Viral vector production

By using a combination of PKC activator and HDAC inhibitor in viral vector production, along with modified U1 snRNA, the problem of maximizing titer in viral vector production was solved, achieving efficient viral vector production and maintenance of cell viability.

CN122012625APending Publication Date: 2026-05-12OXFORD BIOMEDICA (UK) LTD
View PDF 23 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
OXFORD BIOMEDICA (UK) LTD
Filing Date
2021-05-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively address the issue of maximizing titers in the large-scale production of GMP-grade viral vectors, particularly due to factors such as viral serotype, transgenic sequence, culture medium composition, transfection method, cell vulnerability, and bioreactor shear stress.

Method used

Using PKC activators alone or in combination with HDAC inhibitors, viral vector titers are increased by culturing cells containing nucleic acid sequences of viral vector components in cell culture medium, and viral vector production is enhanced by binding modified U1 snRNA to the packaging region of the lentiviral vector genome sequence.

Benefits of technology

It significantly improved the titer of viral vectors and maintained high cell viability, making it suitable for the production of various viral vectors, including retroviruses, adenoviruses, adeno-associated viruses, and vaccinia viruses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012625A_ABST
    Figure CN122012625A_ABST
Patent Text Reader

Abstract

The invention relates to viral vector production. In particular, the present invention provides novel methods for producing viral vectors. The invention also provides a corresponding virus vector production system and application.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese Patent Application No. 202180035199.X entitled "Production of Viral Vectors", filed on May 14, 2021. Technical Field

[0002] This invention provides a novel method for generating viral vectors. A corresponding viral vector production system and its applications are also provided. Background Technology

[0003] Over the past few decades, the development and production of viral vectors for vaccines and human gene therapies have been well documented in scientific journals and patents. The use of engineered viruses for therapeutic delivery of transgenes is widespread. RNA-based viruses, such as gamma retroviruses and lentiviruses (Muhlebach, MD et al., 2010, ...), are also prevalent. Retroviruses: Molecular Biology, Genomics and Pathogenesis , 13:347-370;Antoniou, MN, Skipper, KA& Anakok, O., 2013, Hum. Gene Ther. , 24:363-374) and DNA viruses, such as adenoviruses (Capasso, C. et al. 2014, Viruses (6:832-855) and adenovirus-associated virus (AAV) (Kotterman, MA & Schaffer, DV, 2014, Nat.). Rev. Genet . , Modern gene therapy vectors (15:445-451) have shown promise in an increasing number of human disease indications. These include the use of patient cells for hematological conditions (Morgan, RA & Kakarla, S., 2014, Cancer J ., 20:145-150; Touzot, F. et al. 2014, Expert Opinion. Biol. Ther ., 14:789-798), and ophthalmology (Balaggan, KS & Ali, RR, 2012, Gene Ther .,19:145-153), cardiovascular (Katz, MG et al. 2013, Hum. Gene Ther ., 24:914-927), neurodegenerative diseases (Coune, PG, Schneider, BL & Aebischer, P., 2012, Cold Spring Harb. Perspective. Med.In vivo therapy and tumor treatment of Pazarentzos, E. & Mazarakis, ND, 2014, 4:a009431 Adv. Exp. Med Biol. In vitro modification of [materials] (818:255-280). As the success of these methods in clinical trials begins to pave the way for regulatory approval and commercialization, attention has focused on bottlenecks in the large-scale production of Good Manufacturing Practice (GMP) grade carrier materials (Vander Loo JCM, Wright JF., 2016, 818:255-280). Human Molecular Genetics , 25(R1):R42–R52).

[0004] Overcoming this difficulty lies in discovering new methods to maximize viral vector titers during production. Conventional methods for viral vector production involve transfecting primary cells or mammalian / insect cell lines with vector DNA components, followed by a limited incubation period, and then harvesting the crude vector from the culture medium and / or cells (Merten, OW., Schweizer, M., Chahal, P., & Kamen, AA, 2014). Pharmaceutical Bioprocessing , 2:183-203). In other cases, the use of production cell lines (PrCL; in which all necessary vector components are stably integrated into the production cell DNA) during transfection-independent methods is advantageous at larger scales. The efficiency of viral vector production in the “upstream stage” is generally affected by several factors, including [1] the viral serotype / pseudotype used, [2] the transgenic sequence composition and size, [3] the culture medium composition / aeration / pH, [4] the transfection reagent / method, [5] the timing of chemical induction and vector harvesting, [6] cell fragility / viability, [7] bioreactor shear stress, and [8] impurities. Obviously, there are other factors to consider in the “downstream” purification / concentration stage (Merten, OW. et al. 2014, 2:183-203). Pharmaceutical Bioprocessing , 2:237-251).

[0005] Therefore, there is a need in the art to provide alternative methods for producing viral vectors that help solve known problems associated with the large-scale production of GMP-grade vector materials. Summary of the Invention

[0006] The inventors unexpectedly demonstrated that, during viral vector production, the use of PKC activators, alone or in combination with HDAC inhibitors, significantly increased viral vector titers. Therefore, this invention relates to the use of PKC activators i) as inducers of viral vector production themselves and ii) as enhancers of HDAC inhibitor-induced viral vector production.

[0007] The inventors have also shown that cells treated with PKC activator maintain high cell viability, which is beneficial during viral vector production.

[0008] Therefore, a method for producing a viral vector is provided, the method comprising culturing cells containing a nucleic acid sequence encoding a component of a viral vector in a cell culture medium containing a PKC activator.

[0009] Appropriately, the viral vector can be a self-inactivating viral vector.

[0010] Appropriately, the PKC activator may be prostratin or phorbol 12-myristate 13-acetate, its analogues, derivatives or salts of pharmaceuticals.

[0011] Appropriately, a) Prostratin may be present in cell culture medium at a concentration of at least about 0.5 μM, optionally wherein prostratin may be present at a concentration of about 0.5 to about 32 μM; or b) Phlorizol 12-myristate 13-acetate may be present in cell culture medium at a concentration of at least about 1 nM, optionally wherein phorbolol 12-myristate 13-acetate may be present at a concentration of about 1 to about 32 nM.

[0012] Suitable, the viral vector may be a lentiviral vector and the modified U1 snRNA may be co-expressed with the lentiviral vector components, wherein the modified U1 snRNA binds to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0013] Appropriately, the viral vector can be a lentiviral vector, and can functionally eliminate splicing activity from the main splice donor region of the lentiviral vector.

[0014] Appropriately, the viral vector may be a lentiviral vector, wherein the lentiviral vector genome has been mutated in the major splice donor region or in the major splice donor region and at least one cryptic splice donor region.

[0015] Appropriately, the cell culture medium may also contain HDAC inhibitors.

[0016] Appropriately, HDAC inhibitors can be aliphatic HDAC inhibitors or oxime HDAC inhibitors.

[0017] Appropriately, aliphatic HDAC inhibitors may be sodium butyrate, sodium valproate, or valproic acid, their analogues, derivatives, or salts of available drugs.

[0018] Appropriately, the PKC activator can be prostratin and the HDAC inhibitor can be sodium butyrate.

[0019] Appropriately, oxime HDAC inhibitors may be diphenylaminoisohydroxamic acid, its analogues, derivatives, or salts of available drugs.

[0020] Appropriately, a) Sodium butyrate may be present in the cell culture medium at a concentration of at least about 2.5 mM, optionally wherein sodium butyrate may be present at a concentration of about 2.5 to about 30 mM; b) Sodium valproate may be present in the cell culture medium at a concentration of at least about 3 mM, optionally wherein sodium valproate may be present at a concentration of about 3 to about 30 mM; c) Valeric acid may be present in the cell culture medium at a concentration of at least about 3 mM, optionally wherein valeric acid may be present at a concentration of about 3 to about 30 mM; or d) The phenylaminohydroxamic acid may be present in the cell culture medium at a concentration of at least about 0.5 μM, optionally wherein the phenylaminohydroxamic acid may be present at a concentration of about 0.5 to about 16 μM.

[0021] Appropriately, the cells can be transiently transfected production cells. In this regard, nucleic acid sequences encoding viral vector components are transiently transfected into production cells.

[0022] Appropriately, the cell can be a stable production cell. In this regard, nucleic acid sequences encoding viral vector components are stably integrated into the production cell.

[0023] Appropriately, the cell can be a eukaryotic cell.

[0024] Appropriately, the cell can be a mammalian cell.

[0025] Appropriately, the cell can be a human cell.

[0026] Appropriately, cells can be adherent.

[0027] Appropriately, the cells may be HEK293 cells or derivatives thereof.

[0028] Appropriately, the HEK293 producing cells may be HEK293T cells.

[0029] If appropriate, cells can be in suspension.

[0030] Appropriately, the viral vector may be selected from: retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors.

[0031] Appropriately, the retroviral vector can be a lentiviral vector.

[0032] Appropriately, lentiviral vectors may be selected from: HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, and sheep exmyelinating virus lentiviral vectors.

[0033] Where appropriate, the viral vector may contain the nucleotide of interest (NOI).

[0034] Appropriately, the cell culture medium may contain at least about 5 liters of culture medium.

[0035] Appropriately, the cell culture medium can be serum-free.

[0036] Suitable, at least one nucleic acid sequence encoding a viral vector component can be operatively linked to a promoter selected from: CMV promoter, RSV promoter, CAG synthetic promoter, CHEF1 promoter, GRP78 promoter, UBC promoter, HIV-1 U3 promoter, and FERH promoter, optionally wherein the promoter can be selected from: CMV promoter, RSV promoter, and CAG synthetic promoter.

[0037] It also provides a viral vector production system, which includes: i) Cells comprising nucleic acid sequences encoding viral vector components; and ii) Cell culture medium containing PKC activator.

[0038] Appropriately, the viral vector can be a self-inactivating viral vector.

[0039] Appropriately, the PKC activator may be prostratin or phorbol 12-myristate 13-acetate, its analogues, derivatives or salts of pharmaceuticals.

[0040] Appropriately: a) Prostratin may be present in cell culture medium at a concentration of at least about 0.5 μM, optionally wherein prostratin may be present at a concentration of about 0.5 to about 32 μM; or b) Phlorizol 12-myristate 13-acetate may be present in cell culture medium at a concentration of at least about 1 nM, optionally wherein phorbolol 12-myristate 13-acetate may be present at a concentration of about 1 to about 32 nM.

[0041] Appropriately, the viral vector production system may also contain a nucleic acid sequence encoding a modified U1 snRNA, wherein the modified U1 snRNA binds to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0042] Appropriately, the viral vector may be a lentiviral vector in which splicing activity from the major splicing donor region of the lentiviral vector genome has been functionally eliminated.

