Transcription factor BnaMYB30 and application thereof

By regulating the expression level of the BnaMYB30 gene and combining it with the BnaFLS1 and BnaUGT75C1 promoters, recombinant vectors were constructed to overexpress or silence BnaMYB30. This solved the problem of unclear anthocyanin synthesis pathways in rapeseed, and achieved effective regulation of rapeseed drought resistance and anthocyanin content, thus promoting colored rapeseed breeding and industrial development.

CN122012590APending Publication Date: 2026-05-12JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU ACAD OF AGRI SCI
Filing Date
2026-02-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The dynamic regulatory mechanism of anthocyanins in the drought resistance response of rapeseed is not fully understood, especially its synthetic pathway, key genes, and differences in role among different rapeseed varieties, which affects the development of drought-resistant breeding of colored rapeseed.

Method used

By regulating the expression level of the BnaMYB30 gene, and utilizing BnaMYB30 to negatively regulate the drought resistance of rapeseed and positively regulate the anthocyanin content of rapeseed under drought stress, and by combining the BnaFLS1 and BnaUGT75C1 promoters to regulate the glycosylation of anthocyanins and the synthesis of flavonols, a recombinant vector overexpressing BnaMYB30 was constructed for gene overexpression or silencing, thereby regulating the drought resistance and anthocyanin content of rapeseed.

Benefits of technology

Effectively regulate the drought resistance of rapeseed and the anthocyanin content under drought stress, promote anthocyanin accumulation, enhance the drought resistance of rapeseed and the development of colored rapeseed industry, and promote the integration of agriculture and ecotourism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012590A_ABST
    Figure CN122012590A_ABST
Patent Text Reader

Abstract

The invention discloses a transcription factor BnaMYB30 and application thereof, and belongs to the technical field of gene engineering. The invention provides application of a BnaMYB30 gene or protein to regulation and control of drought resistance of rape and / or regulation and control of anthocyanin content of rape under drought stress. The BnaMYB30 is combined with a BnaUGT75C1 promoter and a BnaFLS1 promoter to participate in regulation and control of glycosylation of anthocyanin and flavonol synthesis, and accumulation of the anthocyanin is remarkably promoted by activating key structural genes CHI, F3H and DFR in a flavonoid synthesis pathway. The BnaMYB30 overexpression strain lacks effective ABA and JA hormone signal regulation and control, and the stress response mode is single, so that the antioxidant enzyme activity is reduced, the active oxygen scavenging capacity is reduced, and finally the drought sensitive phenotype is shown.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a transcription factor BnaMYB30 and its applications. Background Technology

[0002] Anthocyanins, as important secondary metabolites in plants, are closely related to plant responses to abiotic stress. However, the dynamic regulatory mechanism of anthocyanins in the drought resistance response of rapeseed is not fully understood, especially regarding its synthetic pathways, key genes, and differences in roles among different rapeseed varieties, which still require systematic research.

[0003] Rapeseed is not only an important oilseed crop, but also has high ornamental value. Therefore, studying the regulatory mechanism of anthocyanin synthesis in rapeseed is particularly important for the development of drought-resistant breeding of colored rapeseed. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide an application of the BnaMYB30 gene or protein in regulating drought resistance and / or regulating anthocyanin content in rapeseed under drought stress. BnaMYB30 Overexpression significantly increases anthocyanin content under drought stress and enhances drought sensitivity.

[0005] Another object of the present invention is to provide an overexpression BnaMYB30 Application of recombinant vectors in improving anthocyanin content in rapeseed under drought stress.

[0006] Another objective of this invention is to provide a method for regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of the BnaMYB30 gene or protein in regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress.

[0008] Preferably, BnaMYB30 negatively regulates the drought resistance of rapeseed; BnaMYB30 positively regulates the anthocyanin content of rapeseed under drought stress.

[0009] Preferably, the BnaMYB30 is controlled by... BnaFLS1 and BnaUGT75C1 Genes regulate anthocyanin glycosylation and flavonol synthesis under drought stress.

[0010] Preferably, the BnaMYB30 is bound by the sequences SEQ ID NO:13 and SEQ ID NO:14. BnaFLS1 and BnaUGT75C1 Promoter regulation BnaFLS1 and BnaUGT75C1 The expression.

[0011] Preferably, the gene for BnaMYB30 is located at positions 45820979-45822485 on chromosome C07 of the Brassica napus reference genome version ZS11.v0.

[0012] This invention also provides an overexpression BnaMYB30 Application of recombinant vectors in improving anthocyanin content in rapeseed under drought stress.

[0013] Preferably, the method for constructing the recombinant vector includes: double digestion of the vector with restriction endonucleases to obtain a linearized vector; and obtaining the vector by PCR amplification. BnaMYB30 The CDS target segment; the said BnaMYB30 The CDS target fragment was homologously recombined into a linearized vector; the ligation product was transformed into E. coli DH5α competent cells by heat shock, and the plasmid was extracted after correct sequencing.

[0014] Preferably, the primer sequences for the PCR amplification include SEQ ID NO:1 to SEQ ID NO:2.

[0015] This invention also provides a method for regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress, the method comprising: regulating the anthocyanin content of rapeseed... BnaMYB30 To regulate the expression level of anthocyanins in rapeseed and its drought resistance and anthocyanin content under drought stress; to increase the expression level of anthocyanins in rapeseed. BnaMYB30 The expression level of [a substance] was reduced, thus decreasing the drought resistance of rapeseed and increasing the anthocyanin content of rapeseed under drought stress; the expression level of [a substance] in rapeseed was also reduced. BnaMYB30 The expression level of anthocyanins can be improved to enhance the drought resistance of rapeseed and reduce the anthocyanin content of rapeseed under drought stress.

[0016] Preferably, the method of increasing the rapeseed content BnaMYB30 The ways of expressing the level of expression include any one or more of the following: (1) Import BnaMYB30 Gene, causing the gene to be overexpressed; (2) Gene editing to modify endogenous genes BnaMYB30 Gene regulatory regions enhance transcription; (3) Application BnaMYB30 Gene promoter activators promote their expression; (4) Import and adjust BnaMYB30 Transcriptional regulators of gene expression.

[0017] Preferably, the reduction of rapeseed BnaMYB30 The ways of expressing the level of expression include any one or more of the following: (1) Import BnaMYB30 Gene silencing vectors suppress gene expression; (2) Gene editing to knock out or knock down endogenous genes BnaMYB30 Gene; (3) Application BnaMYB30 Gene promoter inhibitors weaken transcription; (4) Import downgrade BnaMYB30 Inhibitory regulators of gene expression.

