Plant bright leaf character related gene BrTRUD1, molecular marker and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a plant bright leaf character related gene BrTRUD1, a molecular marker and application of the plant bright leaf character related gene BrTRUD1, and the nucleotide sequence of the BrTRUD1 is shown as SEQ ID NO.26. Through genetic localization and KASP genetic typing analysis, it is identified that one basic group transversion in a promoter region is a reason causing wdm21 bright leaf phenotype, and the mutation is located in the promoter region of a pseudouridine synthetase gene BrTRUD1. The result of the invention reveals a new function of BrTRUD1, and clarifies that the gene plays a key role in formation of Chinese cabbage epidermis wax crystals.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a gene related to the bright leaf trait in plants. BrTRUD1 Molecular markers and their applications. Background Technology

[0002] Chinese cabbage( Brassica rapa L. ssp. Pekinensis Chinese cabbage is a major vegetable crop in East Asia. Leaf gloss is a crucial factor determining its marketability. Glossy-leaved Chinese cabbage, with its reduced waxy coating and bright, glossy appearance, has gained increasing popularity among consumers. The glossy leaf phenotype is not only visually appealing but also helps remove pesticide residues during washing. Therefore, breeding glossy-leaved varieties has become a new goal in Chinese cabbage breeding.

[0003] The glossy leaf phenotype is closely related to the composition and structure of the plant's epidermal wax crystals, which form a hydrophobic barrier covering the surface of the plant's above-ground organs. Epidermal wax is a complex mixture of very long-chain fatty acids and their derivatives, such as alkanes, alcohols, aldehydes, and esters, constituting a major barrier against non-stomatal water loss, ultraviolet radiation, and pathogen invasion. Forward genetic screening induced by ethyl methanesulfonate mutagenesis and natural variation analysis have become effective methods for identifying key genes in wax synthesis. To date, numerous wax-deficient mutants have been identified in multiple species. In Arabidopsis thaliana, CER1 , CER3 and WIN1 / SHN1 Genes such as those found in cucumbers have been cloned. CsCER1 and rice OsGL1 They have also been identified. In Brassica crops, genes controlling the biosynthesis of epidermal waxes are being gradually revealed. For example, BoCgl2 It was identified as the cause of heady cabbage ( Brassica oleracea L. var. capitata The gene for the glossy leaf trait. In purple cabbage ( Brassica rapa L. var. purpurea )middle, BrCER4 It is responsible for the biosynthesis of cuticle wax, and mutations in this component lead to a glossy leaf phenotype. Furthermore, BrMYB31 and BrWAX2 It has also been found to be related to the accumulation of waxy substances on the surface of Chinese cabbage. Therefore, there is an urgent need to develop genes associated with the glossy leaf phenotype of Chinese cabbage. Summary of the Invention

[0004] The purpose of this invention is to provide a gene related to the bright leaf trait in plants. BrTRUD1 This solves the problems existing in the current technology.

[0005] The technical solution adopted in this invention is: This invention provides a gene related to the bright leaf trait in plants. BrTRUD1 The BrTRUD1 The nucleotide sequence is shown in SEQ ID NO.26.

[0006] The second aspect of the present invention provides the aforementioned BrTRUD1 The application, wherein the application refers to: Reduce in plants BrTRUD1 The expression level of alkane was reduced to decrease alkane content, thereby obtaining plants with glossy leaves.

[0007] Preferably, the plant includes either Chinese cabbage or Arabidopsis thaliana.

[0008] A third aspect of the present invention provides a molecular marker associated with the bright leaf trait in plants, the molecular marker being located in the... BrTRUD1 The promoter region; the molecular marker is specifically located 270 bp upstream of the start codon; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide at position 101 bp is either A or G.

[0009] A fourth aspect of the present invention provides a KASP primer for identifying the molecular marker, the sequence of which is shown in SEQ ID NO.13 and SEQ ID NO.14.

