Virus Reverse Transcriptase) is a crucial tool enzyme in molecular biology. It possesses 5' → 3' DNA polymerase activity and RNase H activity, and is primarily used in RT-PCR, RT-qPCR, cDNA library construction, RNA sequencing, and retroviral lifecycle analysis. MMLV reverse transcriptase is a key molecular tool for converting RNA information into DNA. Its mutants (such as the M-MLV and SuperScript series) significantly enhance performance by removing RNase H activity and improving thermostability, making it an indispensable reagent in gene expression analysis, diagnostics, and biotechnology research. Currently, nucleic acid aptamers are used in many fields; developing nucleic acid aptamers for MMLV can help researchers further explore the applications of MMLV enzymes. Summary of the Invention

[0005] The purpose of this invention is to provide a nucleic acid aptamer that specifically binds to MMLV, thereby aiding in the research and application of MMLV enzymes.

[0006] To achieve the above objectives, the present invention provides a nucleic acid aptamer that specifically binds to MMLV, wherein the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0007] The application of the above-mentioned nucleic acid aptamers that specifically bind to MMLV in the preparation of reagents for enriching MMLV protein.

[0008] The application of the above-mentioned nucleic acid aptamers that specifically bind to MMLV in the preparation of reagents for isolating MMLV protein.

[0009] The above-mentioned nucleic acid aptamers that specifically bind to MMLV are used in the preparation of MMLV protein detection reagents, test strips, and biosensors.

[0010] The method for preparing the above-mentioned nucleic acid aptamers that specifically bind to MMLV includes the following steps: S1. Design and construction of random nucleic acid libraries and primers; S2. The random nucleic acid library is annealed and then incubated with MMLV protein. The binding is screened using Ni-NTA magnetic beads to obtain the MMLV-library complex. S3. The MMLV-library complex obtained after screening is amplified to obtain amplification products. The amplification products are separated into ssDNA using Streptavidin Magpoly Beads. The separated ssDNA is the nucleic acid library for the first round of screening. S4. Repeat steps S2-S3 for a total of 5 or more rounds of screening, using the nucleic acid library obtained in the previous round as the starting library for each operation; after screening, the target nucleic acid aptamer is obtained.

[0011] Compared with the prior art, the present invention has the following advantages: This method is based on nucleic acid aptamers screened using SELEX technology. After verification, the nucleic acid aptamers can specifically bind to MMLV proteins and exhibit high affinity for MMLV proteins. Therefore, the nucleic acid aptamers can be used in the enrichment, separation and detection of MMLV proteins, which is helpful for the identification and activity study of MMLV proteins. Attached Figure Description

[0012] Figure 1 These are gel electrophoresis results of the amplification products and nucleic acid aptamers prepared into sequencing libraries during each round of screening in this embodiment of the invention; Figure 2 This is a graph showing the quality control results of the sequencing library in an embodiment of the present invention; Figure 3 This diagram illustrates the binding of MMLV protein to nucleic acid aptamers PG7572 and PG7573 in embodiments of the present invention. Figure 4 This is a graph showing the results of nucleic acid aptamer blocking MMLV activity and hot-start activity in an embodiment of the present invention; Figure 5 To predict the structure of the MMLV protein-nucleic acid aptamer complex. Detailed Implementation

[0013] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that the embodiments are only used to explain the present invention and are not intended to limit the present invention. Unless otherwise specified, the reagents and raw materials used in the present invention can be purchased from Sinopharm Chemical Reagent Co., Ltd.

[0014] Example: Screening and preparation of nucleic acid aptamers specifically binding to MMLV (1) Design and construction of random nucleic acid libraries and primers The randomized nucleic acid library and PCR-related amplification primers used for nucleic acid aptamer screening were synthesized by Hunan Aikerui Biotechnology Co., Ltd. The randomized nucleic acid library consists of fixed sequences (20 bases each) at both ends and a randomized 80-base sequence in the middle, composed of four arbitrary nucleotide bases: A, T, C, and G.

[0015] The nucleotide sequence (5'-3') of the randomized nucleic acid library is: AGCACAGAGGTCAGATG-N ​​(80bp) -CCTATGCGTGCTACCGTGAA. Additionally, the nucleotide sequence of primer ssDNA-library-F is shown in SEQ ID NO.3, and the nucleotide sequence of primer ssDNA-library-R is shown in SEQ ID NO.4. Specifically, the primer information (5'-3') is shown in Table 1.