[0018] The beneficial effects of this invention are: This invention screened core transcription factors through weighted gene co-expression network analysis and differential gene clustering. BnaMYB30 BnaMYB30 plays an important regulatory role in anthocyanin synthesis and drought resistance in rapeseed. It binds to... BnaUGT75C1 and BnaFLS1 The promoter participates in regulating the glycosylation of anthocyanins and the synthesis of flavonols, and activates key structural genes in the flavonoid synthesis pathway. CHI , F3H , DFR It significantly promotes the accumulation of anthocyanins. BnaMYB30 Overexpression lines lack effective ABA and JA hormone signaling regulation, resulting in a single stress response mode, reduced antioxidant enzyme activity, decreased reactive oxygen species scavenging capacity, and ultimately, a drought-sensitive phenotype. This invention discovers that by regulating... BnaMYB30 The expression level of this substance can effectively regulate the drought resistance of rapeseed and control its anthocyanin content under drought stress. This will contribute to the theoretical development of drought-resistant breeding of colored rapeseed, promote the sustainable growth of the colored rapeseed industry, enhance the diversified development of the rural economy, and promote the organic integration of modern agriculture with ecotourism and cultural industries. Attached Figure Description

[0019] Picture 1 WGCNA analysis of differentially expressed genes in purple-leaf (PL) and green-leaf (GL) Brassica napus under drought and rehydration treatments in Example 1. A is a hierarchical clustering tree and module partitioning diagram of differentially expressed genes, and B is a GO and KEGG enrichment network diagram of genes in the Yellow module. Picture 2 This is a heatmap of hierarchical clustering analysis of differentially expressed genes in purple-leaf (PL) and green-leaf (GL) Brassica napus varieties under the combined effects of material specificity and drought stress in Example 1. Picture 3 Phylogenetic analysis and amino acid sequence alignment of MYB30 in different species in Example 1; Picture 4 In Example 1 BnaMYB30 Gene cloning and subcellular localization analysis, where A is... BnaMYB30 The CDS amplification electrophoresis image, B is the recombinant vector. pBnaMYB30 A schematic diagram of the construction of -sGFP, where C represents... BnaMYB30 Subcellular localization, scale bar 10 μm; Picture 5 For the transfer in Example 1 BnaMYB30 Identification of gene-positive plants, where A is... BnaMYB30 PCR verification of transgenic lines, B is wild-type control WT, and M is DNA Marker; Picture 6 In Example 1 BnaMYB30 Relative expression levels in T1 generation lines; Picture 7 As the control and drought stress in Example 1 BnaMYB30 Phenotypic differences between overexpression lines and wild-type lines; Picture 8 For example, the drought stress in Example 1 MYB30 - The effect of OE on the content of chlorophyll a (A), chlorophyll b (B), and anthocyanin (C) in WT; according to the Turkey test, the figure shows... express p <0.05, , and They represent p <0.01, 0.001, and 0.0001, ns indicates no significant difference, as shown in the following figure; Picture 9 For example, under drought stress in Example 1 MYB30 - Differences in relative water content (RWC), electrical conductivity (EL), proline (Pro), and malondialdehyde (MDA) content between OE and WT; Picture 10 For example, under drought stress in Example 1 MYB30 Differences in the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) between OE and WT; Picture 11 For example, under drought stress in Example 1 MYB30 -OE and WT leaf histochemical staining: DAB staining indicates the accumulation of H2O2, and NBT staining indicates the amount of O2. ·— The accumulated amount; Picture 12 This is the construction of the Atmyb30 gene deletion mutant in Example 1, where A is a schematic diagram of T-DNA insertion and primer design, and B is the PCR verification of the Atmyb30 gene deletion mutant; Picture 13 The growth phenotypes of the three plants in Example 1; Picture 14Before and after drought stress in Example 2 MYB30 -Analysis of differentially expressed genes (DEGs) between OE and WT, where A is a bar chart of differentially expressed genes between different groups, and B is a Venn diagram analysis of common and specific differentially expressed genes under drought stress; Picture 15 Before and after drought stress in Example 2 MYB30 - GO (A) and KEGG (B) enrichment analysis of differentially expressed genes in OE; Picture 16 Enrichment analysis of GO (A) and KEGG (B) genes differentially expressed in WT before and after drought stress in Example 2; Picture 17 In Example 2 BnaMYB30 Effects of overexpression and drought stress on anthocyanin synthesis gene expression, where A is a heatmap of differential pathways of anthocyanin synthesis genes among different materials and treatments, and B is a cluster analysis of anthocyanin synthesis gene expression levels among different materials and treatments. Picture 18 Analysis of promoter cis-acting elements of 19 differentially expressed anthocyanin synthesis structural genes in Example 2; Picture 19 This example demonstrates molecular docking prediction and interaction site simulation between key transcription factors and candidate downstream target genes in Example 2, where A represents the BnMYB30 protein and... UGT75C1 Interaction structure prediction of the promoter (BnaC08G0116200ZS), B represents BnMYB30 protein and FLS1 Interaction structure prediction of (BnaC08G0286600ZS) promoter; Picture 20 In Example 2, BnaMYB30 and BnaUGT75C1 and BnaFLS1 Promoter interaction analysis, where A is yeast one-hybrid verification (including 70mM 3-AT screening), B is a schematic diagram of the dual-luciferase experimental vector structure, C is imaging of dual-luciferase activity in tobacco leaves, and D is the interaction between BnaMYB30 and promoters predicted by JASPAR. BnaUGT75C1 and BnaFLS1 Promoter binding sites (top five scores) and partial sequences, E is for verification by electrophoretic mobility variation assay (EMSA). Detailed Implementation

[0020] This invention provides the application of the BnaMYB30 gene or protein in regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress.

[0021] In this invention, BnaMYB30 negatively regulates drought resistance in rapeseed; BnaMYB30 positively regulates anthocyanin content in rapeseed under drought stress. BnaMYB30 negatively regulates drought resistance in rapeseed by inhibiting ABA-related stress response pathways. Increased BnaMYB30 expression levels lead to decreased drought resistance and increased anthocyanin content under drought stress; conversely, decreased BnaMYB30 expression levels lead to increased drought resistance and decreased anthocyanin content under drought stress.

[0022] In this invention, the BnaMYB30 is controlled by... FLS1 and UGT75C1 Genes are used to regulate the glycosylation of anthocyanins and the synthesis of flavonols under drought stress. The BnaMYB30 gene binds to the sequences SEQ ID NO:13 and SEQ ID NO:14. BnaFLS1 and BnaUGT75C1 Promoter regulation BnaFLS1 and BnaUGT75C1 The expression of these substances regulates the glycosylation of anthocyanins and the synthesis of flavonols.

[0023] This invention screened core transcription factors through weighted gene co-expression network analysis (WGCNA) and differential gene clustering. BnaMYB30 It plays an important regulatory role in anthocyanin synthesis and drought resistance in rapeseed. BnaMYB30 Overexpression lines exhibited high sensitivity to drought stress, with significantly decreased chlorophyll a content, weakened ROS scavenging ability, accompanied by insufficient proline accumulation and exacerbated membrane lipid peroxidation, ultimately leading to severe cell damage. BnaMYB30 binds to... BnaUGT75C1 and BnaFLS1 The promoter participates in regulating the glycosylation of anthocyanins and the synthesis of flavonols, and activates key structural genes in the flavonoid synthesis pathway. CHI , F3H , DFR It significantly promotes the accumulation of anthocyanins. BnaMYB30 Overexpression lines lack effective ABA and JA hormone signaling regulation, have a single stress response mode, resulting in reduced antioxidant enzyme activity, decreased reactive oxygen species scavenging capacity, and ultimately exhibit a drought-sensitive phenotype.

[0024] In this invention, the gene BnaMYB30 is preferably located at positions 45820979-45822485 on chromosome C07 of the Brassica napus reference genome version ZS11.v0, with the gene ID BnaC07G0316500ZS.

[0025] This invention also provides an overexpression BnaMYB30 Application of recombinant vectors in improving anthocyanin content in rapeseed under drought stress.

[0026] In this invention, the method for constructing the recombinant vector is not particularly limited and can be conventionally selected according to actual needs. In some embodiments, the method for constructing the recombinant vector preferably includes: double digestion of the vector with restriction endonucleases to obtain a linearized vector; and obtaining the vector by PCR amplification. BnaMYB30 The CDS target segment; the said BnaMYB30 The CDS target fragment was homologously recombined into a linearized vector; the ligation product was transformed into E. coli DH5α competent cells by heat shock, and the plasmid was extracted after correct sequencing.