[0010] A fifth aspect of the present invention provides an application of the molecular marker and / or the KASP primer, wherein the application refers to any one of the following: 1) To identify or assist in the identification of the glossy leaf trait in plants; 2) Screening or breeding plant strains or varieties with bright leaf traits; 3) Prepare products for identifying the bright leaf trait in plants.

[0011] Preferably, the method for identifying the glossy leaf trait in plants is as follows: Extract genomic DNA from the plant to be tested; Detect the genotype type at position 101 of the molecular marker; If the genotype is AA, the plant being tested is determined to have the glossy leaf trait.

[0012] Preferably, the plant is Chinese cabbage.

[0013] Compared with the prior art, the beneficial effects of the present invention are: This invention provides a gene related to the bright leaf trait in plants. BrTRUD1 The BrTRUD1The nucleotide sequence is shown in SEQ ID NO. 26. This invention isolated a bright-leaf mutant from an EMS-mutated population of Chinese cabbage. wdm21 Through MutMap genetic mapping and KASP genotyping analysis, a single base transversion in the promoter region was identified as the cause of... wdm21 The cause of the glossy leaf phenotype is a mutation located in the pseudouridine synthase gene. BrTRUD1 The promoter region. The results of this invention reveal... BrTRUD1 The novel function of this gene clarifies its crucial role in the formation of waxy crystals in the epidermis of Chinese cabbage. In summary, this study successfully cloned the pseudouridine synthase gene. BrTRUD1 This study reveals a novel biological role of the gene in the formation of waxy epidermis in plants, providing new genetic resources for the commercial improvement of Chinese cabbage. Attached Figure Description

[0014] Picture 1 for wdm21 Phenotypic identification of its wild-type 'FT'. a: The leaf surface of 'FT' is grayish-white, while wdm21 The leaf surface is glossy. Scale bar = 5cm. b: Cryo-Scanning Electron Microscopy observation of the waxy crystals on the 'FT' epidermis. c: wdm21 No epidermal wax crystal deposition.

[0015] Picture 2 Compared to wild-type 'FT', wdm21 It has a lower wax content and higher stratum corneum permeability. The experiment was performed in three biological replicates. Numerical values ​​are expressed as mean ± standard deviation (*). P <0.05; **, P <0.01). a: 'FT' and wdm21 Total wax content. b: 'FT' and wdm21 Comparison of the three main waxy components of the stratum corneum. c: 'FT' and wdm21 The rate of water loss. d: 'FT' and wdm21 chlorophyll extraction rate.

[0016] Picture 3 This is a distribution plot of the SNP-Index from MutMap analysis for Chinese cabbage. The horizontal axis represents the chromosome name and its physical length (Mb), and the vertical axis represents the SNP-index value. The measured SNP-index value for each data point is shown, with the red dashed line representing the 99% confidence level threshold.

[0017] Picture 4The KASP genotyping results for four candidate genes in Chinese cabbage are shown. a: SNP (A03: 15,727,811); b: SNP (A03: 16,963,846); c: SNP (A03: 17,792,221); d: SNP (A03: 15,827,470). Blue, red, and green dots represent the A:A, G:G, and G:A genotypes, respectively.

[0018] Picture 5 for BrTRUD1 Sequence analysis. a: Reference genome, 'FT' and wdm21 middle BrTRUD1 Comparative analysis of promoter sequences. b: BrTRUD1 The phylogenetic tree.

[0019] Picture 6 for BrTRUD1 Verification of transgenic function in Arabidopsis thaliana. a: 4-week-old Col-0, trud1 ,exist trud1 Expression in plants Pro35S :: BrTRUD1 ::GFP ( BrTRUD1 -Comp) and expression in Col-0 plants Pro35S :: BrTRUD1 ::GFP ( BrTRUD1 Morphology of Col-OE. b~e: Stem surfaces of four strains observed under a stereomicroscope (Nikon SMZ25, 1×). From left to right: Col-O, trud1 , BrTRUD1 -Comp and BrTRUD1 -OE plant. f: Col-0, trud1 , BrTRUD1 -Comp and BrTRUD1 -OE water loss rate. g: Col-0, trud1 , BrTRUD1 -Comp and BrTRUD1 -OE chlorophyll extraction rate.