[0043] Suitable, the viral vector may be a lentiviral vector and wherein the lentiviral vector genome has been mutated in the major splice donor region or in the major splice donor region and at least one cryptic splice donor region.

[0044] Appropriately, the cell culture medium may also contain HDAC inhibitors.

[0045] Appropriately, HDAC inhibitors can be aliphatic HDAC inhibitors or oxime HDAC inhibitors.

[0046] Appropriately, aliphatic HDAC inhibitors may be sodium butyrate, sodium valproate, or valproic acid, their analogues, derivatives, or salts of available drugs.

[0047] Appropriately, the PKC activator can be prostratin and the HDAC inhibitor can be sodium butyrate.

[0048] Appropriately, oxime HDAC inhibitors may be diphenylaminoisohydroxamic acid, its analogues, derivatives, or salts of available drugs.

[0049] Appropriately: a) Sodium butyrate may be present in the cell culture medium at a concentration of at least about 2.5 mM, optionally wherein sodium butyrate may be present at a concentration of about 2.5 to about 30 mM; b) Sodium valproate may be present in the cell culture medium at a concentration of at least about 3 mM, optionally wherein sodium valproate may be present at a concentration of about 3 to about 30 mM; c) Valeric acid may be present in the cell culture medium at a concentration of at least about 3 mM, optionally wherein valeric acid may be present at a concentration of about 3 to about 30 mM; or d) The phenylaminohydroxamic acid may be present in the cell culture medium at a concentration of at least about 0.5 μM, optionally wherein the phenylaminohydroxamic acid may be present at a concentration of about 0.5 to about 16 μM.

[0050] Appropriately, the cells can be transiently transfected production cells.

[0051] Appropriately, cells can be stable production cells.

[0052] Appropriately, the cell can be a eukaryotic cell.

[0053] Appropriately, the cell can be a mammalian cell.

[0054] Appropriately, the cell can be a human cell.

[0055] Appropriately, cells can be adherent.

[0056] Appropriately, the cells may be HEK293 cells or derivatives thereof.

[0057] Appropriately, HEK293 production cells can be HEK293T cells.

[0058] If appropriate, cells can be in suspension.

[0059] Appropriately, the viral vector may be selected from: retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors.

[0060] Appropriately, the retroviral vector can be a lentiviral vector.

[0061] Appropriately, lentiviral vectors may be selected from: HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, and sheep exmyelinating virus lentiviral vectors.

[0062] Where appropriate, the viral vector may contain the nucleotide of interest (NOI).

[0063] Appropriately, the cell culture medium can be serum-free.

[0064] Suitable, at least one nucleic acid sequence encoding a viral vector component can be operatively linked to a promoter selected from: CMV promoter, RSV promoter, CAG synthetic promoter, CHEF1 promoter, GRP78 promoter, UBC promoter, HIV-1 U3 promoter, and FERH promoter, optionally wherein the promoter can be selected from: CMV promoter, RSV promoter, and CAG synthetic promoter.

[0065] In the context of the methods or viral vector production systems described herein, nucleic acid sequences encoding viral vector components can encode viral vector components required for lentiviral vector production. For example, they can encode i) gag-pol; ii) env; iii) a viral vector genome (typically encoding NOI); and iv) optionally rev, or functional alternatives thereof, where env can be VSV-G env. Each nucleic acid sequence i) through iv) can be a single sequence or can be part of a modular construct. For example, at least two of the nucleic acid sequences i) through iv) can be modular constructs encoding viral vector components located at the same gene locus. In another instance, at least two of the nucleic acid sequences can be modular constructs encoding viral vector components in opposite and / or alternating orientations. In other instances, at least two of the nucleic acid sequences are modular constructs encoding gag-pol and / or env, where the modular constructs are associated with at least one regulatory element.

[0066] Alternatively, the nucleic acid sequence encoding viral vector components can encode viral vector components required for the production of different retroviral vectors, or viral components required for the production of adeno-associated virus vectors, herpes simplex virus vectors, or vaccinia virus vectors. The functional components required for the production of each of these viral vectors are well known in the art. For example, for the production of AAV vectors, nucleic acid sequences encoding capsid proteins can be used.

[0067] It also provides the use of PKC activators to increase viral vector titers during viral vector production.

[0068] Appropriately, PKC activators can be used in combination with HDAC inhibitors.

[0069] Appropriately, the viral vector can be a self-inactivating viral vector.

[0070] Appropriately, the PKC activator may be prostratin or phorbol 12-myristate 13-acetate, its analogues, derivatives or salts of pharmaceuticals.

[0071] Appropriately, HDAC inhibitors can be aliphatic HDAC inhibitors or oxime HDAC inhibitors.

[0072] Appropriately, aliphatic HDAC inhibitors may be sodium butyrate, sodium valproate, or valproic acid, their analogues, derivatives, or salts of available drugs.

[0073] Appropriately, the PKC activator can be prostratin and the HDAC inhibitor can be sodium butyrate.

[0074] Appropriately, oxime HDAC inhibitors may be diphenylaminoisohydroxamic acid, its analogues, derivatives, or salts of available drugs.

[0075] Suitablely, viral vectors can be produced from cells containing nucleic acid sequences encoding components of the viral vector, wherein at least one of the nucleic acid sequences is operatively linked to a promoter selected from: CMV promoter, RSV promoter, CAG synthetic promoter, CHEF1 promoter, GRP78 promoter, UBC promoter, HIV-1 U3 promoter, and FERH promoter, optionally wherein the promoter may be selected from: CMV promoter, RSV promoter, and CAG synthetic promoter.

[0076] Several aspects of the present invention will now be described in further detail. Attached Figure Description

[0077] Embodiments of the invention are further described below with reference to the accompanying drawings, wherein: Figure 1The diagram shows: A. A schematic of the typical construction of a third-generation (self-inactivating (SIN)) lentiviral vector expression cassette containing a functional primary splice donor embedded within a stem loop (SL2) of the packaging signal, and the type of mRNA produced during lentiviral vector production. The diagram also shows the type of mRNA produced from a “standard” lentiviral vector (LV) DNA cassette and (a) a lentiviral vector DNA cassette with a functional mutation in the MSD region that inhibits or eliminates confounding activity from the MSD (“MSD-KO LV DNA cassette”). For both cassettes, co-expression from rev produces full-length (“non-splicing”) vector RNA (vRNA) that binds to the rev response element (RRE) and is generally considered to inhibit splicing from the MSD to the splice acceptor 7 (sa7) contained with the RRE sequence. For the standard lentiviral vector DNA cassette, in the absence of rev, splicing from all introns is generally considered to occur effectively (“splicing”). However, “abnormal” splicing products can be prepared during lentiviral vector production, where the MSD is highly efficiently spliced ​​to either the splice acceptor site or the cryptic splice acceptor site (“abnormal” splicing), typically “ignoring” introns containing RREs, thus minimizing the impact of revs on this activity of the MSD. Lentiviral vector production can also be performed by co-expression of modified U1 snRNA redirected to the packaging region of the MSD-mutant lentiviral vector DNA cassette. (Symbols: Pro, promoter; the region from 5'R to gag contains the packaging element {ψ}; msd, major splice donor; cppt, central polypurine segment; Int, intron; sd / sa, splice donor / acceptor; GOI, gene of interest; gray arrows indicate the positions of the forward {f} and reverse {r} primers to evaluate the proportion of unspliced ​​vRNA produced during third-generation lentiviral vector production. Posttranscriptional regulatory elements {PRE} are not shown for clarity.) B. Removal of U3 from the LTR of the SIN LV vector; C. Third-generation CMV-driven LV vector plasmid.

[0078] Figure 2 The final vector titers from HEK293T cells induced with different concentrations of antioxidants (NAC), HDAC inhibitors: sodium butyrate, sodium valproate, valerate, SAHA, and TSA; HAT inhibitor (tannic acid); and transcription activators: PMA, HMBA, and prostratin are shown.

[0079] Figure 3The final vector titers from HEK293T cells induced by random combinations of NAC; HDAC inhibitors: sodium butyrate, sodium valproate, valerate, SAHA, and TSA; HAT inhibitor (tannic acid); and transcription activators: PMA, HMBA, and prostratin are shown. Dashed lines indicate induction levels at 20 mM sodium butyrate.

[0080] Figure 4 The final vector titers of HEK293T cells induced by HDAC inhibitors in combination with transcription activators at different concentrations: sodium butyrate, sodium valproate, valerate, and SAHA; transcription activators: HMBA, prostratin, and PMA; and HDAC inhibitor-induced HK293T cells are shown. Arrows indicate the concentrations of the inducing agents used in combination.

[0081] Figure 5 The results show: A. Final vector titers from HEK293T cells induced with different concentrations of sodium butyrate, prostratin, and HMBA. B. JMP predictive analyzer for vector titer results.

[0082] Figure 6 The JMP predictive analyzer shows the carrier titer results for: A. Sodium valproate, B. Valproic acid, and C. SAHA.

[0083] Figure 7 The final vector titers from HEK1.65s cells induced with different concentrations of sodium butyrate, sodium valproate, valerate, and SAHA are shown with and without proprin.

[0084] Figure 8 The final vector titers from HEK1.65s cells induced with different concentrations of propranin and sodium butyrate are shown.

[0085] Figure 9 Displayed are: A. A surface plot of the interaction between sodium butyrate and prostratin on the carrier titer; B. DOE true results, effect summary, and misfit table via the prediction plot; and C. The prediction analyzer.

[0086] Figure 10 The viral titers determined by A. FACS and B. double-helix integration qPCR assays are shown.

[0087] Figure 11This is a schematic diagram of a U1 snRNA molecule and an example of how it is modified for use as a target sequence in this invention. During an early step of intron splicing, the endogenous noncoding RNA U1 snRNA binds to a common splice donor site (5'-MAGGURR-3' (SEQ ID NO: 1)) via the native splice donor target sequence 5'-(AC)UUACCUG-3' (SEQ ID NO: 2) (highlighted in gray). Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5'-AUUUGUGG-3' (SEQ ID NO: 3) sequence binds to the Sm protein, which, together with stem-loop IV, is important for U1 snRNA processing. In this invention, the modified U1 snRNA is modified to introduce a heterologous sequence complementary to the target sequence within the vector genome vRNA molecule at the site of the natural splicing donor target sequence; in the example provided in the figure, the modified U1 snRNA is directed to 15 nucleotides (256-270, 256U1 relative to the first nucleotide of the vector genome molecule) of the standard HIV-1 lentiviral vector genome (or, if it is a packaging signal, located in the SL1 loop).