[0027] In this invention, the carrier preferably comprises 35S- p CAMBIA1300-sGFP. The 35S- p CAMBIA1300-sGFP is in p sGFP was inserted into CAMBIA1300; the insertion method is not particularly limited and can be conventionally selected according to actual needs. In some embodiments, the insertion method preferably includes: amplifying the sGFP sequence by PCR, adding a Sal I restriction enzyme to the 5' end of the upstream primer, and adding a Pst I restriction enzyme to the 5' end of the downstream primer; digesting the PCR product with Sal I and Pst I and then ligating it into pCAMBIA1300 digested with the same enzymes to obtain 35S- p CAMBIA1300-sGFP.

[0028] In some embodiments of the present invention, the restriction endonuclease preferably includes BamHI and XbaI.

[0029] In some embodiments of this invention, the double enzyme digestion reaction system preferably comprises: 2 µL of 10× QuickCut Buffer, 1 µg of 35S- p The CAMBIA1300-sGFP vector DNA, 1 µL of QuickCut BamHI, and 1 µL of QuickCut XbaI were added, and finally, ddH2O was added to bring the total volume to 20 µL. The preferred reaction temperature for the double digestion was 35–40 °C, for example, 35, 36, 37, 38, 39, or 40 °C; the preferred reaction time was 10–20 min, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 min. After the reaction was complete, the temperature was preferably lowered to 4 °C, and the digested products were directly recovered using the FastPure Gel DNA Extraction Mini Kit.

[0030] In some embodiments of this invention, the primer sequences for PCR amplification preferably include SEQ ID NO:1~SEQ ID NO:2. The PCR amplification system preferably includes: 12.5 µL of 2×Master Mix, 1 µL of upstream primer (10 μmol / L), 1 µL of downstream primer (10 μmol / L), 1 µL of cDNA template, and finally, ddH2O to a total volume of 25 µL. The preferred PCR amplification reaction program is: pre-denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 30 s → annealing at 57 °C for 30 s → extension at 72 °C for 1 min; final extension at 72 °C for 5 min, followed by cooling to 4 °C after the reaction. The annealing temperature can be adjusted appropriately according to the primers used. The PCR products are preferably separated by 1% agarose gel electrophoresis, and the target fragment is recovered using the FastPure Gel DNA Extraction Mini Kit.

[0031] In some embodiments of this invention, the homologous recombination reaction system preferably comprises: (0.02 × total base pairs of the vector) ng of linearized vector, (0.04 × total base pairs of the target fragment) ng of target gene fragment, 4 µL of 5 × CEII Buffer, 2 µL of Exnase II, and finally supplemented with ddH2O to a total volume of 20 µL. The preferred reaction temperature for homologous recombination is 35–40 °C, for example, 35, 36, 37, 38, 39, or 40 °C; the preferred reaction time is 20–40 min, for example, 20, 25, 30, 35, or 40 min.

[0032] In some embodiments of the present invention, plasmids are preferably extracted using the TIANprep Mini Plasmid Kit plasmid extraction kit.

[0033] This invention also provides a method for regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress, the method comprising: regulating the anthocyanin content of rapeseed... BnaMYB30 The expression level of [a specific substance] can be used to regulate the drought resistance of rapeseed and the anthocyanin content of rapeseed under drought stress.

[0034] In this invention, the content of rapeseed is increased BnaMYB30 The expression level of [a substance] was reduced, thus decreasing the drought resistance of rapeseed and increasing the anthocyanin content of rapeseed under drought stress; the expression level of [a substance] in rapeseed was also reduced. BnaMYB30 The expression level of anthocyanins can be improved to enhance the drought resistance of rapeseed and reduce the anthocyanin content of rapeseed under drought stress.

[0035] In this invention, the content of rapeseed is increased BnaMYB30 The expression level of [a substance] was reduced, inhibiting the ABA-related stress response pathway, decreasing antioxidant enzyme activity and ROS scavenging capacity, and reducing drought resistance in rapeseed; [the substance] also decreased the [content] in rapeseed. BnaMYB30The expression level of [the substance] can reduce the inhibition of ABA-related stress response pathways, increase the activity of antioxidant enzymes and ROS scavenging capacity, and improve the drought resistance of rapeseed.

[0036] In this invention, the method of improving the rapeseed content BnaMYB30 There are no specific limitations on the way the level of expression is expressed, but it is preferable to include any one or more of the following: (1) Import BnaMYB30 Gene, causing the gene to be overexpressed; (2) Gene editing to modify endogenous genes BnaMYB30 Gene regulatory regions enhance transcription; (3) Application BnaMYB30 Gene promoter activators promote their expression; (4) Import and adjust BnaMYB30 Transcriptional regulators of gene expression.

[0037] In this invention, the reduction of rapeseed BnaMYB30 There are no specific limitations on the way the level of expression is expressed, but it is preferable to include any one or more of the following: (1) Import BnaMYB30 Gene silencing vectors suppress gene expression; (2) Gene editing to knock out or knock down endogenous genes BnaMYB30 Gene; (3) Application BnaMYB30 Gene promoter inhibitors weaken transcription; (4) Import downgrade BnaMYB30 Inhibitory regulators of gene expression.

[0038] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Unless otherwise specified, the following embodiments are all conventional methods.

[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0041] Example 1 1. Transcriptome data analysis This study used purple-leaved colored rapeseed (PL) and a green-leaved control (GL) with a similar background. Both were derived from the segregating population of the same rapeseed inbred line and maintained relatively consistent phenotypic characteristics across multiple inbred generations. Both PL and GL were subjected to drought treatments for 0 days (control), 4 days, 8 days, and 4 days of rehydration, respectively. RNA sequencing analysis was performed on 24 samples to identify differentially expressed genes. Weighted co-expression network analysis (WGCNA) and differential gene clustering analysis were performed on the transcriptome data using the MetWare online analysis platform and IDEP 2.01. Hierarchical clustering analysis was performed on DEGs with similar expression patterns across different materials and treatments using IDEP 2.01, employing Pearson correlations and k-means (k=5) algorithms. The clustering results were visualized as heatmaps, as shown below. Picture 1 and Picture 2 As shown.

[0042] like Picture 1 As shown in Figure A, the differentially expressed genes were divided into 23 co-expressed gene modules, with high co-expression levels within each module. Screening of these modules using anthocyanin synthesis structural genes revealed that most of these structural genes were concentrated in the Yellow module. All differentially expressed genes within these modules were extracted and subjected to GO and KEGG enrichment analyses, as shown below. Picture 1 As shown in Figure B, these genes were found to be significantly enriched in biological processes, functions, and cellular components such as small molecule metabolic processes, oxidoreductase activity, and chloroplasts. Furthermore, KEGG enrichment analysis revealed that these genes are primarily concentrated in the synthesis of secondary metabolites. This indicates that these genes include structural genes related to anthocyanin synthesis, as well as functional genes responding to drought stress.

[0043] Focusing on transcription factors in the Yellow module, we discovered... BnaMYB30 All four homologous genes were present in the Yellow module, and the kWithin values ​​of two of these genes ranked among the top three of all screened MYB transcription factors, indicating that they have high connectivity with the structural genes in the Yellow module. At the same time, the gene expression levels were obtained based on transcriptome data.

[0044] Hierarchical clustering analysis results show that BnaMYB30 upstream genes in the anthocyanin synthesis pathway C4H and FLS They have more similar expression patterns. Therefore, it was finally confirmed that... BnaMYB30(BnaC07G0316500ZS) was used as a key gene for subsequent experimental research.