[0016] Table 1 Primer Information

[0017] In Table 1, F in the primer name represents the forward primer, R represents the reverse primer, and Biotin in the sequence indicates that the 5' end of the sequence is modified with a biotin label.

[0018] (2) Magnetic bead screening a) Take 5 OD random nucleic acid library, centrifuge at 12000 rpm for 10 min, then add 100 μL All in one Buffer to dissolve, and denature and anneal the random nucleic acid library according to the following program: 95℃ for 5 min, then cool down to 25℃ at a rate of 1℃ / min. Set aside. The All in one Buffer consists of: 80 mM Tris-HCl, 2 mM dN(UTP)s, 320 mM MCl, 320 mM MgCl2, and 0.8 mg / mL sodium alginate (pH 8.9). b) Thoroughly mix the Ni-NTA magnetic beads (purchased from Thermo Fisher Scientific), pipette 50 μL of Ni-NTA magnetic beads into two tubes, place them on a magnetic rack, let them stand to remove the supernatant, and wash the magnetic beads three times with 200 μL All in one Buffer in both tubes for later use; c) Add 1 nmol MMLV protein (purchased from Novizan) to 50 μL of Ni-NTA magnetic beads washed in step b), mix well by pipetting, and incubate on a shaker at room temperature for 30 min. After incubation, place the beads on a magnetic rack and let them stand to remove the supernatant. Wash the magnetic beads three times with 200 μL All in one Buffer and set aside. d) Add the annealed random nucleic acid library from step a) to 50 μL of washed Ni-NTA magnetic beads from step b), incubate on a shaker at room temperature for 10 min, place it on a magnetic rack after incubation, let it stand and collect the supernatant, add the supernatant to the magnetic beads washed after incubation with MMLV protein from step c), pipette and mix well, incubate on a shaker at room temperature for 15 min; e) Wash the magnetic beads from step d) three times with 200 μL All in one Buffer, elute with 50 μL All in one Buffer containing 500 Mm imidazole, collect the supernatant to obtain the MMLV-library complex, and label it as MMLV-Elution.

[0019] (3) Preparation of ssDNA single strands i) MMLV-Elution was used as a template for amplification. Specifically, the AG12308 kit from Hunan Aike Rui Biotechnology Co., Ltd. was used for amplification. The amplification system was as follows: 5 μL Multiplex DNA Polymerase, 125 μL 2X Multiplex PCR Buffer, 5 μL ssDNA-library-F, 5 μL ssDNA-library-R2, 50 μL MMLV-Elution, and 60 μL RNase-free H2O. Each tube contained 50 μL for amplification. The amplification program was: 95℃ for 1 min; 95℃ for 30 s, 60℃ for 30 s, 68℃ for 10 s, 25 cycles; 68℃ for 10 min. The amplified product was labeled as MMLV-dsDNAAmplicon and kept for later use. ii) Primer ssDNA-library-R2 is biotinylated, therefore the amplified MMLV-dsDNA Amplicon is also biotinylated. Single-stranded ssDNA is obtained using Streptavidin Magpoly Beads (SA beads). First, the SA beads are thoroughly mixed. 100 μL of SA beads is placed on a magnetic rack and allowed to stand to remove the supernatant. The beads are then washed three times with 200 μL SA Buffer. The SA Buffer consists of 20 mM Tris-HCl, 200 mM NaCl, and 0.1 mM EDTA (pH 7.5). iii) Add the MMLV-dsDNA Amplicon from step i) to 100 μL of washed SA magnetic beads from step ii), incubate on a shaker at room temperature for 1 h, incubate for 10 min, place on a magnetic rack, let stand and collect the supernatant, add 50 μL of 0.1 M glacial acetic acid to the supernatant for neutralization, the resulting solution is the separated ssDNA single strand, which is labeled as MMLV-ssDNA pool-1st and can be used for the next round of magnetic bead screening.