[0088] Figure 12 The significance of aberrant splicing from the major splice donor site (MSD) within HIV-1-based lentiviral vectors. Figure 1 Small figure A shows a schematic diagram illustrating the typical construction of a third-generation (self-inactivating (SIN)) lentiviral vector expression cassette. Figure 12 In this study, standard third-generation lentiviral vector production was performed in HEK293T cells at + / - rev, and total RNA was extracted from the cells after production. qPCR (SYBR green) was performed on the total RNA using two primer sets (marked in A): total transcripts amplified by f+rT from the lentiviral vector expression cassette, and unspliced ​​transcripts amplified by f+rUS; therefore, the ratio of unspliced ​​to total vRNA transcripts was calculated and plotted. The data showed that the ratio of unspliced ​​vRNA to total vRNA was moderate during standard third-generation lentiviral vector production and varied depending on the internal transgenic cassette (in this case, containing different promoters and GFP genes); furthermore, this ratio increased only minimally with the action of rev.

[0089] Figure 13A. A schematic diagram showing the construction of a standard or MSD-mutant lentiviral vector expression cassette encoding the EF1a-GFP internal expression cassette, and the type of mRNA produced during lentiviral vector production. (Symbols: Pro, promoter; region from 5'R to gag contains packaging element {ψ}; msd, major splice donor; cppt, central polypurine segment; Int, intron; sd / sa, splice donor / recipient; GOI, gene of interest; gray arrows indicate the positions of forward {f} and reverse {r} primers to evaluate the proportion of unspliced ​​vRNA produced during third-generation lentiviral vector production. Posttranscriptional regulatory element {PRE} is not shown for clarity.) B. [i] Production and titration of standard or MSD-2KO lentiviral vectors in HEK293T cells at + / - tat, 179 U1, or 305 U1. [ii] Total cytoplasmic mRNA was extracted from post-production cells and analyzed by RT-PCR / gel electrophoresis using primers (f+rG) capable of detecting major “abnormal” splicing products from the SL2 splice region to the EF1a splice acceptor. Data showed that modified U1 snRNA (vRNA) redirected to the 5' packaging region of the MSD-2KO lentiviral vector genome improved the titers of both the standard and MSD-2KO lentiviral vectors in a similar manner to tat. The MSD-2KO mutation eliminated the detection of “abnormal” splicing products from the SL2 splice region to the EF1a splice acceptor (see [link to relevant documentation]). Figure 14 A). Importantly, contrary to the use of tat, the increase in titer of modified U1 snRNA was accompanied by the maintenance of almost undetectable “abnormal” splicing products.

[0090] Figure 14A description of functional major splice donor mutations, their effects on lentiviral vector titers, and restoration via modified U1 snRNA. A. The top shows the sequence of the stem-loop 2 (SL2) region of “wild-type” HIV-1 (NL4-3; the “standard” sequence within the current lentiviral vector genome). The sequence contains the major splice donor site (MSD: common sequence = CTGGT) and the cryptic splice donor site (crSD: common sequence = TGAGT) when the MSD site itself is mutated. When splice donor sites are used, the nucleotides at the splice location are bolded and identified by arrows. Four functional MSD mutations that eliminate splice activity at both the MSD and crSD sites are described: MSD-2KO, which mutates two “GT” motifs from both MSD and crSD; MSD-2KOv2, which also includes mutations eliminating both the MSD and crSD sites; MSD-2KOm5, which introduces a novel stem-loop structure lacking any splice donor sites; and ΔSL2, which completely deletes the SL2 sequence. The substitutions introducing the SL2 sequence in the MSD-2KO, MSD-2KOv2, and MSD-2KOm5 mutations are shown in italics and lowercase letters. B. Cloning of sequences containing (…) via the EFS-GFP inner cassette. Figure 14 Four lentiviral vector genomic variants with functional MSD mutations (as described in A) were used, and the MSD-2KO or MSD-2KOm5 variants were additionally cloned via EF1a-, CMV-, or huPGK-GFP internal cassettes. Standard and MSD-mutated LVs were generated and titrated in HEK293T cells (+ / - 256U1). Data showed that the degree of attenuation of lentiviral vector titers varied depending on the specific mutation, and the MSD-2KOm5 variant generally produced a less attenuated phenotype. When co-expressed during production, modified U1 snRNAs increased lentiviral vector titers for all four lentiviral vector genomic variants containing functional MSD mutations. The titer increase was greatest when 256U1 was expressed via an MSD-mutated LV genome containing the MSD-2KOm5 sequence.

[0091] Figure 15Prostratin, alone or in combination with modified U1 snRNA, was used to enhance the production titer of lentiviral vectors (LVs) with functional mutations in the major splice donor (MSD) region. The effects of mutations in the MSD and the cryptic splice site immediately downstream of the MSD are due to reduced vector RNA (vRNA) production, resulting in lower production titers. The titer of MSD-mutated LVs can be restored by providing modified U1 snRNA, allowing it to anneal to the region within the vRNA packaging region, thus increasing the mix of packageable vRNAs. To test whether the provision of Prostratin during MSD-mutated LV production could further enhance titers, HIV-MSD2KOm5-EFS-GFP (A) or HIV-MSD2KOm5-EF1a-GFP (B) were produced in serum-free suspension HEK293T cells in the absence of an inducer, either by using 11 μM Prostratin (added during the sodium butyrate step) or by co-transfection with a plasmid expressing “256U1” modified U1 snRNA. Surprisingly, Prostratin increased the titer of MSD-mutated LV vectors by 5-10 times, and when Prostratin was applied together with 256U1, the titer achieved was higher than the standard LV production titer produced in the absence of an inducer.

[0092] Figure 16 The titers of vectors CAR#1, CAR#2, and CAR#2-T2A-GFP produced in transiently transfected HEK1.65s cells in the absence of a titer enhancer are shown by 256U1 expression, by 11 μM prostratin at induction, and by 256U1 expression in combination with 11 μM prostratin at induction.

[0093] Figure 17 The vector titer (TU / mL) at harvest is shown for the production of EIAV-CMV-GFP with and without 11 μM prostratin during induction.

[0094] Figure 18Induction of promoters of varying strengths by prostratin is shown. Suspension (serum-free) HEK293T cells were transfected with plasmids encoding GFP reporter genes driven by the specified promoters. To model the expression of viral vector components (e.g., AAV capsid, LV genome) during production, two different plasmid input amounts (0.1 μg / mL [Lo] and 0.95 μg / mL [Hi]) were implemented, and all cultures were induced with 10 mM sodium butyrate after transfection, with or without 11 μm prostratin. Cells were analyzed by flow cytometry approximately 2 days post-transfection to measure GFP expression. Gene expression scores (& GFP-positive × median fluorescence intensity) were generated for each case and plotted on the y-axis (note that the y-axis ranges of the two sets of plots differ by log⁻¹⁰ from top to bottom, i.e., from the strongest promoter to the weakest promoter). Cytomegalovirus promoter- CMV, Laure's sarcoma virus U3 promoter-RSV, CAG synthesis promoter (CMV enhancer, chicken β-actin gene promoter) Exons / introns, the splice acceptor of the rabbit β-globulin gene), the Chinese hamster EF-1α-1 promoter-CHEF1, GRP78 / BiP (stress-inducible) promoter - GRP78, ubiquitin-C promoter - UBC, HIV-1 U3 promoter - HIV-1 U3, human iron Protein heavy chain promoter - FERH, untransfected control - UTC.

[0095] Several aspects of the present invention will now be described in further detail. Detailed Implementation

[0096] The inventors have recognized that PKC activators can be used to increase viral vector titers during viral vector production. Furthermore, they have been shown to maintain cell viability when PKC activators are present during viral vector production. Therefore, the methods, viral vector production systems, and uses described herein include the use of PKC activators as detailed below.

[0097] A. PKC activator

[0098] (i) Methods for producing viral vectors

[0099] A method for producing a viral vector is provided, comprising culturing cells containing a nucleic acid sequence encoding a component of a viral vector in a cell culture medium containing a PKC activator.

[0100] The terms “cell,” “culture,” “cell culture,” “cell culture medium,” “nucleic acid sequence,” “viral vector,” and “viral vector component” are described in more detail elsewhere in this article and are used equivalently herein.

[0101] The cells used in the methods described herein can be transiently transfected into production cells or stable production cells. The terms “transiently transfected production cells” and “stable production cells” are described in more detail elsewhere in this document and are used equivalently herein.

[0102] The cells can be eukaryotic cells, such as mammalian cells (e.g., human cells). Alternative cell types are discussed in more detail below.

[0103] The cells can be adherent or suspension. Suitable cell types are discussed in more detail elsewhere in this article, and they include HEK293 cells (e.g., HEK293T cells) or derivatives thereof.

[0104] The methods described herein can be used to produce any suitable viral vector. Suitable viral vectors are described in more detail in the definitions section of this document and are used equivalently herein. Examples of viral vectors that can be produced by the methods described herein include viral vectors selected from the following: retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors. Detailed information on each of these vectors is provided elsewhere and is used equivalently herein.

[0105] The methods described herein are particularly suitable for producing retroviral vectors, especially lentiviral vectors. For example, the methods described herein can be used to produce lentiviral vectors selected from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, and sheep exmyelinating virus lentiviral vectors. In one instance, the methods described herein can be used to produce lentiviral vectors selected from HIV (e.g., HIV-1, HIV-2) or EIAV lentiviral vectors.

[0106] Each of these lentiviral vectors is described in more detail elsewhere in this article.

[0107] The methods presented herein are particularly useful when producing self-inactivated (SIN) viral vectors (e.g., SIN lentiviral vectors). The characteristics of SIN vectors are described in more detail elsewhere in this document. In specific instances, the SIN vector may be a third-generation SIN viral vector (e.g., a third-generation lentiviral vector).

[0108] Typically, viral vectors produced by the methods described herein contain the nucleotide of interest (NOI). The NOI can be any suitable NOI. Examples of suitable NOIs are provided elsewhere in this document.

[0109] Typically, in some instances, the nucleic acid sequences encoding viral vector components encode vector components, which include gag-pol, env, optionally rev, and the genome of the viral vector. Further details are provided elsewhere in this article.