[0045] 2. Phylogenetic analysis and conserved domain analysis of MYB30 The amino acid sequence of BnaMYB30 was obtained from the reference genome of Brassica napus (ZS11.v0). BLAST was performed using the NCBI (https: / / ncbi.nlm.nih.gov) and BnIR (https: / / yanglab.hzau.edu.cn / BnIR / ) databases to search for its orthologous proteins in Arabidopsis thaliana, Chinese cabbage, Brassica rapa, Brassica napus, Ethiopian mustard, black mustard, tomato, tobacco, rice, and maize to obtain the corresponding amino acid sequences.

[0046] Cluster analysis of the amino acid sequences of MYB30 from different species was performed using MEGA11 software. The amino acid domains of MYB30 from different species were predicted using the BnIR database and the SMART online analysis platform (https: / / embl-heidelberg.de). The results are as follows: Picture 3 As shown.

[0047] The results showed that BnaMYB30 (BnaC07G0316500ZS) and Ethiopian mustard BcaMYB30 (BcaC06g33651) clustered in the same clade, indicating a high degree of sequence similarity and a possible origin from a common ancestral C subgenome. Furthermore, they exhibited high evolutionary conservation within the Brassicaceae family, suggesting similar biological functions. Maize ZmMYB30 (XP_008652703.1) and rice OsMYB30 (KAB8108656.1) clustered separately, showing differences from BnaMYB30 at multiple amino acid sites, suggesting that this gene may have different functions in monocots and dicots. Conserved domain analysis revealed that the MYB30 protein in all species contains the typical R2R3-MYB domain (PF00249), which is relatively conserved in dicots.

[0048] 3. Subcellular localization analysis (1) Extraction of DNA and RNA and synthesis of cDNA DNA was extracted using a high-efficiency plant genomic DNA extraction kit (DP350, Tiangen), and total RNA was extracted using the SteadyPure Universal RNA Extraction Kit (AG21022). Extraction methods were performed according to the respective kit instructions. Total RNA was extracted from leaves of purple-leaved Brassica napus. cDNA synthesis was performed using the extracted RNA. Long-fragment cDNA templates were synthesized using the HiScript II 1st Strand cDNA Synthesis Kit (R212-01, Vazyme) for subsequent CDS sequence cloning. The reverse transcription system and reaction conditions were as per the kit instructions.

[0049] (2) Enzymatic digestion and recovery of the vector Subcellular localization and the construction of target gene overexpression materials both used the laboratory-preserved 35S-pCAMBIA1300-sGFP vector. BamH I and Xba I restriction endonuclease (QuickCut) TM Linearization was achieved by double digestion with Takara enzyme. The reaction mixture consisted of 2 µL of 10× QuickCut Buffer, 1 µg of vector DNA, and 1 µL of QuickCut Buffer. BamH I, 1µL QuickCut Xba First, add ddH2O to bring the total volume to 20µL. Mix well and react at 37℃ for 15min. After the reaction is complete, cool to 4℃. The enzyme digestion product is directly recovered using the FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme) and stored at -20℃ for later use.

[0050] (3) Acquisition of gene sequences and synthesis of CDS sequences Based on the reference genome of Brassica napus (ZS11.v0) BnaMYB30 The CDS sequence information of (gene ID: BnaC07G0316500ZS), combined with 35S- p Based on the upstream and downstream sequences of the CAMBIA1300-sGFP vector restriction enzyme sites, specific amplification primers for homologous recombination were designed using the Vazyme online primer design platform (https: / / crm.vazyme.com / cetool.html) (Table 1). Using the synthesized cDNA as a template, high-fidelity enzyme 2×Phanta MaxMaster Mix (Dye Plus) was used to... BnaMYB30The CDS sequence was amplified using a PCR system consisting of 12.5 µL of 2×MasterMix, 1 µL of upstream primer (10 μmol / L), 1 µL of downstream primer (10 μmol / L), 1 µL of cDNA template, and finally, ddH2O to a total volume of 25 µL. The reaction program was as follows: pre-denaturation (95 °C, 3 min), 35 cycles of denaturation (95 °C, 30 s) → annealing (57 °C, 30 s) → extension (72 °C, 1 min), final extension (72 °C, 5 min), followed by cooling to 4 °C (the specific annealing temperature can be adjusted according to the primers used). The obtained PCR products were separated by 1% agarose gel electrophoresis. The gel containing the target fragment was excised and the target fragment was recovered using the FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme).

[0051] Table 1 Primers for homologous recombination fragment amplification

[0052] The results of 1% agarose gel electrophoresis showed that ( Picture 4 (A) BnaMYB30 The amplified product band was approximately 1000 bp in size, consistent with the 1002 bp sequence length in the reference genome.

[0053] (4) Construction of the carrier Using the linearized vector after enzyme digestion and the obtained CDS target fragment, the ClonExpress MultiS OneStep Cloning Kit (C113-01, Vazyme) was used to... BnaMYB30 Homologous recombination to 35S- p The recombinant plasmid constructed on the CAMBIA1300-sGFP vector is denoted as [insert denot here]. pBnaMYB30 -sGFP ( Picture 4 (Medium B). The reaction system consisted of: [0.02 × total base pairs of the vector] ng of linearized vector, [0.04 × total base pairs of the fragment] ng of the target gene fragment, 4 µL of 5 × CE II Buffer, 2 µL of Exnase II, and finally, ddH2O to a total volume of 20 µL. After mixing, the mixture was incubated at 37 °C for 30 min and then cooled on ice.

[0054] The ligation product was transformed into *E. coli* DH5α competent cells (Shanghai Weidi Biotechnology) using a heat shock method. Randomly selected positive single colonies were verified by colony-mediated PCR. Products with the correct band length were sequenced, and the amplified CDS sequence was found to be completely identical to the reference genome sequence. Plasmids were extracted using the TIANprep Mini Plasmid Kit (Tiangen). pBnaMYB30 -sGFP, refer to the kit instructions for specific steps.

[0055] After extraction and testing to ensure that the concentration and quality meet the standards... pBnaMYB30 -sGFP plasmid was transformed into Agrobacterium GV3101 competent cells (Shanghai Weidi Biotechnology) using the freeze-thaw method. After the positive colonies were confirmed to have bands by PCR, they were mixed with 50% glycerol at a 1:1 volume ratio and stored at -80℃ for later use.

[0056] (5) Subcellular localization analysis Subcellular localization of the BnaMYB30 protein was observed using an Agrobacterium-mediated transient expression system in tobacco epidermal cells. Flat leaves with a deep green color from 3-4 week old tobacco plants were selected and transiently transformed using preserved Agrobacterium. The transient expression resuspension (OD600=1.0) contained 10 mM / L MgCl2, 10 mM / L MES, and 0.1 mM / L acetylsylcholine. Tobacco samples were collected 24-48 h after injection of the transient expression resuspension and incubated in 2 µg / mL DAPI solution in the dark for 15-30 min for nuclear staining. Fluorescence signals were observed using a laser confocal microscope (Nikon AI-SHS, Japan).

[0057] The results showed that BnaMYB30 The green fluorescence signal of -sGFP completely overlaps with the DAPI-stained nuclear region (blue channel), indicating that the BnaMYB30 protein is localized in the cell nucleus. Picture 4 (C). The negative control, using an empty plasmid, showed uniform fluorescence distribution throughout the cell, without nuclear-specific aggregation. (Note: This likely refers to a specific cell type or parameter.) BnaMYB30 The proteins of the gene are all located in the cell nucleus, consistent with their functional characteristics as transcription factors.