[0020] (4) Screening of nucleic acid aptamers Repeat steps (2) and (3) for a total of 5 rounds of screening, using the nucleic acid library obtained in the previous round as the starting library for each screening. In subsequent screenings, the amount of MMLV protein was gradually reduced (halved compared to the previous round), the binding time between the nucleic acid library and MMLV protein was shortened, and the number of washing cycles was increased (two more washing cycles than the previous round). The final amplification round used ssDNA-library-F and ssDNA-library-R for amplification, without separating and preparing ssDNA single strands, ultimately obtaining a dsDNA library, which was labeled as MMLV-dsDNA pool. The MMLV-dsDNA pool was prepared into a sequencing library using the AG12535 kit from Hunan Aike Rui Biotechnology Co., Ltd. The gel electrophoresis results of the amplification products and nucleic acid aptamers prepared into sequencing libraries during the 1st to 5th rounds of screening are shown below. Figure 1 As shown, Figure 1 In the agarose gel electrophoresis diagram shown, lanes 1-5 in ABCDE represent the amplification products of nucleic acid aptamers after 1-5 rounds of screening (i.e., lane 1 in A represents the amplification product in the first round of screening, lane 2 in B represents the amplification product in the second round of screening, and so on). F represents the preparation of nucleic acid aptamers into sequencing libraries. Lane M in AD and F represents DNA markers (100 bp-5000 bp), and lane M in E represents DNA markers (100 bp-2000 bp). Figure 1 In the first round of screening, the bands in lanes 1-5 were all around 120 bp in size, indicating that the nucleic acid library bound to the MMLV protein, and aptamers that bind to the MMLV protein were selected. The first round of screening removed a large number of proteins that did not bind to the MMLV protein. After multiple rounds of screening, the sequences were mostly those with strong binding affinity to the MMLV protein. With each subsequent round of screening, the enriched bands became more distinct (brighter). Figure F shows the sequencing library prepared from the library obtained in the final round of screening, with bands approximately 200 bp in size.

[0021] The sequencing library in step (4) was subjected to quality control analysis using a 2100 bioanalyzer. The quality control results are as follows: Figure 2 As shown in the figure, the quality inspection revealed that the sequencing library sequence was approximately 221 bp, consistent with the theoretical library size, indicating that the sequencing library quality was excellent.

[0022] Example 1 Differential scanning fluorescence (DSF) was used to detect the binding affinity between nucleic acid aptamers and MMLV protein. Several selected nucleic acid aptamers were incubated with MMLV protein at 37°C for 2 h, with MMLV protein alone serving as a control. Changes in the Tm values ​​of the nucleic acid aptamers and MMLV protein were measured. Some results are shown below. Figure 3As shown in Table 2, the Tm value of the supernatant after incubation of the nucleic acid aptamer with MMLV protein was higher than that of the control, indicating that the nucleic acid aptamer can bind to MMLV protein. The predicted structure after binding of the nucleic acid aptamer with MMLV protein is shown in Table 2. Figure 5 As shown, Figure 5 In the table, A represents the structure of MMLV protein after binding with the annealed chain (PG7572+PG7573), B represents the structure of MMLV protein after binding with PG7572, and C represents the structure of MMLV protein after binding with PG7573. Nucleic acid aptamers with strong binding affinity to MMLV protein are shown in Table 3.

[0023] Table 2. Results of nucleic acid aptamer binding ability to MMLV protein.

[0024] Table 3 Nucleic acid aptamer sequences

[0025] Characterization Example 2 The activity of nucleic acid aptamers in blocking MMLV protein at 37℃ and 55℃ was verified. MMLV is a reverse transcriptase. The nucleic acid aptamers were incubated with MMLV, and the enzyme activity of the incubated solution was measured. Specifically, the activity was measured according to the following method: 1) The selected nucleic acid aptamers were incubated with MMLV enzyme protein in a 6.9 μL incubation system: 1 X RTReaction buffer, 3.5 pmol nucleic acid aptamers, and 50 pmol MMLV enzyme protein (purchased from Novizan). The mixture was incubated at 4 °C for 16 h.

[0026] 2) Template annealing: 10 μL annealing reaction system: 1 X dNTP Mix, 0.5 pmol Oligo dT (18T) Primer, 0.5 μg 293T RNA (4Kb); reaction program: 65℃ for 5 min, 4℃ ∞.

[0027] 3) MMLV activity reaction: 20 μL reaction system: 1 X RT Reaction buffer, 20 U RNase Inhibitor, supernatant from step 1) of the above incubation of nucleic acid aptamer and MMLV enzyme protein, and 10 μL annealing template from step 2). Two reaction programs are set up: Program 1: 37℃ for 30 min, 85℃ for 10 min, 4℃ ∞; Program 2: 65℃ for 10 min, 37℃ for 30 min, 85℃ for 10 min, 4℃ ∞.