[0110] The inventors have shown that the addition of a PKC activator (such as prostratin) increases viral vector titers (and maintains cell viability) regardless of the promoter used (i.e., the effect is not promoter-specific). The inventors have tested several different promoters to confirm that the effects observed herein are independent of the promoter used. For example, the inventors have shown that the methods described herein are compatible with the use of CMV (cytomegalovirus), CHEF-1 (CHO-derived extension factor 1), RSV (Raoult's sarcoma virus), and GRP78 (immunoglobulin heavy chain binding protein) promoters (for driving GFP genome, Gag / Pol, Rev, and VSVG plasmid expression, respectively). In addition, the inventors have demonstrated that the following promoters can be used when using promoterin to induce GFP plasmid expression: Cytomegalovirus promoter - CMV, Laure's sarcoma virus U3 promoter - RSV, CAG synthetic promoter (CMV enhancer, promoter - chicken β-actin gene exon / intron, rabbit β-globulin gene splice acceptor), Chinese hamster EF-1alpha-1 promoter - CHEF1, GRP78 / BiP (stress-inducible) promoter - GRP78, ubiquitin-C promoter - UBC, HIV-1 U3 promoter - HIV-1 U3, and human ferritin heavy chain promoter - FERH (see...) Figure 18 These promoters can be used to drive the production of several different types of viral vectors, including viral vectors selected from the following: retroviral vectors, adenoviral vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors. For example, strong promoters such as CMV, RSV, and CAG can be selected to drive the expression of viral vector components, such as structural viral vector components, including the AAV capsid protein. When using one or more of these promoters, the PKC activators described herein can be advantageously used to enhance viral vector production. Therefore, the present invention provides the use of PKC activators to enhance viral vector titers during the production of viral vectors from cells containing nucleic acid sequences encoding viral vector components, wherein at least one of the nucleic acid sequences is operatively linked to a promoter selected from the following: CMV promoter, RSV promoter, CAG synthesis promoter, CHEF1 promoter, GRP78 promoter, UBC promoter, HIV-1 U3 promoter, and FERH promoter. Optionally, the promoter can be selected from the following: CMV promoter, RSV promoter, and CAG synthesis promoter. This is particularly relevant for nucleic acid sequences encoding structural viral vector components, such as AAV capsid proteins, when a strong promoter is desired. Alternatively, the viral vector may be a retroviral vector (e.g., a lentiviral vector), an adenovirus vector, or an adeno-associated virus vector.

[0111] Therefore, the present invention provides the use of PKC activators for increasing viral vector titers during the production of viral vectors from cells containing nucleic acid sequences encoding viral vector components, wherein at least one of the nucleic acid sequences is operatively linked to a promoter selected from the group consisting of: CMV promoter, RSV promoter, CAG synthesis promoter, CHEF1 promoter, GRP78 promoter, UBC promoter, HIV-1 U3 promoter, and FERH promoter, and wherein the viral vector is selected from: retroviral vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector, and vaccinia virus vector. Optionally, the promoter may be selected from the group consisting of: CMV promoter, RSV promoter, and CAG synthesis promoter. Optionally, the viral vector may be a retroviral vector (e.g., a lentiviral vector), an adenovirus vector, or an adeno-associated virus vector.

[0112] The inventors have identified that the presence of a PKC activator in the cell culture medium increases the viral vector titer during viral vector production. Therefore, the cell culture medium used in the methods described herein can be any suitable cell culture medium, as long as it contains a PKC activator. Suitable cell culture media and cell culture methods are described in more detail elsewhere herein and are applied equivalently herein.

[0113] In a specific instance, the cell culture medium may be serum-free. As used herein, "serum-free condition" is a condition in which serum is omitted from the culture medium, such that, for example, the culture medium does not contain (i.e., substantially free of or not supplemented with) serum.

[0114] As used herein, “protein kinase C activator” or “PKC activator” refers to a substance that increases the rate of a reaction catalyzed by PKC. Some PKC activators and methods for identifying PKC activators are well known in the art. Examples of suitable methods for identifying PKC activators are provided in Chakravarthy et al., Analytical Biochemistry, Vol. 196, No. 1, 1991, pp. 144-150. PKC activators are also referred to herein as PKC agonists.

[0115] Protein kinase C (PKC) is one of the largest gene families of protein kinases. The serine-threonine kinase family of protein kinases plays a crucial regulatory role in a variety of biological phenomena. The PKC family consists of at least 12 isotypes belonging to three distinct categories: (i) the standard isotypes 25 (α, β1, β2, γ) activated by intracellular release of Ca2+, phorbol esters, and diglycerides caused by phospholipase C; (ii) novel isotypes (δ, η, ε, θ) activated by phorbol esters and diglycerides but not by Ca2+; and (iii) abnormal family members (ζ, λ, ι) that are not activated by Ca2+, phorbol esters, or diglycerides. The identity of protein kinase C is usually established by its ability to phosphorylate proteins when adenosine triphosphate (ATP) and phospholipid cofactors are present; its activity is drastically reduced in the absence of these cofactors. Furthermore, the maximum activity of certain forms of protein kinase C requires the presence of calcium ions. Protein kinase C (PKC) activity is also significantly stimulated by certain 1,2-sn-diglycerides, which bind specifically and stoichiometrically to the recognition site on the enzyme. Once activated, it is believed that most, but not all, of the isoforms translocate from the cytoplasm to the plasma membrane. Due to its importance in a variety of biological processes, numerous studies have identified the structure and function of PKC.

[0116] PKC activators can be non-specific or specific. Specific activators activate one PKC isoform, for example, PKC-ε (epsilon), to a level greater than detectable by another PKC isoform. Exemplary PKC activators are disclosed in WO 2017 / 062924A1, specifically in paragraphs

[039] ,

[040] ,

[053] ,

[058] -

[0112] , the entire contents of which are incorporated herein by reference. Wu-Zhang and Newton, Biochem. J. (2013) 452, 195-209, the entire contents of which are incorporated herein by reference, also discloses exemplary PKC activators.

[0117] PKC activators may be selected from prostratin, phorbol 12-myristate 13-acetate, macrolides, bryologs, diglycerides, isoprene analogs, octylindolinamide, gnidimacrin, euphorbia diterpenoid, iripallidal, sulfamethoxazole, diglyceride inhibitors, growth factors, polyunsaturated fatty acids, monounsaturated fatty acids, cyclopropane-modified polyunsaturated fatty acids, cyclopropane-modified monounsaturated fatty acids, fatty acid alcohols and their derivatives, and fatty acid esters, or their pharmaceutically available salts or derivatives.

[0118] PKC activators can be prostratin or phorbol 12-myristate 13-acetate (PMA), or analogues, derivatives, or pharmaceutically available salts thereof. PKC activators can be macrolides, for example, containing a 14-, 15-, or 16-membered lactone ring. Macrolides can be lichenin (such as lichenin-1, lichenin-2, lichenin-3, lichenin-4, lichenin-5, lichenin-6, lichenin-7, lichenin-8, lichenin-9, lichenin-10, lichenin-11, lichenin-12, lichenin-13, lichenin-14, lichenin-15, lichenin-16, lichenin-17 and / or lichenin-18); oleander (such as oleander-1); macrocyclic derivatives of cyclopropane-modified polyunsaturated fatty acids (such as 24-octahepane-25-one); lichenin analogues (analogs of lichenin). PKC activators can be diglycerides (or derivatives thereof) that bind to and activate PKC. PKC activators can be isoprene-like substances, such as farnesylthiotriazole. PKC activators can also be octylindolamide V, gnidimacrin, giant saphenoxy diterpenoid alcohol, or iripallidal. PKC can be naphthalenesulfonamides, such as N-(n-heptyl)-5-chloro-1-naphthalenesulfonamide or N-(6-phenylhexyl)-5-chloro-1-naphthalenesulfonamide. PKC activators can be glycerol dikinase inhibitors, which indirectly activate PKC (such as 6-(2-(4-[R4-fluorophenyl)phenylmethylene]-1-piperidinyl)ethyl)-7-methyl-5H-thiazo[3,2-a]pyrimidin-5-one (R59022) or [3-[2-[4-(bis-(4-fluorophenyl)methylene]piperidin-1-yl)ethyl]-2,3-dihydro-2-thio4(1)-quinazolinone (R59949)). PKC activators can also be growth factors (such as fibroblast growth factor 18 (FGF-18), insulin-like growth factor, 4-methylcatecholacetic acid, NGF, or BDNF). PKC activators can be polyunsaturated fatty acids, monounsaturated fatty acids, cyclopropanated polyunsaturated fatty acids, cyclopropanated monounsaturated fatty acids, fatty acid alcohols, cyclopropanated polyunsaturated fatty acid alcohols, cyclopropanated monounsaturated fatty acid alcohols, fatty acid esters, cyclopropanated polyunsaturated fatty acid esters, or cyclopropanated monounsaturated fatty acid esters.

[0119] Prostratin is also known as 12-deoxyphorbol-13-acetic acid ester (≥98% HPLC, Sigma: P0077). Initially, it was studied at the National Cancer Institute (NCI) as a tropical plant, *Populus tomentosa* (also known as *Populus tomentosa*). Homalanthus nutansProstratin, the active component of the extract, was isolated from *Pterocarpus spp.*, a traditional herbal remedy used by Samoans to treat yellow fever, i.e., hepatitis (Gustafson et al., 1992, J Med Chem 35(11): 1978-86). Unlike other phorbol esters, prostratin is a potent antitumor agent. Prostratin and its structural analogs can be purified from natural sources or synthesized. Methods for the synthetic production of prostratin and its structural analogs are known in the art (Wender et al., 2008, Science 320(5876): 649-52).

[0120] Phloridine 12-Myristate 13-acetate (PMA), also known as 12-O-tetradecanoylphorbol-13-acetate (TPA), is a potent tumor promoter and activates protein kinase C in vivo and in vitro. It is involved in a variety of cellular responses, including gene transcription, cell division and differentiation, apoptosis, and immune responses.

[0121] PKC activators can be present in cell culture media at any suitable concentration. Those skilled in the art can readily identify suitable concentration ranges using conventional experimental methods. For example, methods similar to those described in the following examples can be used to identify PKC activator concentrations that enhance viral titers. Several methods for measuring viral titers are known in the art. Further details are provided elsewhere herein.

[0122] Cells can be cultured in any suitable cell culture volume and in any suitable cell culture container in the presence of PKC activator. Cell culture tubes, cell culture flasks, cell culture dishes, and cell culture plates are referred to herein as cell culture containers because they are examples of individual cell culture products (or consumer products) that can be used within the methods described herein. Typically, cell culture tubes, cell culture flasks, and cell culture dishes are cell culture containers with a single cell culture reaction chamber, while cell culture plates are typically cell culture containers with several cell culture reaction chambers (i.e., several wells). Other suitable cell culture containers are well known in the art.

[0123] Cells can be cultured for a suitable duration in the presence of a PKC activator. Typically, cells can be cultured for at least 30 minutes in the presence of a PKC activator. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of a PKC activator. Cells can also be cultured for a duration from approximately 30 minutes to approximately 5 days in the presence of a PKC activator. For example, cells can be cultured for a maximum duration (e.g.) of approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours in the presence of a PKC activator.

[0124] As will be apparent to those skilled in the art, it is generally beneficial to passage cells to fresh culture medium when the cell culture duration is at least 2 days. As used herein, “passage” refers to the step of harvesting grown cells from a “parental” cell culture aliquot and re-inoculating them to produce new “daughter” cell culture aliquots. Thus, passage refers to the transfer of a proportion of cell suspension and / or supernatant from one aliquot to another.