[0058] 4. Screening and validation of genetically transformed lines (1) Genetic transformation of rapeseed The same method as described in the above experiment was used to construct and obtain pBnaMYB30 The -sGFP plasmid was then transformed into Agrobacterium GV3101 competent cells using the same method to obtain cells carrying the plasmid. pBnaMYB30 The GV3101 strain carrying the -sGFP plasmid was used via Agrobacterium-mediated transformation. pBnaMYB30 The GV3101 strain with the -sGFP plasmid achieved genetic transformation of rapeseed under sterile conditions.

[0059] The Westar inbred line, a common variety of Brassica napus, was selected as the genetic transformation recipient material. Seeds were rigorously screened and stored in a dry environment at 4℃ for later use. The aseptic seedling culture conditions were: temperature 25℃, relative humidity 60%–70%, no light during the dark culture stage, and a light intensity of 60 μmol / m² during the light culture stage. -2 s -1 The photoperiod is 16 hours of light / 8 hours of darkness. The genetic transformation process is as follows: a. Seed sterilization and aseptic seedling culture: Take 200 Westar seeds and place them in a 50mL centrifuge tube. Add 75% ethanol and soak for about 1 minute, gently shaking during the process. After discarding the ethanol, add 1.5% HgCl2 solution and soak for about 15 minutes. Rinse 4 times with sterile water. Sow the sterilized seeds evenly on M0 medium, about 20 seeds per dish, and culture at 24℃ in the dark for 6 days.

[0060] b. Agrobacterium activation and bacterial culture preparation: The preserved strain was streaked onto LB agar containing the appropriate antibiotic and incubated at 28°C for 48 hours. A single colony was picked and inoculated into a 10 mL centrifuge tube containing 4 mL of liquid LB (containing 50 mg / L Kan and 50 mg / L Rif), and incubated at 28°C with shaking at 200 rpm for 14–16 hours until OD (Organic Dioxide) was reached. 600 ≈0.6; Take 4 mL of bacterial culture into a sterile centrifuge tube, centrifuge at 3000 rpm for 3 min, discard the supernatant, resuspend twice in DM medium, and finally dilute to OD0.6. 600 =0.6~0.8, keep at 4℃.

[0061] c. Explant preparation and infection: Take 6-day-old sterile seedlings, cut off the hypocotyl and cut it into small segments of 0.8~1.0cm, place them in a culture dish with DM medium to keep them moist; immerse the explants in the prepared Agrobacterium suspension for 30min, gently shaking them several times during the process; after removing them, use sterile filter paper to absorb the bacterial solution on the surface of the explants, transfer them to M1 medium, and incubate at 24℃ in the dark for 48h.

[0062] d. Co-culture and screening for differentiation: After co-culture, the explants were transferred to medium containing M2 and cultured under light for 3 weeks to induce callus formation; the callus was transferred to medium M3 and subcultured every 2-3 weeks to screen for differentiated green shoots; when the green shoots grew to 2-3 cm, the complete growing point was cut off and transferred to medium M4 to induce rooting.

[0063] e. Identification and screening of positive plants: DNA was extracted from the transgenic plants screened in hygromycin-resistant medium. The target gene was amplified by PCR according to the method in the above experiment "(3) Acquisition of gene sequence and synthesis of CDS sequence" (primer sequences are shown in Table 1). After band detection by 1% agarose gel electrophoresis and sequencing identification, the positive seedlings were transplanted to the greenhouse for cultivation. After flowering, they were bagged and self-pollinated for seed collection.

[0064] During the tissue culture stage, explants transformed with Agrobacterium were inoculated onto a selection medium containing 50 mg / L hygromycin (Hyg). Continuous selection ensured that the resulting explants exhibited Hyg resistance, guaranteeing the transfer of the vector plasmid. Next, the green shoots were transferred to a rooting medium. Once roots had developed and the seedlings were relatively robust, they were transplanted into substrate soil and cultured in a greenhouse. After the seedlings adapted to the soil culture environment and grew normally, DNA was extracted from young leaf tissue using 35S-... p PCR amplification of the target gene was performed using specific primers on the CAMBIA1300-sGFP vector. 1% agarose gel electrophoresis showed... BnaMYB30 All transgenic plants amplified the target band, and the fragment length was consistent with the corresponding sequence length, while WT showed no specific product. Picture 5 (AB). The PCR products were sequenced, and sequence consistency was confirmed by BLAST alignment. Plants with completely correct sequences were selected for further culture. After flowering, artificial self-pollination was performed using the bagging method to prevent cross-pollination from contaminating the genetic background. After maturity, T1 generation seeds were harvested, dried, and stored at 4℃ for subsequent generation propagation and phenotypic analysis.

[0065] (2) Screening and treatment of genetically transformed lines Using the self-pollinated progeny lines of the selected positive seedlings as experimental materials, and the Westar inbred line of the conventional rapeseed variety as a wild-type control (WT), physiological indicators under drought stress were determined. When the seedlings grew to 2-3 true leaves, RNA was extracted from the seedling leaves to determine the expression level of the target gene. Primers were designed using Primer Premier 5.0 based on the sequencing results in the above experiment "(4) Vector Construction" combined with the gene sequence of the reference genome (Table 2). Two lines with high expression of the target gene were selected and transferred to soil for culture (nutrient soil: vermiculite = 1:1) for subsequent physiological indicator determination.

[0066] Table 2 Primers for quantitative fluorescence detection

[0067] To screen transgenic lines with stable and high expression of target genes, total RNA was extracted from young leaves of T1 generation seedlings, and the expression levels of key genes were analyzed by qRT-PCR, such as... Picture 6 As shown, in the T1 generation transgenic lines BnaMYB30 The expression level was significantly higher than that of wild-type (WT), and it was finally selected. BnaMYB30 -OE1、 BnaMYB30 -OE2 was used as the material for subsequent experiments.

[0068] (3) BnaMYB30 Phenotypic characteristics of overexpression lines under drought stress right BnaMYB30-OE1、 BnaMYB30 Phenotypic observations and physiological index measurements were performed on OE2 and wild-type (WT) materials under drought stress. When seedlings reached 3-4 true leaves, a 10-day cessation of watering was used as the drought stress treatment condition, with normal conditions serving as the control. The experiment was divided into 6 treatment groups: MYB30-OE1_CK: 20 plants randomly selected BnaMYB30 Seedlings with uniform appearance phenotype in gene-high expression line 1 were cultured under normal conditions; MYB30-OE1_D: 20 plants randomly selected BnaMYB30 Stop watering seedlings with uniform appearance phenotype in gene-high expression line 1 for 10 days; MYB30-OE2_CK: 20 plants were randomly selected. BnaMYB30 Seedlings with identical appearance phenotypes in gene-high expression line 2 were cultured under normal conditions; MYB30-OE2_D: 20 plants were randomly selected. BnaMYB30 Stop watering seedlings with uniform appearance in the gene-high expression line 2 for 10 days; WT_CK: Twenty seedlings with identical appearance and phenotypes were randomly selected and cultured under normal conditions; WT_D: Randomly select 20 seedlings of wild type material with the same appearance and phenotype and stop watering for 10 days; Take photos to record the growth on the tenth day after stopping watering. For example... Picture 7 As shown in Figure A, there was no significant difference in growth between the overexpression material and the wild-type material under control conditions. However, significant phenotypic differences were observed under drought stress treatment. BnaMYB30 -OE (hereinafter referred to as OE) MYB30 -OE is more sensitive to drought stress than WT, showing obvious leaf wilting and wrinkling, petiole bending and drooping, and growth and development are severely affected. Picture 7 (B)

[0069] (4) Under drought stress MYB30 Physiological phenotype analysis of -OE and WT Under drought stress BnaMYB30 -OE1、 BnaMYB30 Physiological indicators such as photosynthetic pigment content, anthocyanin content, osmotic regulation capacity, ROS accumulation, and antioxidant enzyme activity of OE2 and wild-type WT were systematically measured.