[0028] 4) MMLV Reversal Product Amplification: Using the reaction product obtained in step 3) as a template, the 50 μL amplification system consisted of: 1x PCR Reaction buffer, 1X dNTPs, 0.2 μmol / L upstream and downstream primers (0.2 μmol / L each; the upstream primer was MMLV-F, with the nucleotide sequence shown in SEQ ID NO.5: TCGGACACTGCTACCTCTTCTTTTGG; the downstream primer was MMLV-R, with the nucleotide sequence shown in SEQ ID NO.6: ACTGCTTCTGCGGTTCCTTCCCTTCA), 2.5 U DNA polymerase, and 2 μL template. The reaction program was: 94℃ for 1 min, 94℃ for 30 s, 56℃ for 30 s, 72℃ for 4 min, for a total of 30 cycles; followed by 72℃ for 10 min. After the reaction, agarose gel electrophoresis was performed, and the results are shown below. Figure 4 As shown.

[0029] Figure 4 In the diagram, lane M represents the DNA Marker (100 bp-5000 bp), and lane 1 represents the MMLV enzyme protein and MMLV reaction. Lane 2 shows the supernatant reaction results after incubation with buffer. Lane 3 shows the supernatant reaction results after incubation of MMLV enzyme protein with H2O (reaction procedure 1). Lane 4 shows the supernatant reaction results after incubation of MMLV enzyme protein with PG7572 single-stranded nucleic acid aptamer (reaction procedure 1). Lane 5 shows the supernatant reaction results after incubation of MMLV enzyme protein with PG7573 single-stranded nucleic acid aptamer (reaction procedure 2). Lane 6 shows the supernatant reaction results after incubation of MMLV enzyme protein with PG7573 single-stranded nucleic acid aptamer (reaction procedure 2). Lane 7 shows the supernatant reaction results after incubation of MMLV enzyme protein with the annealed strands of PG7572 and PG7573 double strands (reaction procedure 1). Lane 8 shows the supernatant reaction results after incubation of MMLV enzyme protein with the annealed strands of PG7572 and PG7573 double strands (reaction procedure 2). Figure 4 It can be seen that, with MMLV + H2O and MMLV + MMLV Reaction buffer as controls (lanes 1, 2), nucleic acid aptamers PG7572, PG7573, and PG7572+PG7573 annealed strands can effectively block MMLV enzyme protein activity (lanes 3, 4, 7); adding a hot start program (65℃, 10 min) can restore MMLV enzyme protein activity (lanes 5, 6, 8).

[0030] The above are merely embodiments of the present invention. The invention is not limited to the fields covered by these embodiments. Commonly known structures and characteristics are not described in detail here. Those skilled in the art are aware of all common technical knowledge in the field prior to the application date or priority date, are aware of all existing technologies in that field, and have the ability to apply conventional experimental methods prior to that date. Those skilled in the art can improve and implement this solution based on the guidance provided in this application and their own capabilities. Some typical known structures or methods should not be obstacles for those skilled in the art to implement this application. It should be noted that those skilled in the art can make several modifications and improvements without departing from the structure of the present invention. These should also be considered within the scope of protection of the present invention, and will not affect the effectiveness or practicality of the invention. The scope of protection claimed in this application should be determined by the content of its claims. The specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. A nucleic acid aptamer that specifically binds to MMLV, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The application of the nucleic acid aptamer that specifically binds to MMLV as described in claim 1 in the preparation of reagents for enriching MMLV protein.

3. The application of the nucleic acid aptamer that specifically binds to MMLV as described in claim 1 in the preparation of reagents for isolating MMLV protein.

4. The application of the nucleic acid aptamer that specifically binds to MMLV as described in claim 1 in the preparation of MMLV protein detection reagents, test strips, and biosensors.

5. The method for preparing a nucleic acid aptamer that specifically binds to MMLV as described in claim 1, characterized in that: Includes the following steps: S1. Design and construction of random nucleic acid libraries and primers; S2. The random nucleic acid library is annealed and then incubated with MMLV protein. The binding is screened using Ni-NTA magnetic beads to obtain the MMLV-library complex. S3. The MMLV-library complex obtained after screening is amplified to obtain amplification products. The amplification products are separated into ssDNA using Streptavidin Magpoly Beads. The separated ssDNA is the nucleic acid library for the first round of screening. S4. Repeat steps S2-S3 for a total of 5 or more rounds of screening, using the nucleic acid library obtained in the previous round as the starting library for each operation; after screening, the target nucleic acid aptamer is obtained.