[0125] When passaged adherent cells, they are typically washed in PBS while still attached to the culture medium, separated from their aliquots, and then resuspended. A certain proportion of the resuspended cells is then transferred to a new aliquot. When passaged non-adherent cells, the cells are in suspension, so a certain proportion can be directly transferred to a new aliquot.

[0126] The passage number in cell culture refers to the number of harvests and re-inoculations. During passage, a certain volume of parental cell culture aliquots is harvested and re-inoculated into new daughter aliquots (usually re-inoculated into fresh cell culture medium). In instances where cell culture includes the duration of passage in the presence of a PKC activator, the fresh medium used for passage obviously also contains the PKC activator of interest. In other words, the cell culture medium containing the PKC activator can be replaced during cell culture (partially or completely removed from the cells and replaced with fresh medium containing the PKC activator).

[0127] In one non-limiting example, the PKC activator present in cell culture medium is prostratin, or a salt of its analogues, derivatives, or drugs. Generally, the term "prostratin" is used extensively herein to encompass salts of its analogues, derivatives, or drugs. Therefore, throughout the description, the term "prostratin" is interchangeable with the phrase "prostratin, or a salt of its analogues, derivatives, or drugs."

[0128] Prostratin can be present in cell culture medium at any suitable concentration. For example, prostratin can be present in cell culture medium at a concentration of at least about 0.1 μM. In one instance, prostratin can be present in cell culture medium at a concentration of at least about 0.5 μM. In other words, prostratin can be present in cell culture medium at concentrations of at least about 1 μM, at least about 2 μM, at least about 4 μM, at least about 8 μM, at least about 10 μM, at least about 15 μM, at least about 16 μM, at least about 20 μM, at least about 25 μM, at least about 30 μM, etc.

[0129] For example, prostratin can be present in cell culture media at concentrations ranging from about 0.1 μM to 50 μM. In other words, prostratin can be present in cell culture media at the following concentrations: about 0.5 μM to about 32 μM, about 1 μM to about 32 μM, about 2 μM to about 32 μM, about 4 μM to about 32 μM, about 5 μM to about 32 μM, about 8 μM to about 32 μM, about 10 μM to about 32 μM, about 15 μM to about 32 μM, about 16 μM to about 32 μM, about 20 μM to about 32 μM, about 25 μM to about 32 μM, etc.

[0130] Cells can be cultured in the presence of prostratin for a suitable duration. Typically, cells are cultured for at least 30 minutes in the presence of prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of prostratin. For example, the maximum duration could be approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0131] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.1 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.1 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.1 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0132] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.5 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.5 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.5 μM prostratin. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0133] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0134] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0135] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0136] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0137] For example, cells can be cultured for at least 30 minutes in the presence of at least 16 μM prostratin. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 16 μM prostratin. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 16 μM prostratin. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0138] In another non-limiting example, the PKC activator present in the cell culture medium is phorbol 12-myristate 13-acetate, its analogues, derivatives, or a salt available as a drug. The term "phorbol 12-myristate 13-acetate" is generally used broadly herein to encompass salts available as its analogues, derivatives, or drugs. Therefore, throughout the description, the term "phorbol 12-myristate 13-acetate" is interchangeable with the phrase "phorbol 12-myristate 13-acetate, its analogues, derivatives, or a salt available as a drug."

[0139] Phtropine 12-myristate 13-acetate can be present in cell culture media at any suitable concentration. For example, phorbol 12-myristate 13-acetate can be present in cell culture media at a concentration of at least about 0.1 nM. In one example, phorbol 12-myristate 13-acetate can be present in cell culture media at a concentration of at least about 0.5 nM. In other words, phorbol 12-myristate 13-acetate can be present in cell culture media at concentrations of at least about 1 nM, at least about 2 nM, at least about 4 nM, at least about 8 nM, at least about 10 nM, at least about 15 nM, at least about 16 nM, at least about 20 nM, at least about 25 nM, at least about 30 nM, etc.

[0140] For example, phorbol 12-myristate 13-acetate can be present in cell culture media at concentrations between about 0.1 nM and 50 nM. In other words, phorbol 12-myristate 13-acetate can be present in cell culture media at the following concentrations: about 0.5 nM to about 32 nM, about 1 nM to about 32 nM, about 2 nM to about 32 nM, about 4 nM to about 32 nM, about 5 nM to about 32 nM, about 8 nM to about 32 nM, about 10 nM to about 32 nM, about 15 nM to about 32 nM, about 16 nM to about 32 nM, about 20 nM to about 32 nM, about 25 nM to about 32 nM, etc.

[0141] Cells can be cultured for a suitable duration in the presence of phorbol 12-myristate 13-acetate. Typically, cells can be cultured for at least 30 minutes in the presence of phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of phorbol 12-myristate 13-acetate. Cells can also be cultured for a duration from approximately 30 minutes to approximately 5 days in the presence of phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0142] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.1 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.1 nM phorbol 12-myristate 13-acetate. Cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.1 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0143] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.5 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.5 nM phorbol 12-myristate 13-acetate. Cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.5 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0144] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 nM phorbol 12-myristate 13-acetate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0145] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 nM phorbol 12-myristate 13-acetate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0146] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 nM phorbol 12-myristate 13-acetate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0147] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 nM phorbol 12-myristate 13-acetate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0148] For example, cells can be cultured for at least 30 minutes in the presence of at least 16 nM phorbol 12-myristate 13-acetate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 116 hours, etc., in the presence of at least 16 nM phorbol 12-myristate 13-acetate. Cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 16 nM phorbol 12-myristate 13-acetate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0149] PKC activators can be included in cell culture media in any suitable manner. For example, PKC activators can be added to cell culture media as a supplement. In this embodiment, PKC activators can be added to cell culture media before or after cell culture media has been added to the cells. PKC activators can also be included in cell cultures in other ways known in the art.

[0150] It has been shown that the presence of PKC activators in cell culture medium increases viral vector titers during viral vector production. In this regard, "increased viral vector titers" can include "inducing viral vector titers" or "enhancing viral vector titers" during viral vector production. As will be apparent to those skilled in the art, in this respect, "enhancing" viral vector titers means an increase in viral vector titers relative to viral vector production in the absence of PKC activators. Therefore, viral vector production in the presence of PKC activators increases viral vector titers relative to viral vector production in the absence of PKC activators. Assays suitable for measuring viral vector titers are described herein (e.g., for lentiviruses). In some embodiments, an increase in viral vector titers (e.g., lentiviral vector titers) occurs in the presence or absence of a functional 5'LTR polyA site. In some embodiments, the increase in viral vector titers (e.g., lentiviral vector titers) mediated by PKC activators is independent of polyA site inhibition in the 5'LTR of the vector genome.

[0151] In some instances, the presence of a PKC activator can increase the viral vector titer by at least 30% during viral vector production, relative to viral vector production in the absence of a PKC activator. Suitablely, the PKC activator can increase the viral vector titer by at least 35% (suitably at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000%) compared to viral vector production in the absence of a PKC activator.

[0152] The method described herein is particularly advantageous when viral vector production occurs in the presence of a PKC activator and an HDAC inhibitor. Therefore, a method for producing viral vectors is provided, comprising culturing cells containing nucleic acid sequences encoding components of a viral vector in a cell culture medium containing a PKC activator and an HDAC inhibitor.

[0153] Methods for inducing viral vector production are known, in which cells are cultured in the presence of an HDAC inhibitor (typically sodium butyrate) in the absence of other transcription promoters. The inventors have now discovered that exposing cells to a specific combination of an HDAC inhibitor and a PKC activator results in an unexpected further increase (enhancement) in viral vector titers during viral vector production.

[0154] The combination of PKC activators and HDAC inhibitors described herein can be used to produce any suitable viral vector. Examples of viral vectors that can be produced by methods are provided elsewhere in this document, and these examples include viral vectors selected from the following: retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors. Detailed information on each of these vectors is provided elsewhere and they are used equivalently herein.

[0155] The method using a combination of PKC activators and HDAC inhibitors is particularly suitable for the production of retroviral vectors, especially lentiviral vectors. For example, the method described herein can be used to produce lentiviral vectors selected from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, and sheep exmyelinating virus lentiviral vectors. In one instance, the method described herein can be used to produce lentiviral vectors selected from HIV (e.g., HIV-1, HIV-2) or EIAV lentiviral vectors.

[0156] The method described herein, which utilizes a combination of PKC activators and HDAC inhibitors, is particularly useful when producing self-inactivated (SIN) viral vectors (e.g., SIN lentiviral vectors). The characteristics of SIN vectors are described in more detail elsewhere in this document. In specific instances, the SIN vector may be a third-generation SIN viral vector (e.g., a third-generation lentiviral vector).

[0157] In one instance, the cell culture medium contained a PKC activator and an HDAC inhibitor.

[0158] Nuclear DNA is wrapped around histones. Histones play a crucial role in the epigenetic regulation of gene expression through acetylation modifications, and this is controlled by a balance between the activities of histone acetyltransferases (HATs) and histone deacetylases (HDACs), which attach or remove acetyl groups from the lysine tails of these histone barrels. Acetyl groups mask the close interaction between positively charged lysine residues and the DNA phosphate backbone, resulting in a more "open" chromatin state. HDACs remove these acetyl groups, resulting in a more "tight" or compressed DNA-histone state.

[0159] Histone deacetylases (HDACs) are enzymes that remove acetyl groups from lysine residues in core histones, thus leading to condensed and transcriptionally silent chromatin formation. Currently, 18 known histone deacetylases exist, classified into four groups. Group I HDACs include HDAC1, HDAC2, HDAC3, and HDAC8, associated with the yeast RPD3 gene. Group II HDACs include HDAC4, HDAC5, HDAC6, HDAC7, HDAC9, and HDAC10, associated with the yeast Hdal gene. Group III HDACs, also known as sirtuins, are associated with the Sir2 gene and include SIRT1-7. Group IV HDACs contain only HDAC11 and possess characteristics of both Group I and Group II HDACs.

[0160] As used herein, the term "HDAC" refers to one or more histone deacetylases.

[0161] As used herein, the term "HDAC inhibitor" refers to a substance that reduces the rate of a reaction catalyzed by HDAC. In Xu et al., OncogeneExemplary HDAC inhibitors are disclosed in (2007), 26, 5541-5552, specifically in Table 2 on page 5543, the entire contents of which are incorporated herein by reference. In this document, the terms “histone deacetylase inhibitor,” “HDAC inhibitor,” and “HDACi” are used interchangeably. The HDAC inhibitors described herein may be selective or non-selective for a particular type of histone deacetylase.