[0070] Regarding pigment content, such as Picture 8 As shown in Figure A, under drought stress, BnaMYB30The chlorophyll a content of the -OE2 line was significantly lower than that of the control, while the chlorophyll a level of the WT line did not show a significant difference before and after drought treatment. Similarly, both materials showed a significant increase in chlorophyll b content under drought stress. BnaMYB30 The increase was more significant in the -OE2 strain, being 2.46 times that of the control condition. Picture 8 (B) Regarding anthocyanin content, the wild-type material did not show a significant increase under drought stress, while MYB30 -OE materials all showed significant accumulation of anthocyanin content under drought stress, especially BnaMYB30 In the -OE1 line, anthocyanin content was upregulated by 24.8% compared to the control, indicating that the MYB30 gene significantly promoted anthocyanin synthesis under drought stress. Figure 8 (C)

[0071] Physiological indicators such as relative water content (RWC), electrical conductivity (EL), proline (Pro), and malondialdehyde (MDA) content were measured to investigate... MYB30 - Differences between OE and WT in terms of moisture regulation and oxidative damage.

[0072] After drought treatment, MYB30 Both -OE and WT showed significantly lower RWC compared to the control, and under drought stress MYB30 -OE's RWC is significantly lower than WT, indicating MYB30 -OE has a weaker water retention capacity than WT. Figure 9 (A). Similarly, under control conditions, MYB30 Both -OE and WT EL remained at low levels, but showed a rapid increase after drought treatment, and MYB30 The increase in -OE is more significant than that in WT. BnaMYB30 The percentage of cells in the -OE2 strain reached approximately 80%, indicating severe cell membrane damage under drought stress. Figure 9 (Middle B). For example Figure 9 As shown in Figure C, under drought stress, WT responds to stress damage through the large accumulation of Pro, although MYB30 The content of -OE also increased, but compared to the 2.23-fold increase in WT, the two overexpression lines only increased by 1.14 and 0.48 times respectively compared to the control. The Pro content under drought stress was significantly lower than that in WT, reflecting the fact that... MYB30 -OE has a relatively limited ability to regulate osmotic pressure. Malondialdehyde is a product of lipid peroxidation, and due to stress damage, MYB30 The MDA content in both OE and WT was increased after drought treatment. BnaMYB30 The upregulation of MDA content in the -OE2 strain was more significant than that in the WT strain, indicating more severe oxidative damage under stress. Figure 9 (D).

[0073] Regarding antioxidant enzyme activity, drought stress significantly increased it. MYB30 -OE and SOD content in WT, but this increase is more significant in WT, and SOD activity in WT under drought stress is still significantly higher than that in WT. BnaMYB30 -OE1 strain, and BnaMYB30 The content of -OE2 strain and WT under different treatments was not significantly different. Figure 10 (A). Regarding the differences in POD activity, POD increased sharply after drought stress, upregulated by 7.33 times in WT, while BnaMYB30 The level was upregulated by 3.81 times in the -OE1 line under drought stress. BnaMYB30 The POD content in the -OE1 strain was significantly lower than that in the WT strain, while BnaMYB30 The -OE2 line showed an upregulation of 6.76-fold, and under drought stress, there was no significant difference compared to the WT line. Figure 10 (B). Regarding CAT activity, the content in WT under drought stress was relatively low. MYB30 -OE increased significantly, showing a correlation with BnaMYB30 Significant differences in the -OE2 strains ( Figure 10 (C). Regarding APX activity, the upregulation of APX content in WT was more pronounced after drought stress, showing a 2.96-fold increase. MYB30 The upregulation in -OE was less than 2-fold, while APX activity in WT was significantly higher under drought stress than in WT. MYB30 -OE two strains ( Figure 10 (D). In general, BnaMYB30 Overexpression significantly inhibited the activation of SOD, POD, CAT and APX responses under drought-induced conditions, reduced the plant's ROS scavenging capacity, led to the accumulation of oxidative damage, and thus exacerbated the drought sensitivity of overexpressing lines.

[0074] The concentrations of hydrogen peroxide (H2O2) and superoxide anion (O2) in leaves were visualized using a diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining method. ·— The distribution and intensity of ( ). For example Figure 11 As shown, compared to the wild type, all materials under drought stress exhibited significant H2O2 (dark brown precipitate) and O2 content. ·— The accumulation of (blue spots) indicates that drought stress promotes a large accumulation of ROS. Significant differences also exist in the degree of ROS accumulation and its spatial distribution among different genotypes. MYB30 -OE leaves under drought stress showed patches of darker blue spots, while WT leaves showed partial accumulation around the veins, indicating that MYB30 - Higher O2 in OE ·— Content. Similarly, MYB30The dark brown precipitate in -OE is darker and covers a larger area than that in WT, indicating a greater accumulation of H2O2.

[0075] 5. Validation in Arabidopsis thaliana Atmyb30 gene deletion mutants were constructed by silencing the Atmyb30 gene through T-DNA insertion. A schematic diagram of T-DNA insertion and primer design is shown below. Figure 12 As shown in Figure A, using the genomic DNA of the candidate plant as a template, amplification was performed using LP+RP primer combinations and BP+RP primer combinations, respectively. The results are shown below. Figure 12 As shown in Figure B, amplification with the LP+RP primer combination yielded no obvious bands, indicating that the wild-type gene fragment in the sample had been disrupted by T-DNA insertion, and no complete wild-type gene was present. Amplification with the BP+RP primer combination yielded clear bands, indicating that the T-DNA had successfully inserted into the corresponding region of the target gene.

[0076] Constructing Arabidopsis BnaMYB30 Overexpression lines ( BnaMYB30 -OE), with wild-type Arabidopsis thaliana (Col-0) and the successfully constructed Atmyb30 gene deletion mutant as controls. The three plants were placed under normal growth conditions (CK), 1 μM abscisic acid (ABA) treatment, and 200 mM mannitol (simulated drought) treatment, respectively. After uniform cultivation, the growth phenotypes of the three plants were observed and compared. The results are as follows: Figure 13 As shown.

[0077] It can be seen that under normal growth conditions, there were no significant differences in the growth phenotypes of the three; under 1 μM ABA treatment, BnaMYB30 -OE grew normally, while Atmyb30 growth was severely inhibited; under 200mM mannitol treatment... BnaMYB30 -OE root growth was inhibited, while Atmyb30 had a well-developed root system and relatively better growth; this indicates that the Atmyb30 mutant is more sensitive to ABA, has a stronger drought stress response, a more developed root system under simulated drought conditions, and higher drought resistance; BnaMYB30 Plants that overexpress ABA are less sensitive to ABA, have a weaker ability to respond to drought stress, and show suppressed root growth and poorer drought resistance under simulated drought conditions.

[0078] Example 2 1. MYB30 Differential gene expression analysis between OE and WT In order to investigate BnaMYB30 The functions of plant drought stress response and anthocyanin synthesis were selected. BnaMYB30 -OE2 strain (hereinafter referred to as MYB30Transcriptome analysis was performed on samples from wild-type controls (OE) and wild-type controls (WT) under normal conditions and under drought stress treatment with 10 days of withheld irrigation. Results are as follows: Figure 14 As shown in Figure A. MYB30 -OE exhibits different gene expression characteristics compared to WT under drought stress. MYB30 -OE already has a number of constitutively differentially expressed genes under normal conditions, but under drought stress, the differences between the two materials further widen. MYB30 More genes in the -OE strain showed suppressed expression, indicating BnaMYB30 It exhibits a regulatory pattern that suppresses expression under drought stress.