[0020] Picture 7 for BrTRUD1 Analysis of promoter activity, expression patterns, and expression patterns of genes related to the alkane pathway. a: Schematic diagram of GUS reporter gene construction. b: Detection of GUS activity by histochemical staining. c: In ProBrTRUD1 FT and ProBrTRUD1 wdm21 Controlled GUS gene expression levels. d: BrTRUD1 In 'FT' and wdm21 Expression levels in different organs. e: Expression level of genes in the alkane pathway.

[0021] Picture 8 Subcellular localization of BrTRUD1 in Nicotiana benthamiana. GFP, green fluorescent protein. (See figure.) Pro35S ::GFP and Pro35S :: BrTRUD1 ::GFP is abbreviated as GFP and GFP respectively. BrTRUD1 ::GFP. Detailed Implementation

[0022] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0023] The inventive concept of this invention is as follows: TRUD1 It is a member of the pseudouridine synthase family, catalyzing the isomerization of uridine to pseudouridine. Pseudoridineization is the most common type of RNA modification and plays a crucial role in the regulation of various genes. Some biological functions of members of the pseudouridine synthase family have been revealed. For example, the pseudouridine synthase in Arabidopsis thaliana mitochondria. AtFCS1 Mitochondrial 26S rRNA pseudouridine mediated by mitochondrial synthesis is crucial for maintaining mitochondrial function and normal development. (Pseudouridine synthase gene) AtCBF5 T-DNA insertion in rice is lethal. (Pseudoruridyl synthase) OsPUS1 Mediated pseudouridine cytosylation of chloroplast rRNA helps enhance cold tolerance in seedlings. However, the role of pseudouridine synthase remains unclear. TRUD1 Research on this topic is relatively limited. In rice... OsTRUD1 The expression level of [a specific substance] changed under abiotic stress conditions, suggesting its potential involvement in salt and drought stress responses. (Arabidopsis thaliana) AtTRUD1 and corn ZmTRUD1 They exhibited different responses to abiotic stresses.

[0024] This invention screened a bright-leaf mutant from an EMS mutagenesis population of Chinese cabbage. wdm21 and identified BrTRUD1 It is a mutated gene. The results of this invention reveal... BrTRUD1 This discovery reveals a new function in the formation of epidermal wax crystals and provides new genetic resources for the breeding of glossy-leaved Chinese cabbage.

[0025] The present invention BrTRUD1 The nucleotide sequence is shown in SEQ ID NO.26.

[0026] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0027] Example 1 A gene associated with the trait of glossy leaves in plants BrTRUD1 Molecular markers and their applications are detailed below: 1. Materials and Methods.

[0028] 1.1 Plant materials.

[0029] This invention uses Chinese cabbage 'FT' as a background, and constructs a mutant population with high genetic variation by treating its seeds with 0.8% ethyl methanesulfonate EMS solution. After multiple generations of self-pollination and phenotypic screening, a stably inherited bright-leaf mutant was isolated and named... wdm21 All experimental materials were grown in the greenhouse of Shenyang Agricultural University.

[0030] 1.2. Observation using cryo-scanning electron microscopy.

[0031] During the bolting stage, wild-type 'FT' and mutant strains were collected separately. wdm21 Fresh leaves were used. The leaves were cut into 1mm × 3mm strips with a sharp blade. The samples were fixed on the sample stage and quickly frozen in liquid nitrogen, followed by gold sputtering. The samples were then observed using a Hitachi Regulus 8100 cryo-scanning electron microscope.

[0032] 1.3 Gas chromatography-mass spectrometry analysis of the content and composition of stratum corneum wax.

[0033] The extraction and quantification of waxes were based on published methods with slight modifications. At room temperature, equal areas of 'FT' and... wdm21 Leaf extract was prepared by 1 min to extract cuticle wax. Tetracosane was added to the extract as an internal standard. Subsequently, the sample was derivatized with 100 μL of N,O-bis(trimethylsilyl)trifluoroacetamide and 100 μL of pyridine, sealed, and incubated at 70°C for 60 min. The sample was analyzed using an AGILENT 6890-5973N gas chromatograph equipped with a mass spectrometer detector.