[0162] Several HDAC inhibitors are known in the art. HDAC inhibitors can be selected from isohydroxamic acid, cyclic peptides, benzamides, or aliphatic acids, or their pharmaceutically available salts or derivatives. Examples of HDAC inhibitors belonging to each of these classes can be found in Kim HJ, Bae SC. Histone deacetylase inhibitors: molecular mechanisms of action and clinical trials as anti-cancer drugs. Am J Transl Res. 2011;3(2):166–179. Figure 1 This document, in its entirety, is incorporated herein by reference. HDAC inhibitors can be aliphatic acids, such as butyric acid, valproic acid, valeric acid, or phenylbutyric acid, or salts available for use with these drugs. HDAC inhibitors can be hydroxamic acids, such as hypophenylaminohydroxamic acid, pabisostat, belisstat, gilvesta, or abexistat, or salts available for use with these drugs. HDAC inhibitors can be cyclic peptides, such as romidesin, or salts available for use with these drugs. HDAC inhibitors can be benzamide, pyridin-3-ylmethyl N-[[4-[(2-aminophenyl)carbamoyl]phenyl]methyl]carbamate, or N-(2-aminophenyl)-4-[[(4-pyridin-3-ylpyrimidin-2-yl)amino]methyl]benzamide, or salts available for use with these drugs. HDAC inhibitors can be butyric acid, valproic acid, valeric acid, phenylbutyric acid, or hypophenylaminohydroxamic acid, or salts available for use with these drugs. Methods for identifying HDAC inhibitors are well known in the art. Examples of methods suitable for identifying HDAC inhibitors are provided by Wei et al., PLoS Pathog. 2014 Apr 10;10(4):e1004071 and Zaikos et al. J Virol. 2018 Mar 15; 92(6):e02110-17.

[0163] In one instance, the HDAC inhibitor may be selected from aliphatic HDAC inhibitors or oxime HDAC inhibitors. Suitable aliphatic HDAC inhibitors include (but are not limited to) sodium butyrate, sodium valproate, or valproic acid, their analogues, derivatives, or salts available as pharmaceuticals. Particularly suitable aliphatic HDAC inhibitors are sodium butyrate, its analogues, derivatives, or salts available as pharmaceuticals.

[0164] Sodium butyrate is the sodium salt of butyrate. Sodium valproate is the sodium salt of valproic acid. Valeric acid is also known as pentanoic acid.

[0165] Generally, the term "sodium butyrate" is used extensively in this document to encompass the salts available for its analogues, derivatives, or pharmaceuticals. Therefore, throughout the description, the term "sodium butyrate" is interchangeable with the phrase "sodium butyrate, its analogues, derivatives, or pharmaceuticals available for salts."

[0166] Generally, the term "sodium valproate" is used extensively in this document to encompass the salts available for its analogues, derivatives, or pharmaceuticals. Therefore, throughout the description, the term "sodium valproate" is interchangeable with the phrase "sodium valproate, its analogues, derivatives, or pharmaceuticals available for salts."

[0167] Generally, the term “valeric acid” is used extensively in this document to cover its analogues, derivatives, or pharmaceutically available salts. Therefore, throughout the description, the term “valeric acid” is interchangeable with the phrase “valeric acid, its analogues, derivatives, or pharmaceutically available salts”.

[0168] Suitable oxime acid HDAC inhibitors include (but are not limited to) phenylaminoisohydroxamic acid, its analogues, derivatives or salts available for use with the drug.

[0169] Generally, the term “hypophenylaminohydroxamic acid” is used extensively in this document to cover its analogues, derivatives or available salts of pharmaceuticals. Therefore, throughout the description, the term “hypophenylaminohydroxamic acid” is interchangeable with the phrase “hypophenylaminohydroxamic acid, its analogues, derivatives or available salts of pharmaceuticals”.

[0170] In one specific example, a method for producing a viral vector is provided, comprising culturing cells comprising a nucleic acid sequence encoding a component of the viral vector in a cell culture medium containing a PKC activator (preferably prostratin) and an HDAC inhibitor (preferably sodium butyrate). Suitable concentrations of the PKC activator are provided above. Corresponding concentrations of the HDAC inhibitor are provided below.

[0171] HDAC inhibitors can be present in cell culture media at any suitable concentration. Those skilled in the art can readily identify suitable concentration ranges using conventional experimental methods. For example, methods similar to those described in the following examples section can be used to identify HDAC inhibitor concentrations that enhance viral titers. Several methods for measuring viral titers are known in the art. Further details are provided elsewhere herein.

[0172] Cells can be cultured for a suitable duration in the presence of an HDAC inhibitor. Typically, the PKC activator and HDAC inhibitor are present in the culture medium simultaneously for at least a certain culture time. The PKC activator and HDAC inhibitor can be added to the cells simultaneously or sequentially. For example, an HDAC inhibitor can be added to the cells, with the PKC activator added simultaneously with or at a certain point after the HDAC inhibitor. For instance, the PKC activator can be added to the cells 0 to 10 hours after the HDAC inhibitor.

[0173] Typically, in the presence of HDAC inhibitors, cell cultures are cultured for a duration similar to that of the PKC activators used in combination. For example, cells can be cultured for at least 30 minutes in the presence of HDAC inhibitors. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of HDAC inhibitors. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of HDAC inhibitors. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0174] As will be apparent to those skilled in the art, it is generally advantageous to passage cells to fresh medium when the cell culture duration is at least 2 days. In instances where cell culture includes passage duration in the presence of an HDAC inhibitor, the fresh medium used for passage obviously also contains the HDAC inhibitor of interest. In other words, the cell culture medium containing the HDAC inhibitor can be replaced during culture (partially or completely removed from the cells and replaced with fresh medium containing the HDAC inhibitor).

[0175] For example, an HDAC inhibitor present in cell culture medium can be sodium butyrate. Sodium butyrate can be present in cell culture medium at any suitable concentration. For example, sodium butyrate can be present in cell culture medium at a concentration of at least about 1 mM. In one instance, sodium butyrate can be present in cell culture medium at a concentration of at least about 2 mM. In other words, sodium butyrate can be present in cell culture medium at concentrations of at least about 2.5 mM, at least about 3 mM, at least about 4 mM, at least about 5 mM, at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 25 mM, etc.

[0176] For example, sodium butyrate can be present in cell culture media at concentrations ranging from about 1 mM to 50 mM. In other words, sodium butyrate can be present in cell culture media at the following concentrations: about 2 mM to about 30 mM, about 2.5 mM to about 30 mM, about 3 mM to about 30 mM, about 4 mM to about 30 mM, about 5 mM to about 30 mM, about 8 mM to about 30 mM, about 10 mM to about 30 mM, about 15 mM to about 30 mM, about 20 mM to about 30 mM, about 25 mM to about 30 mM, etc.

[0177] Cells can be cultured in the presence of sodium butyrate for a suitable duration. Typically, cell culture in the presence of sodium butyrate is for a duration similar to that of the PKC activator used in combination. In one example, cells are cultured for at least 30 minutes in the presence of sodium butyrate. In other words, cells can be cultured for durations such as at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of sodium butyrate. Cells can also be cultured for durations from approximately 30 minutes to approximately 5 days in the presence of sodium butyrate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0178] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 mM sodium butyrate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 mM sodium butyrate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 mM sodium butyrate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0179] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 mM sodium butyrate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 mM sodium butyrate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 mM sodium butyrate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0180] For example, cells can be cultured for a duration of at least 30 minutes in the presence of at least 2.5 mM sodium butyrate. In other words, cells can be cultured for durations of at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2.5 mM sodium butyrate. Cells can also be cultured for a duration of approximately 30 minutes to approximately 5 days in the presence of at least 2.5 mM sodium butyrate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0181] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 mM sodium butyrate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 mM sodium butyrate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 mM sodium butyrate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0182] For example, cells can be cultured for a duration of at least 30 minutes in the presence of at least 5 mM sodium butyrate. In other words, cells can be cultured for a duration of at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 5 mM sodium butyrate. For example, cells can be cultured for a duration of approximately 30 minutes to approximately 5 days in the presence of at least 5 mM sodium butyrate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0183] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 mM sodium butyrate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 mM sodium butyrate. For example, cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 mM sodium butyrate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0184] The concentrations and durations of sodium butyrate described above can be, for example, appropriately combined with the concentrations and durations provided for prostratin.

[0185] Alternatively, the above-mentioned concentrations and durations of sodium butyrate can be, for example, appropriately combined with the concentrations and durations provided for phorbol 12-myristate 13-acetate.

[0186] As another example, an HDAC inhibitor present in cell culture medium can be sodium valproate. Sodium valproate can be present in cell culture medium at any suitable concentration. For example, sodium valproate can be present in cell culture medium at a concentration of at least about 1 mM. In one example, sodium valproate can be present in cell culture medium at a concentration of at least about 2 mM. In other words, sodium valproate can be present in cell culture medium at the following concentrations: at least about 2.5 mM, at least about 3 mM, at least about 4 mM, at least about 5 mM, at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 25 mM, etc.

[0187] For example, sodium valproate can be present in cell culture media at concentrations ranging from about 1 mM to 50 mM. In other words, sodium valproate can be present in cell culture media at the following concentrations: about 2 mM to about 30 mM, about 2.5 mM to about 30 mM, about 3 mM to about 30 mM, about 4 mM to about 30 mM, about 5 mM to about 30 mM, about 8 mM to about 30 mM, about 10 mM to about 30 mM, about 15 mM to about 30 mM, about 20 mM to about 30 mM, about 25 mM to about 30 mM, etc.

[0188] Cells can be cultured in the presence of sodium valproate for a suitable duration. Typically, cell culture in the presence of sodium valproate is for a duration similar to that of the PKC activator used in combination with it. In one example, cells are cultured in the presence of sodium valproate for at least 30 minutes. In other words, cells can be cultured in the presence of sodium valproate for durations of at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc. Cells can also be cultured in the presence of sodium valproate for durations from approximately 30 minutes to approximately 5 days. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0189] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 mM sodium valproate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 mM sodium valproate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0190] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 mM sodium valproate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 mM sodium valproate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0191] For example, cells can be cultured for at least 30 minutes in the presence of at least 2.5 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2.5 mM sodium valproate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2.5 mM sodium valproate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0192] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 mM sodium valproate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 mM sodium valproate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0193] For example, cells can be cultured for at least 30 minutes in the presence of at least 5 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 5 mM sodium valproate. For example, cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 5 mM sodium valproate. For example, the maximum duration can be (for example) approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0194] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 mM sodium valproate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 mM sodium valproate. For example, cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 mM sodium valproate. For example, the maximum duration can be (for example) approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0195] The concentrations and durations of sodium valproate described above can be, for example, appropriately combined with the concentrations and durations provided for prostratin.