[0079] Venn diagram analysis was performed on the differentially expressed genes between the two materials under drought stress. Figure 14 (B) It was found that under drought stress MYB30 Differential gene expression between -OE and WT exhibits both common regulatory patterns and significant material specificity. These specific differentially expressed genes may be involved in unique biological processes or regulatory levels, resulting in differences in drought resistance between the two materials.

[0080] 2. Under drought stress MYB30 Differential gene enrichment analysis between OE and WT To further explore BnaMYB30 The role of anthocyanins in drought stress response was investigated, and the mechanisms underlying differences in drought stress response among different materials were analyzed. MYB30 -OE and WT were subjected to GO and KEGG enrichment analyses of DEGs before and after drought stress, respectively. Figure 15 and Figure 16 ).

[0081] MYB30 MYB30-OE and WT exhibit significant regulatory network differentiation. GO and KEGG enrichment revealed that WT primarily responds to drought stress damage by activating basic drought resistance pathways such as hormone signaling, metabolic defense, and photosynthetic maintenance. In contrast, MYB30-OE is specifically enriched in ribosome function, demonstrating a singular stress response mechanism. Based on the physiological data from Example 1, it is inferred that MYB30-OE promotes anthocyanin synthesis under drought stress by specifically activating the flavonoid pathway, while anthocyanin accumulation in WT is limited due to metabolic diversion to the isoflavone pathway.

[0082] 3. Under drought stress MYB30 Expression analysis of anthocyanin structural genes in -OE and WT Seventeen structural genes encoding enzymes related to the anthocyanin synthesis pathway were screened from DEGs of different materials and treatments. These included: four chalcone isomerase (CHI) genes, four flavanone 3-hydroxylase (F3H) genes, two flavanone 3'-hydroxylase (F3'H) genes, four flavonol synthase (FLS) genes, and one each of dihydroflavonol reductase (DFR) gene, anthocyanin synthase (ANS) gene, and UDP-flavonoid glucosyltransferase (UFGTs) gene.

[0083] Based on its corresponding position in the anthocyanin synthesis pathway and the changes in its expression levels in different comparison groups, a pathway heatmap was created for a visual representation. BnaMYB30 The effects of drought stress on the expression of anthocyanin synthesis structural genes. Figure 17 As shown in Figure A, drought stress significantly induced MYB30 -OE and WT showed upregulation of most anthocyanin synthesis genes. In particular, the expression of two F3'H genes was significantly downregulated under drought stress, with BnaC01G0156000ZS showing the following: MYB30 Downregulated in -OE, while BnaA01G0125700ZS and BnaC01G0156000ZS were downregulated in WT. Among the upregulated genes, CHI (BnaC06G0193800ZS) F3H (BnaC08G0427800ZS) DFR (BnaC09G0215200ZS) and FLS (BnaA02G0404600ZS, BnaA02G0404600ZS) under drought stress MYB30 It showed a significant upregulation in -OE. FLS (BnaC08G0286600ZS) and UGT75C1 (BnaC08G0116200ZS) showed good performance under both control and drought treatments. MYB30 - Significant difference between OE and WT.

[0084] Clustering heatmap analysis of these differentially expressed genes revealed that approximately two-thirds of the key structural genes showed changes under drought stress. MYB30 Higher expression in -OE materials, including early synthetic genes CHI , F3H Late-stage synthetic genes DFR and flavonol synthase gene FLS ( Figure 17 (B) (speculation) MYB30 -OE induces the upregulation of structural genes in a large number of flavonoid pathways under drought stress, synthesizing antioxidant metabolites such as anthocyanins and flavonols to alleviate drought stress damage.

[0085] 4. Analysis of promoter cis-regulatory elements of differentially expressed genes in the anthocyanin synthesis pathway The promoter cis-regulatory elements of these structural genes were analyzed. Figure 18 Using PlantCARE online analysis software, cis-acting element analysis was performed on the 2000bp promoter sequences of the 19 differentially expressed structural genes enriched above. Visualization using TBtool revealed the widespread presence of MYB binding sites (MBS, MYB, MYB-like sequences) and various hormone and stress response elements (such as ABRE, DRE, highly repetitive TC sequences, G-box, etc.) on the promoters of anthocyanin synthesis structural genes, suggesting that their expression may be synergistically regulated by multiple signaling pathways. It is speculated that key transcription factors may synergistically activate the expression of these structural genes by integrating multiple signals such as ABA, JA, and ROS.

[0086] 5. BnMYB30 Prediction of downstream target genes Based on the PlantTFDB-based Retrieve Regulation module, for key transcription factors BnaMYB30 Predicting downstream target genes revealed that in BnaMYB30 The predicted target genes included the three key structural genes screened above, including two... FLS1 Genes (BnaA06G0169300ZS, BnaC08G0286600ZS) and UGT75C 1 (BnaC08G0116200ZS). In FLS1 In the promoter of (BnaA06G0169300ZS), two possible binding sites were predicted: TTACCAACCACCCAA (SEQ ID NO:9) / TCCTCACCTACCACT (SEQ ID NO:10). FLS1 Three possible binding sites were predicted in the promoter of (BnaC08G0286600ZS): TTACCAACCACCCAA (SEQ ID NO:9) / TCCTCACCTACCACT (SEQ ID NO:10) / CTCTCAACCACCATA (SEQ ID NO:11). UGT75C1 The binding site TCCACACCCACCAAC (SEQ ID NO:12) was predicted. The presence of these binding sites was confirmed based on the promoter sequence in the reference genome. Simultaneously, based on... Figure 17 The expression changes of these three genes in different groups revealed that all three genes showed differential expression between overexpression materials and wild-type materials, especially FLS1(BnaC08G0286600ZS) and UGT75C1 (BnaC08G0116200ZS) showed significant differences between the two materials under both control and drought stress conditions.

[0087] Based on the above prediction results, the BnMYB30 protein and its derivatives were predicted using AlphaFold and HDOCK servers. FLS1 (BnaC08G0286600ZS) and UGT75C1 The structural model and interaction sites of the (BnaC08G0116200ZS) promoter (1500bp) were analyzed. The model with the highest confidence was submitted to PyMOL software for visualization. The gray chain represents the protein sequence, the green chain represents the candidate target gene promoter sequence, and the hydrogen bonds between them are indicated by red dashed lines. Figure 19 The directional and specific interactions between proteins and their ligands primarily rely on hydrogen bonds, which play a crucial role in protein recognition of specific DNA sequences. It was found that BnaMYB30 can interact with... FLS1 (BnaC08G0286600ZS) and UGT75C1 The promoter of (BnaC08G0116200ZS) forms hydrogen bonds at multiple sites, indicating that there may be interaction sites between these DNAs and proteins, further increasing the possibility that these structural genes are downstream target genes of key transcription factors.

[0088] 6. BnMYB30 Validation of downstream target genes To verify MYB30 right UGT75C1 and FLS1 The transcriptional regulatory role of [the substance] was verified in multiple dimensions using yeast one-hybrid (Y1H), dual-luciferase reporter system (Dual-Luc), and electrophoretic mobility shift assay (EMSA).