[0034] 1.4 Determination of water loss rate and chlorophyll extraction rate.

[0035] Leaves at the same developmental stage were taken from 4-week-old plants and placed at room temperature. The weight of the detached leaves was measured every 20 minutes. The water loss rate was calculated as a percentage of the initial weight.

[0036] Chlorophyll extraction rate was used to assess leaf cuticle permeability, following a method described previously. 'FT' and... wdm21 Leaf samples from the same location were immersed in 30 mL of 80% ethanol. Absorbance was measured at 664 nm and 647 nm using a spectrophotometer. The experiment was performed in triplicate. The chlorophyll concentration was calculated using the following formula:

[0037] .

[0038] In the formula, A Chlorophyll concentration, µg·mL -1 ; B Absorbance at a wavelength of 664nm; C Absorbance at a wavelength of 647nm.

[0039] 1.5 Genetic analysis.

[0040] To perform genetic analysis, 'FT' (P1) was compared with... wdm21 (P2) Crossing yielded the F1 generation. The F1 generation was backcrossed with each of the two parents to obtain the BC1 population. Self-pollination of the F1 plants produced the F2 segregating population. The phenotypes of the P1, P2, F1, BC1, and F2 populations were systematically recorded. The chi-square test (χ²) was used. 2 The segregation ratios of the BC1 and F2 populations were analyzed using a test.

[0041] 1.6. Locate candidate genes using the MutMap method.

[0042] To identify the genetic loci controlling the bright leaf trait, genomic DNA was extracted from individual plants exhibiting the bright leaf phenotype in the F2 population. Fifty high-quality DNA samples were mixed in equal volumes to construct... wdm21 Mix pool. Similarly, combine 'FT' (P1) and... wdm21 DNA from (P2) was mixed separately to construct P1 and P2 pools. Whole-genome resequencing was performed on the Illumina NovaSeq platform. Sequencing data underwent the following bioinformatics workflow: data quality control was performed using FASTP to remove low-quality reads and adapter sequences, obtaining high-quality clean data for downstream analysis; reads were aligned to the reference genome using BWA-MEM software; SNP calling and filtering were performed using GATK; InDel detection was performed using stringent standards; and candidate genomic regions associated with the bright leaf trait were identified through SNP-index analysis.

[0043] 1.7 KASP genotyping verification.

[0044] The SNPs detected by MutMap were validated using competitive allele-specific PCR (KASP) analysis. Materials used for KASP genotyping included two 'FT' strains and two... wdm21 Two F1 hybrid plants and eighty-nine F2 plants exhibiting the glossy leaf phenotype were included. The primer sequences used by KASP are listed in Table 1.

[0045] Table 1 addresses wdm21 KASP primer sequence of the mutant Note: In Table 1, Forward-1 primer corresponds to the FAM probe, and Forward-2 primer corresponds to the HEX probe.

[0046] 1.8 Cloning and sequence analysis of candidate genes.

[0047] Retrieved from the cabbage database BraA03g032280.3.5C The genome sequence was used as a PCR template. Gene-specific primers were designed using Primer Premier 5.0 for cloning. BrTRUD1 Primers are listed in Table 2. The target amplified fragments were separated by 1.5% agarose gel electrophoresis. After purification, the DNA fragments were ligated into the pGEM®-T Easy vector and transformed into *E. coli* DH5α competent cells. Positive clones were identified by colony PCR and sequencing. Sequence alignment was performed using DNAMAN. A phylogenetic tree was constructed using the neighbor-joining method in MEGA 7.0 software, and the reliability of the tree was assessed through 1000 bootstrap replicates.

[0048] Table 2 is used for cloning. BrTRUD1 Primer list 1.9 Arabidopsis vector construction and genetic transformation.