[0196] Alternatively, the above-mentioned concentrations and durations of sodium valproate can be appropriately combined, for example, with the concentrations and durations provided for phorbol 12-myristate 13-acetate.

[0197] As another example, an HDAC inhibitor present in cell culture medium can be valeric acid. Valeric acid can be present in cell culture medium at any suitable concentration. For example, valeric acid can be present in cell culture medium at a concentration of at least about 1 mM. In one example, valeric acid can be present in cell culture medium at a concentration of at least about 2 mM. In other words, valeric acid can be present in cell culture medium at the following concentrations: at least about 2.5 mM, at least about 3 mM, at least about 4 mM, at least about 5 mM, at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 25 mM, etc.

[0198] For example, valeric acid can be present in cell culture media at concentrations ranging from about 1 mM to 50 mM. In other words, valeric acid can be present in cell culture media at the following concentrations: about 2 mM to about 30 mM, about 2.5 mM to about 30 mM, about 3 mM to about 30 mM, about 4 mM to about 30 mM, about 5 mM to about 30 mM, about 8 mM to about 30 mM, about 10 mM to about 30 mM, about 15 mM to about 30 mM, about 20 mM to about 30 mM, about 25 mM to about 30 mM, etc.

[0199] Cells can be cultured in the presence of valeric acid for a suitable duration. Typically, in the presence of valeric acid, cells are cultured for a duration similar to that of the PKC activator used in combination. In one instance, cells are cultured in the presence of valeric acid for at least 30 minutes. In other words, cells can be cultured in the presence of valeric acid for durations of at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc. Cells can also be cultured in the presence of valeric acid for durations from approximately 30 minutes to approximately 5 days. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0200] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.1 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.1 mM valerate. Cells can be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.1 mM valerate. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0201] For example, cells can be cultured for at least 30 minutes in the presence of at least 0.5 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 0.5 mM valerate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 0.5 mM valerate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0202] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 mM valerate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 mM valerate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0203] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 mM valerate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 mM valerate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0204] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 mM valerate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 mM valerate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0205] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 mM valerate. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 mM valerate. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 mM valerate. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0206] The concentrations and durations of valerate described above can be, for example, appropriately combined with the concentrations and durations provided for prostratin.

[0207] Alternatively, the above concentrations and durations of valerate can be, for example, appropriately combined with the concentrations and durations provided for phorbol 12-myristate 13-acetate.

[0208] As another example, an HDAC inhibitor present in cell culture medium can be subberanilohydroxamic acid. Subberanilohydroxamic acid can be present in cell culture medium at any suitable concentration. For example, subberanilohydroxamic acid can be present in cell culture medium at a concentration of at least about 0.1 μM. In one example, subberanilohydroxamic acid can be present in cell culture medium at a concentration of at least about 0.5 μM. In other words, subberanilohydroxamic acid can be present in cell culture medium at concentrations of at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least about 5 μM, at least about 6 μM, at least about 10 μM, etc.

[0209] For example, hypophenylaminohydroxamic acid can be present in cell culture media at concentrations between about 0.1 μM and 50 μM. In other words, hypophenylaminohydroxamic acid can be present in cell culture media at the following concentrations: about 0.5 μM to about 30 μM, about 0.5 μM to about 16 μM, about 1 μM to about 16 μM, about 2 μM to about 16 μM, about 3 μM to about 16 μM, about 4 μM to about 16 μM, about 5 μM to about 16 μM, about 6 μM to about 16 μM, about 10 μM to about 16 μM, about 10 μM to about 30 μM, etc.

[0210] Cells can be cultured for a suitable duration in the presence of hypophenylaminohydroxamic acid. Typically, in the presence of valeric acid, cells are cultured for a duration similar to that of the PKC activator used in combination with it. In one example, cells are cultured for at least 30 minutes in the presence of hypophenylaminohydroxamic acid. In other words, cells can be cultured for durations such as at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, and at least 18 hours in the presence of hypophenylaminohydroxamic acid. Cells can also be cultured for durations from approximately 30 minutes to approximately 5 days in the presence of hypophenylaminohydroxamic acid. For example, the maximum duration could be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0211] For example, cells can be cultured for at least 30 minutes in the presence of at least 1 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 1 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 1 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0212] For example, cells can be cultured for at least 30 minutes in the presence of at least 2 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0213] For example, cells can be cultured for at least 30 minutes in the presence of at least 2.5 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 2.5 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 2.5 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0214] For example, cells can be cultured for at least 30 minutes in the presence of at least 4 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 4 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 4 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0215] For example, cells can be cultured for at least 30 minutes in the presence of at least 5 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 5 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 5 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0216] For example, cells can be cultured for at least 30 minutes in the presence of at least 8 μM hydroxamic acid. In other words, cells can be cultured for at least 30 minutes, at least 60 minutes, at least 2 hours, at least 6 hours, at least 12 hours, at least 18 hours, etc., in the presence of at least 8 μM hydroxamic acid. Cells can also be cultured for approximately 30 minutes to approximately 5 days in the presence of at least 8 μM hydroxamic acid. For example, the maximum duration can be, for example, approximately 5 days, approximately 4 days, approximately 2 days, or approximately 24 hours.

[0217] The concentrations and durations described above for phenylaminohydroxamic acid can be, for example, appropriately combined with the concentrations and durations provided for prostratin.

[0218] Alternatively, the concentrations and durations described above for phenylaminohydroxamic acid can be, for example, appropriately combined with the concentrations and durations provided for phorbol 12-myristate 13-acetate.

[0219] HDAC inhibitors can be included in cell culture media using any suitable method. For example, HDAC inhibitors can be added to cell culture media as a supplement. In this embodiment, the HDAC inhibitor can be added to the cell culture media before or after the cell culture media has been added to the cells. HDAC inhibitors can also be included in cell cultures using other methods known in the art.

[0220] During viral vector production, the presence of an HDAC inhibitor in the cell culture medium has been shown to increase viral vector titers when combined with a described PKC activator. In this respect, “increase in viral vector titer” can include “inducing viral vector titer” or “increasing viral vector titer” during viral vector production. As will be apparent to those skilled in the art, in this respect, “increase” in viral vector titer means an increase in viral vector titer relative to viral vector production in the absence of either a PKC activator or an HDAC inhibitor. Therefore, viral vector production in the presence of both a PKC activator and an HDAC inhibitor increases viral vector titer relative to viral vector production in the absence of either a PKC activator or an HDAC inhibitor. Assays suitable for measuring viral vector titer are described herein (e.g., for lentiviruses). In some embodiments, an increase in viral vector titer (e.g., lentiviral vector titer) occurs in the presence or absence of a functional 5'LTR polyA site. In some implementations, the increase in viral vector titer (e.g., lentiviral vector titer) mediated by PKC activator is independent of polyA site inhibition in the 5'LTR of the vector genome.

[0221] In some instances, the presence of PKC activators and HDAC inhibitors can increase viral vector titers by at least 30% during viral vector production, relative to viral vector production in the absence of either PKC activators or HDAC inhibitors. Suitably, PKC activators can increase viral vector titers by at least 35% (suitably at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000%) during viral vector production, relative to viral vector production in the absence of either PKC activators or HDAC inhibitors.

[0222] The methods described herein can be part of a suitable viral vector production procedure to increase viral vector titers. Therefore, the methods provided herein can be used to produce viral vectors as part of a first or subsequent (e.g., a second) harvest.

[0223] Nucleotide sequences encoding vector components can be introduced into cells simultaneously or sequentially in any order.

[0224] As will be apparent to those skilled in the art, in these methods, the vector components may include the RNA genome of gag, env, rev, and / or lentiviral vectors. These vector components are encoded by nucleotide sequences described elsewhere herein.

[0225] (ii) Virus vector production system

[0226] This article also provides a viral vector production system, which includes: i) Cells comprising nucleic acid sequences encoding viral vector components; and ii) Cell culture medium containing PKC activator.

[0227] In one instance, the cell culture medium contained a PKC activator and an HDAC inhibitor.

[0228] The methods section above provides detailed information on suitable viral vectors, PKC activators and concentrations, HDAC inhibitors and concentrations, cells and cell culture media, and these are used equivalently in this document.

[0229] Furthermore, the terms “viral vector production system,” “culture,” “cell,” “nucleic acid sequence,” “viral vector,” “viral vector component,” “cell culture,” and “cell culture medium” are described in more detail in the general definitions section of this document, and are used equivalently herein.

[0230] (iii) Application

[0231] The inventors have for the first time recognized that PKC activators can be used to increase viral vector titers during viral vector production. They have also shown that PKC activators can be advantageously combined with HDAC inhibitors to further increase viral vector titers during viral vector production.

[0232] The methods section above provides detailed information on suitable viral vectors, PKC activators and concentrations, HDAC inhibitors and concentrations, cells and cell culture media, and these are used equivalently in this document.

[0233] Furthermore, the terms “viral vector production system,” “culture,” “cell,” “nucleic acid sequence,” “viral vector,” “viral vector component,” “cell culture,” and “cell culture medium” are described in more detail in the general definitions section of this document, and are used equivalently herein.

[0234] B. Modified U1 snRNA

[0235] In the context of lentiviral vector production, specifically, the methods, viral vector production systems, and uses described herein that include PKC activators (and optionally HDAC inhibitors) may also include co-expression of modified U1 snRNAs as further described herein. Therefore, when considering lentiviral vector production, each characteristic described relative to the PKC activator (and optionally HDAC inhibitor) can be combined with the characteristics described in this section relative to the modified U1 snRNAs.

[0236] The inventors have previously demonstrated that the yield titer of lentiviral vectors can be enhanced by co-expression of U1 snRNA-based non-coding RNAs, which are modified so that they no longer target endogenous sequences (splicing donor sites) but instead target sequences within the vRNA molecule. They have now also found that co-expression of modified U1 snRNAs during the viral vector production method described herein leads to a further increase in viral vector yield titers. Therefore, methods, systems, and uses are provided herein in which a PKC activator and modified U1 snRNAs (optionally with an HDAC inhibitor, as described above) are used in combination. The method includes the co-expression of modified U1 snRNAs along with other vector components during vector production. The modified U1 snRNAs are designed to eliminate binding to shared splicing donor sites by replacing the native splicing donor annealing sequence in the U1 snRNA with a heterologous sequence complementary to the target sequence within the vector genomic vRNA. The optimal properties of the modified U1 snRNAs, including target sequence and complementarity length, design, and expression pattern, are described below.