[0089] Based on the JASAR prediction results of binding sites, the predicted binding sites containing BnaMYB30 will be... BnaUGT75C1 and BnaFLS1The promoter fragment 1500 bp upstream of the ATG gene was cloned into the pHis2 bait vector to construct recombinant plasmids proUGT75C1-pHis2 and proFLS1-pHis2. Simultaneously, the CDS sequence of MYB30 was cloned into the pGADT7 prey vector to construct the recombinant plasmid pGADT7-MYB30. Yeast Y187 competent cells were co-transformed with the bait plasmids ProUGT75C1-pHis2 and ProFLS1-pHis2 along with the prey plasmid pGADT7-MYB30 as experimental groups, while the control groups were co-transformed with the empty pGADT7 vector. Y187[p53-His2+pGADT7-p53] and Y187[p53-His2+pGADT7] served as positive and negative controls, respectively, and were spotted onto SD / -His / -Leu / -Trp and SD / -His / -Leu / -Trp with 3-AT in the order of experimental groups first, followed by control groups. like Figure 20 As shown in Figure A, the experimental group grew on both plates, while the control group was significantly inhibited on SD / -His / -Leu / -Trp with 3-AT. The growth of the experimental group was significantly better than that of the control group, indicating that BnaMYB0 protein and... BnaUGT75C1 and BnaFLS1 There is binding between the promoters, further increasing... BnaUGT75C1 and BnaFLS1 for BnaMYB0 Potential downstream target genes.

[0090] By using a dual-luciferase assay, BnaUGT75C1 and BnaFLS1 The 1500bp promoter sequence was ligated into a reporter vector containing the firefly luciferase gene (LUC) and the kidney luciferase gene (REN) driven by the 35S promoter, and the 1500bp promoter sequence was ligated into a reporter vector. BnaMYB30 The full-length CDS was connected to the effector driven by the 35S promoter, and the following results were obtained: pGreenII proUGT75C1-LUC , pGreenII proFLS1-LUC Recombinant report plasmids and pGreenII 62-SK-BnMYB30 Recombinant effector plasmids, in order to pGreenII 62-SK Empty plasmid as a control ( Figure 20 (B) The reporter plasmid and effect plasmid were combined separately as experimental groups, and the reporter plasmid and effect plasmid were combined as experimental groups. pGreenII 62-SK Empty vector plasmids were used as control groups, and simultaneously expressed in tobacco leaf epidermal cells. It was found that BnaMYB30 could activate… BnaUGT75C1 and BnaFLS1 Promoter-driven LUC fluorescence signal ( Figure 20 (C) indicates that BnaMYB30 positively regulates downstream target genes. BnaUGT75C1 and BnaFLS1 The expression.

[0091] Using JASPAR to analyze BnaMYB30 and BnaUGT75C1 and BnaFLS1 Promoter binding sites were predicted, and the positions and partial binding site sequences of the top five binding sites with the highest relative scores were shown below. Figure 20 As shown in Figure D. Based on the highest relative score prediction and combined with the amplified 1500bp promoter sequence, probes for the EMSA experiment were designed: BnaFLS1 probe: ataatcaaccacccaagca (SEQ ID NO:13); BnaUGT75C1 probe: ctggttggtgggtgtggaggt (SEQ ID NO:14). Figure 20 As shown in Figure E, the experimental results of the protein-free group, the biotin probe experimental group, and the 10× cold probe competitive binding group indicate that the MYB30 protein can specifically bind to... UGT75C1 and FLS1 The corresponding specific sites in the promoter. In the biotinylated probe group, MYB30 protein formed a DNA-protein complex with the probe, which was observed as an electrophoretic migration retardation band; while in the protein-free control group, only the free probe signal was observed, indicating that MYB30 protein can bind to the probe to form a complex, leading to electrophoretic migration retardation. Simultaneous addition of biotinylated probe and 10× unlabeled cold probe significantly weakened the retardation band of the biotinylated probe, indicating that the cold probe inhibited the formation of the biotinylated complex by competitively binding to MYB30 protein, further confirming the binding ability of MYB30 protein to the probe sequence.

[0092] The above results confirm that MYB30 can directly bind via the sequences ctggttggtgggtgtggaggt and ataatcaaccacccaagca. UGT75C1 and FLS1 The promoter regulates the expression of both. A combination of three experiments—yeast one-hybrid assay, dual-luciferase complementation assay, and electrophoretic mobility shift analysis—determined the... BnaFLS1 and BnaUGT75C1 yes BnaMYB30 BnaMYB30 can bind to downstream target genes. BnaFLS1 and BnaUGT75C1 The corresponding sequence on the promoter regulates the glycosylation of anthocyanins and the synthesis of flavonols.

[0093] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of the BnaMYB30 gene or protein in regulating drought resistance and / or regulating anthocyanin content in rapeseed under drought stress.

2. The application according to claim 1, characterized in that, The BnaMYB30 negatively regulates the drought resistance of rapeseed; the BnaMYB30 positively regulates the anthocyanin content of rapeseed under drought stress.

3. The application according to claim 2, characterized in that, The BnaMYB30 regulates anthocyanin glycosylation and flavonol synthesis under drought stress by modulating the BnaFLS1 and BnaUGT75C1 genes; the BnaMYB30 regulates the expression of BnaFLS1 and BnaUGT75C1 by binding to the BnaFLS1 and BnaUGT75C1 promoters through the sequences of SEQ ID NO:13 and SEQ ID NO:

14.

4. The application according to claim 1, characterized in that, The gene BnaMYB30 is located at positions 45820979-45822485 on chromosome C07 of the Brassica napus reference genome version ZS11.v0.

5. Application of recombinant vectors overexpressing BnaMYB30 in increasing anthocyanin content in rapeseed under drought stress.

6. The application according to claim 5, characterized in that, The method for constructing the recombinant vector includes: double digestion of the vector with restriction endonucleases to obtain a linearized vector; obtaining the CDS target fragment of BnaMYB30 by PCR amplification; homologously recombining the CDS target fragment of BnaMYB30 into the linearized vector; transforming the ligation product into Escherichia coli DH5α competent cells by heat shock, and extracting the plasmid after correct sequencing.

7. The application according to claim 6, characterized in that, The primer sequences for the PCR amplification include SEQ ID NO:1~SEQ ID NO:

2.

8. A method for regulating the drought resistance of rapeseed and / or regulating the anthocyanin content of rapeseed under drought stress, characterized in that, The method includes: regulating the drought resistance of rapeseed and its anthocyanin content under drought stress by controlling the expression level of BnaMYB30 in rapeseed; increasing the expression level of BnaMYB30 in rapeseed to reduce its drought resistance and increase its anthocyanin content under drought stress; and decreasing the expression level of BnaMYB30 in rapeseed to improve its drought resistance and reduce its anthocyanin content under drought stress.

9. The method according to claim 8, characterized in that, The methods for increasing the expression level of BnaMYB30 in rapeseed include any one or more of the following: (1) Introduce the BnaMYB30 gene to overexpress it; (2) Gene editing modifies the regulatory region of the endogenous BnaMYB30 gene to enhance transcription; (3) Apply BnaMYB30 gene promoter activator to promote its expression; (4) Introduce transcriptional regulatory factors that upregulate the expression of the BnaMYB30 gene.

10. The method according to claim 8, characterized in that, The methods for reducing the expression level of BnaMYB30 in rapeseed include any one or more of the following: (1) Introduce the BnaMYB30 gene silencing vector to inhibit the expression of this gene; (2) Gene editing to knock out or knock down the endogenous BnaMYB30 gene; (3) Administering a BnaMYB30 gene promoter inhibitor to weaken transcription; (4) Introduce inhibitory regulatory factors that downregulate the expression of the BnaMYB30 gene.