[0049] Arabidopsis mutants were purchased from a publicly available website (http: / / www.arabidopair.org) and the SIGNAL-based three-primer system was used to... trud1 Genotyping of the mutant (SALK_031107C) was performed, and the primer sequences used to identify the homozygous mutant are listed in Table 3. The mutant was then subjected to infection to verify gene function.

[0050] Table 3 Primer sequences used for verifying homozygous mutants in Arabidopsis thaliana. To conduct complementation and overexpression experiments, clones were used. BrTRUD1 The encoded sequence CDS (SEQ ID NO.26) is used to construct pBWA(V)HS- Pro35S:: BrTRUD1 ::GFP plant overexpression vector, and transformed into GFP plants using Agrobacterium-mediated inflorescence staining. trud1 In mutants and Col-0 wild-type Arabidopsis thaliana. The constructed vector was transformed into trud1 In homozygous mutants, obtain BrTRUD1 -Complementaton ( BrTRUD1 -Comp) replenishment material; transfer the same carrier into a Col-0 background to obtain BrTRUD1 -Overexpression ( BrTRUD1 -OE) overexpression materials. Relevant primers are shown in Table 4.

[0051] Table 4 Primer sequences used for CDS cloning and genetic transformation SEQ ID NO.26:

[0052] 1.10. Histochemical analysis of β-glucuronidase.

[0053] respectively 'FT' and wdm21 Using genomic DNA as a template, amplification BrTRUD1 The promoter fragment 2000 bp upstream of the ATG start codon was used to replace the 35S promoter in the modified pBI101 vector, and then fused with the GUS reporter gene. The restriction enzyme sites were SalⅠ and BamHI. The recombinant vector was validated by Sanger sequencing (primer sequences are shown in Table 5) and transiently transformed into *Nicotiana benthamiana* leaves. The soaked tobacco plants were cultured in the dark for 48 hours, followed by GUS histochemical staining and GUS gene expression analysis according to the GUS staining kit instructions. Each experiment included three independent biological and technical replicates.

[0054] Table 5 Primers used to validate the GUS fusion vector 1.11 Real-time quantitative PCR analysis.

[0055] 'FT' and 'FT' were extracted using an RNA extraction kit. wdm21 Total RNA from the corresponding tissue was collected, and the procedure followed the manufacturer's instructions. After passing quality testing, 1 μg of RNA was reverse transcribed using the Fast Quant RT Kit to synthesize cDNA. qRT-PCR reactions were performed using SYBR Green PCR Master Mix on a Quant Studio™ 6 Flex system. Two [units / items / etc.] were used. −ΔΔCt The method performs relative quantitative analysis to BrActin This gene was used as an internal reference. All gene expression analyses were performed in triplicate (biological and technical replicates). All specific primer sequences are listed in Table 6.

[0056] Table 6 Primer sequences for qRT-PCR 1.12. Subcellular localization.

[0057] Will Pro35S :: BrTRUD1 ::GFP recombinant plasmid was transformed into Agrobacterium GV3101 strain. Leafy tobacco plants grown for 30 days were used to transiently express GFP by injecting Agrobacterium bacterial suspension with an OD600 of 0.8 using a needle-free syringe. After inoculation, the tobacco plants were first cultured in the dark for 18 hours, followed by culture under normal light for 24 hours. GFP fluorescence was observed using a confocal laser scanning microscope; the excitation wavelength was 488 nm, and the emission wavelength was 510 nm.

[0058] 2. Results and Analysis.

[0059] 2.1 Phenotypic characteristics of mutants.

[0060] Throughout the reproductive period, especially during the bolting stage, wdm21 All mutants exhibited a glossy leaf phenotype, while the wild-type 'FT' had grayish-white leaves. Cryo-scanning electron microscopy revealed that the 'FT' leaf surface was densely covered with epidermal waxy crystals, while... wdm21 Almost no wax crystals were deposited on the leaf surface. See the above results. Picture 1 .

[0061] 2.2 Wax components and stratum corneum permeability.

[0062] 'FT' and 'FT' were determined by GC-MS. wdm21 The total wax content. The results showed that... wdm21 The total wax content of 'FT' was significantly lower than that of 'FT'. Wax composition analysis showed that keratin wax is mainly composed of fatty acids, alcohols, and alkanes. Alkanes accounted for the largest proportion, and were present in both 'FT' and 'FT'. wdm21 Significant differences exist between them. The above results are shown in [reference needed]. Picture 2 a and b.

[0063] Further analysis was conducted by measuring the water loss rate and chlorophyll extraction rate to detect 'FT' and wdm21 Leaf cuticle permeability. At all measurement time points, wdm21 The water loss rate and chlorophyll extraction rate of were both significantly higher than those of 'FT'. These results indicate that wdm21 The decrease in wax content significantly enhanced its stratum corneum permeability. See the above results. Picture 2 c and d.

[0064] 2.3 Genetic analysis of mutant traits.

[0065] 'FT' and wdm21 Crossing yielded F1, BC1, and F2 populations. The segregation ratios conformed to Mendelian inheritance, with the BC1 (F1×P2) population having a ratio of 1.08:1 (χ² = 0.16) and the F2 population having a ratio of 2.78:1 (χ² = 0.60). The results are shown in Table 7. These data indicate that the bright leaf trait is controlled by a single recessive nuclear gene.

[0066] Table 7 Genetic analysis of the glossy leaf phenotype in Chinese cabbage. Note: In Table 7, "-" indicates that this item is not present.

[0067] 2.4. Location of candidate genes.

[0068] Candidate genomic regions were identified using the MutMap method. Three DNA pools ( wdm21 Deep sequencing was performed on the P1, P2, and P3 pools, yielding 174.8 million, 163.3 million, and 73.1 million high-quality clean reads, respectively (see Table 8). Alignment analysis showed that 99.01%, 99.11%, and 98.42% of the reads in the three pools successfully aligned to the reference genome Brara_Chiifu_V3.5 (Table 9). SNP annotation identified 143,758 non-synonymous mutation sites (Table 10). A 2.8 Mb candidate region was delineated on chromosome A03 using a 99% threshold. Picture 3 This region is significantly associated with the glossy leaf phenotype.

[0069] Table 8 Statistics of high-quality MutMap sequencing data HQ Reads: Number of high-quality reads (Phred quality value ≥ Q30); HQ Reads (%): Percentage of high-quality reads relative to the original number of reads; HQ Data (bp): Total number of base pairs that passed quality filtering; HQ Data (%): Proportion of high-quality bases to the original total number of bases.

[0070] Table 9. Alignment statistics in MutMap sequencing analysis Mapped reads: Number of sequencing reads aligned to the reference genome; Mapped bases: Total number of base pairs aligned to the reference genome; Mapping rate: Percentage of total reads aligned to the reference genome.

[0071] Table 10 SNP annotation statistics in MutMap analysis Exonic: SNPs (protein-coding sequences) located in exon regions; Stopgain: nonsense SNPs that lead to premature stop codons (PTCs); Stoploss: SNPs that eliminate natural stop codons; Synonymous: synonymous mutations that do not change the amino acid sequence; Nonsynonymous: missense mutations that cause amino acid substitutions; Unknown: variants located in unannotated or uncharacterized regions; Splicing: variants located within 2 bp at exon-intron junctions; Intronic: SNPs located in intron regions; Intergenic: variants located between annotated genes; Upstream: regulatory regions within 1 kb upstream of transcription start sites; Downstream: regions within 1 kb downstream of transcription termination sites; Upstream; Downstream: joint regulatory regions flanking genes.

[0072] Within the candidate regions, MutMap analysis identified three nonsynonymous SNPs located in the exons and one SNP located in the promoter region (see Table 11). KASP genotyping showed that none of the three nonsynonymous SNPs in the exons co-segregated with the bright leaf phenotype (see Table 11). Picture 4 a~c. In BraA03g032280.3.5C A completely co-separated base substitution (SNP-index=1) was found in the promoter region, which is consistent with the phenotype. (See...) Picture 4 d. Bioinformatics analysis indicates that, BraA03g032280.3.5C With Arabidopsis thaliana encoding pseudouridine synthase ( TRUD1 )of AT3G04820 Gene homology. Therefore, this invention names this gene... BrTRUD1 These results suggest that BrTRUD1 Is it the cause wdm21 Candidate genes for the glossy leaf phenotype.

[0073] Table 11 Information on four candidate SNPs in the MutMap analysis of Chinese cabbage. 2.5 BrTRUD1 Cloning and sequence analysis.

[0074] This invention clones 'FT' and wdm21 Candidate genes BrTRUD1 The DNA sequence. Sanger sequencing confirmed 'FT' and wdm21 The coding sequences are completely identical. Its 2000 bp promoter region was isolated and sequenced, revealing a base substitution (GA) 270 bp upstream of the start codon ATG. (See...) Picture 5 Sequencing results of the cloned PCR product confirmed the KASP genotyping results. Phylogenetic analysis showed that... BrTRUD1 With cabbage ( Brassica oleracea TRUD1-like proteins cluster together and are highly conserved, see [link to relevant documentation]. Picture 5 b.

[0075] The sequences containing the mutation sites are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0076] SEQ ID NO.1: AATAATGAAAACATGTATTCGTGATAAAATTTTAGATCTGGATTCGGATATTTTAAAAAAATTTGGAGACCTGAGTAGTCCTATTAATGATTGGTAATAGGCTGGTTTAGAGCGTAGTCGGTTCGGTTCGGTTCGGTTCGGTTCGGTAAAGGTTCAACAAACTGGCTCAAGTCAACGACGATGGAGAATTCGATTTACTGG.

[0077] SEQ ID NO.2: AATAATGAAAACATGTATTCGTGATAAAATTTTAGATCTGGATTCGGATATTTTAAAAAAATTTGGAGACCTGAGTAGTCCTATTAATGATTGGTAATAGACTGGTTTAGAGCGTAGTCGGTTCGGTTCGGTTCGGTTCGGTTCGGTAAAGGTTCAACAAACTGGCTCAAGTCAACGACGATGGAGAATTCGATTTACTGG.

[0078] When the above base is A, that is, when the sequence is as shown in SEQ ID NO.2, the Chinese cabbage has a glossy leaf appearance.

[0079] 2.6 BrTRUD1 Functional verification was performed in Arabidopsis thaliana through genetic transformation.

[0080] System evolutionary analysis confirms BrTRUD1 It is Arabidopsis thaliana AtTRUD1 ( AT3G04820 This refers to orthologous proteins in the Brassica genus. To verify... BrTRUD1 The function was further demonstrated through heterologous transformation experiments in Arabidopsis thaliana. Phenotypic analysis was performed using T3 generation plants of the Arabidopsis thaliana mutant SALK_031107C.

[0081] SALK_031107C is a T-DNA sequence inserted into AtTRUD1The CDS region, resulting in a mutant that causes the gene to lose function. Compared to Col-0, Arabidopsis thaliana... trud1 The mutant's leaves and stems both exhibit a glossy phenotype, see Picture 6 a~c. BrTRUD1 -Comp recompensated plants reverted to the rough phenotype of the wild type. BrTRUD1 -OE overexpression plants exhibit the same phenotype as Col-0. Arabidopsis thaliana trud1 The mutant exhibited higher rates of water loss and chlorophyll extraction than Col-0, see [reference needed]. Picture 6 f and g. These results demonstrate that the bright leaf phenotype of the mutant is caused by f and g. BrTRUD1 This is caused by a mutation. A similar phenotype has also been observed in Chinese cabbage.

[0082] 2.7 BrTRUD1 Promoter activity is reduced in mutants.

[0083] This invention constructs separate promoters (FT) from the FT promoter (FT) ProBrTRUD1 FT )and wdm21 promoter ( ProBrTRUD1 wdm21 Two GUS reporter gene vectors driven by ) are shown in Figure 7 a. GUS histochemical staining and expression level analysis showed that, by ProBrTRUD1 FT The staining intensity and expression level of the GUS gene driven by [the specific gene] were both higher than those driven by [other gene]. ProBrTRUD1 wdm21 Driven GUS gene, see Figure 7 b and c. These results indicate that the base substitution pair BrTRUD1 The activity of the promoter had a negative impact.

[0084] Used for building ProBrTRUD1 FT The sequence of the promoter is shown in SEQ ID NO.47.

[0085]

[0086] Used for building ProBrTRUD1 wdm21 The sequence of the promoter is shown in SEQ ID NO.48.

[0087]

[0088] 2.8 BrTRUD1 And the expression patterns of key genes in the alkane pathway.

[0089] speculation BrTRUD1 Decreased promoter activity downregulates its expression level. Therefore, this invention evaluates... BrTRUD1 In 'FT' and wdm21 Expression levels in different organs. qRT-PCR analysis showed that... BrTRUD1 exist wdm21 It exhibits systemic downregulation, with transcript levels in leaves, stems, flowers, and siliques all lower than 'FT' ( Figure 7 d). Due to 'FT' and wdm21 Significant differences in alkane content were observed among the groups, and the expression of six core genes in the alkane synthesis pathway was quantitatively analyzed. Compared with 'FT', the expression of these six alkane pathway genes was significantly different. wdm21 The expression levels in the samples were significantly reduced ( Figure 7 Therefore, it is inferred that... BrTRUD1 Mutations in the promoter lead to reduced expression of key genes in the alkane pathway, resulting in a glossy leaf phenotype in Chinese cabbage.

[0090] 2.9 BrTRUD1 Subcellular localization.

[0091] Cell-PLoc online tool predictions indicate that BrTRUD1 is likely localized in the cell nucleus. To determine the subcellular localization of BrTRUD1, [further details needed]. Pro35S :: BrTRUD1 The ::GFP construct was transiently expressed in *Nicotiana benthamiana* leaves using the Agrobacterium tumefaciens infiltration method. Confocal microscopy revealed that... Pro35S :: BrTRUD1 ::GFP's green fluorescence strongly co-localizes with the nuclear labeling signal, see... Figure 8 The results showed that the BrTRUD1 protein is located in the cell nucleus.

[0092] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0093] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A gene associated with the bright leaf trait in plants. BrTRUD1 Its characteristics are, The BrTRUD1 The nucleotide sequence is shown in SEQ ID NO.

26.

2. As described in claim 1 BrTRUD1 The application, characterized in that, The application refers to: Reduce in plants BrTRUD1 The expression level of alkane was reduced to decrease alkane content, thereby obtaining plants with glossy leaves.

3. The application as described in claim 2, characterized in that, The plant includes either Chinese cabbage or Arabidopsis thaliana.

4. A molecular marker associated with the bright leaf trait in plants, characterized in that, The molecular marker is located in claim 1. BrTRUD1 The promoter region; the molecular marker is specifically located 270 bp upstream of the start codon; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide at position 101 bp is either A or G.

5. A KASP primer for identifying the molecular marker of claim 4, characterized in that, The sequences of the KASP primers are shown in SEQ ID NO.13 and SEQ ID NO.

14.

6. The application of the molecular marker as described in claim 4 and / or the KASP primer as described in claim 5, characterized in that, The application refers to any one of the following: 1) To identify or assist in the identification of the glossy leaf trait in plants; 2) Screening or breeding plant strains or varieties with bright leaf traits; 3) Prepare products for identifying the bright leaf trait in plants.

7. The application as described in claim 6, characterized in that, The methods for identifying glossy leaves in plants are as follows: Extract genomic DNA from the plant to be tested; Detect the genotype type at position 101 of the molecular marker; If the genotype is AA, the plant being tested is determined to have the glossy leaf trait.

8. The application as described in claim 6, characterized in that, The plant in question is Chinese cabbage.

Images