[0237] Modified U1 snRNA

[0238] Human U1 snRNA (small nuclear RNA) is 164 nt long and has a well-defined structure consisting of 4 stem-loops (see [link]). Figure 11 During the early steps of intron splicing, endogenous noncoding RNA, U1 snRNA, via natural splice donor annealing sequences (e.g., 5'-ACUUACCUG-3' (SEQ ID NO: 2)), binds to a shared 5' splice donor site (e.g., 5'-MAGGURR-3' (SEQ ID NO: 1), where M is A or C and R is A or G). Stem-loop I binds to the U1A-70K protein, which has been shown to be important for polyA repression. Stem-loop II binds to the U1A protein, and the 5'-AUUUGUGG-3' (SEQ ID NO: 3) sequence binds to the Sm protein, which, together with stem-loop IV, is important for U1 snRNA processing. Modified U1 snRNA as described herein introduces a heterologous sequence complementary to the target sequence within the vector genomic vRNA molecule at the site of the natural splice donor targeting sequence (see [link to documentation]). Figure 11 ).

[0239] As used herein, the terms “modified U1 snRNA,” “redirected U1 snRNA,” “retargeted U1 snRNA,” “reused U1 snRNA,” and “mutant U1 snRNA” indicate U1 snRNA that has been modified so that it no longer binds to the shared 5' splice donor site sequence (e.g., 5'-MAGGURR-3' (SEQ ID NO: 1)) used to initiate the splicing process of the target gene. Therefore, modified U1 snRNA is U1 snRNA that has been modified so that, based on the complementarity of the donor site sequence with the native splice donor annealing sequence at the 5' end of the U1 snRNA, it no longer binds to the splice donor site sequence (e.g., 5'-MAGGURR-3' (SEQ ID NO: 1)). Alternatively, modified U1 snRNA is designed so that it binds to a unique RNA sequence (target site) within the packaging region of the lentiviral vector genome molecule, i.e., a nucleotide sequence unrelated to gene splicing. The nucleotide sequence within the packaging region of the lentiviral vector genome molecule can be pre-selected. Therefore, the modified U1 snRNA is a U1 snRNA that has been modified so that its 5' end binds to the nucleotide sequence within the packaging region of the lentiviral vector genome molecule. Thus, based on the complementarity between the target site sequence and the short sequence at the 5' end of the modified U1 snRNA, the modified U1 snRNA binds to the target site sequence.

[0240] As used herein, the terms “natural splice donor annealing sequence” and “natural splice donor targeting sequence” refer to short sequences at the 5' end of endogenous U1 snRNAs that are broadly complementary to the shared 5' splice donor sites of introns. A natural splice donor annealing sequence may be 5'-ACUUACCUG-3' (SEQ ID NO: 2).

[0241] As used herein, the term “shared 5' splice donor site” refers to a shared RNA sequence at the 5' end of an intron used in splice site selection, for example, having the sequence 5'-MAGGURR-3' (SEQ ID NO: 1).

[0242] As used herein, the terms “nucleotide sequence within the packaging region of a lentiviral vector genome sequence,” “target sequence,” and “target site” refer to a site within the packaging region of a lentiviral vector genome molecule that has a specific RNA sequence pre-selected as a target site for binding modified U1 snRNA.

[0243] As used herein, the terms "packaging region of a lentiviral vector genome molecule" and "packaging region of a lentiviral vector genome sequence" refer to the region located at the 5' end of the lentiviral vector genome, starting from the 5' U5 domain and extending to the region derived from... gag The packaging region at the ends of the gene sequence. Therefore, the packaging region of a lentiviral vector genome molecule includes the 5' U5 domain, PBS element, stem-loop (SL)1 element, SL2 element, SL3ψ element, SL4 element, and elements derived from... gag The sequence of the gene. In this field, during lentiviral vector production, the complete genome is provided trans-associated. gag Genes are commonly used to enable the production of replication-defective viral vector particles. Trans-provided... gag The nucleotide sequence of the gene does not need to be encoded by wild-type nucleotides, but it can be codon-optimized; importantly, it is provided in trans form. gag The key property of the gene is that it encodes and directs the expression of the gag and gagpol proteins. Therefore, those skilled in the art will understand that if the complete gene is provided trans-associated during lentiviral vector production... gag In the context of genes, the term "packaging region of a lentiviral vector genome molecule" can refer to the region at the 5' end of a lentiviral vector genome molecule, from the beginning of the 5' U5 domain to the "core" packaging signal at the SL3ψ element. as well as From the ATG codon (present in SL4) to the remaining ones present on the vector genome. gag Natural ends of nucleotide sequences gag Nucleotide sequence.

[0244] As used in this article, the term "derived from" gag "Gene sequence" refers to a sequence derived from the ATG codon up to nucleotide 688, which can exist, for example, be maintained, in the vector genome (Kharytonchyk, S. et al., 2018, J. Mol. Biol., 430:2066-79). gag Any genes natural sequence.

[0245] As used herein, the terms “introducing a heterologous sequence into the first 11 nucleotides of U1 snRNA, which encompasses the natural splice donor annealed sequence,” “introducing the heterologous sequence into the 9 nucleotides at positions 3- to 11,” and “introducing a heterologous sequence into the first 11 nucleotides of the 5' end of U1 snRNA” include replacing all or part of the first 11 nucleotides or the 9 nucleotides at positions 3- to 11 of U1 snRNA with the heterologous sequence, or modifying the first 11 nucleotides or the 9 nucleotides at positions 3- to 11 of U1 snRNA to have the same sequence as the heterologous sequence.

[0246] As used herein, the terms “introducing a heterologous sequence into a natural splice donor annealed sequence” and “introducing a heterologous sequence into the 5' end of a U1 snRNA into a natural splice donor annealed sequence” include replacing all or part of the natural splice donor annealed sequence with the heterologous sequence or modifying the natural splice donor annealed sequence to have the same sequence as the heterologous sequence.

[0247] Modified U1 snRNA can be used in methods described elsewhere herein, wherein the U1 snRNA has been modified to bind to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence. In some embodiments, the modified U1 snRNA is modified at the 5' end relative to the endogenous U1 snRNA to introduce a heterologous sequence complementary to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence. In some embodiments, the modified U1 snRNA is modified at the 5' end relative to the endogenous U1 snRNA to introduce a heterologous sequence complementary to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence within a natural splice donor annealing sequence.

[0248] The U1 snRNA, relative to the endogenous U1 snRNA, can be modified at the 5' end to replace the sequence covering the natural splice donor annealing sequence with a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0249] The modified U1 snRNA can be a modified U1 snRNA variant. According to the present invention, the modified U1 snRNA variant can be a naturally occurring U1 snRNA variant, a U1 snRNA variant containing a mutation in stem-loop I that eliminates U1-70K protein binding, or a U1 snRNA variant containing a mutation in stem-loop II that eliminates U1A protein binding. The U1 snRNA variant containing a mutation in stem-loop I that eliminates U1-70K protein binding can be U1_m1 or U1_m2, preferably U1A_m1 or U1A_m2.

[0250] In some embodiments, the modified U1 snRNA comprises a nucleotide sequence having at least 70% identity (suitably at least 75%, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) with the master U1 snRNA sequence [cloverleaf shape] (nt 410-562) of the U1_256 sequence as described herein. In some embodiments, the modified U1 snRNA of the present invention comprises the master U1 snRNA sequence [cloverleaf shape] (nt 410-562) of the U1_256 sequence as described herein. The master U1 snRNA sequence [cloverleaf shape] (nt 410-562) of the U1_256 sequence is contained in SEQ ID NO: 4: SEQ ID NO: 4:

[0251] GCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCGGATG TGCTGACCCCTGCGATTTCCCCAAATGTGGGAAACTCGACTGCATAATTTGTGGTAGTGGGGGACTGCGTTCGCGC TTTCCCCTG.

[0252] In some preferred embodiments, the first 11 nucleotides of the U1 snRNA covering the natural splice donor annealing sequence can be entirely or partially replaced by a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence. Suitably, 1-11 (suitably 2-11, 3-11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11) nucleic acids in the first 11 nucleotides of the U1 snRNA are replaced with a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0253] In some embodiments, the natural splice donor annealing sequence may be wholly or partially replaced by a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence. Suitably, 1-11 (suitably 2-11, 3-11, 5-11, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11) nucleic acids of the natural splice donor annealing sequence are replaced by a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence. In a preferred embodiment, the entire natural splice donor annealing sequence is replaced by a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence, i.e., the natural splice donor annealing sequence (e.g., 5'-ACUUACCUG-3' (SEQ ID NO: 2)) is completely replaced by a heterologous sequence according to the invention.

[0254] In some implementations, a modified U1 snRNA containing a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence will encode A at the first nucleotide at the 5' end of the heterologous sequence, regardless of whether A is involved in annealing with the target sequence.

[0255] In some implementations, a modified U1 snRNA containing a heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence will encode AU at the first two nucleotides of the 5' end of the heterologous sequence, regardless of whether A or U is involved in annealing with the target sequence.

[0256] In some implementations, the U1 snRNA modified with a heterologous sequence that is complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence will not encode AU at the first two nucleotides at the 5' end of the heterologous sequence, and the first nucleotide may or may not participate in annealing with the target sequence.

[0257] In some embodiments, the heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises at least 7 nucleotides complementary to said nucleotide sequence. In some embodiments, the heterologous sequence complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence comprises at least 9 nucleotides complementary to said nucleotide sequence. Preferably, the heterologous sequence used in this invention comprises 15 nucleotides complementary to said nucleotide sequence.

[0258] Suitably, the heterologous sequence used in this invention may contain 7-25 (suitably 7-20, 7-15, 9-15, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides. Suitably, the heterologous sequence used in this invention may contain 7 nucleotides. Suitably, the heterologous sequence used in this invention may contain 8 nucleotides. Suitably, the heterologous sequence used in this invention may contain 9 nucleotides. Suitably, the heterologous sequence used in this invention may contain 10 nucleotides. Suitably, the heterologous sequence used in this invention may contain 11 nucleotides. Suitably, the heterologous sequence used in this invention may contain 12 nucleotides. Suitably, the heterologous sequence used in this invention may contain 13 nucleotides. Suitably, the heterologous sequence used in this invention may contain 14 nucleotides.

[0259] Suitably, the heterologous sequence used in this invention may contain 15 nucleotides. Suitably, the heterologous sequence used in this invention may contain 16 nucleotides. Suitably, the heterologous sequence used in this invention may contain 17 nucleotides. Suitably, the heterologous sequence used in this invention may contain 18 nucleotides. Suitably, the heterologous sequence used in this invention may contain 19 nucleotides. Suitably, the heterologous sequence used in this invention may contain 20 nucleotides. Suitably, the heterologous sequence used in this invention may contain 21 nucleotides. Suitably, the heterologous sequence used in this invention may contain 22 nucleotides. Suitably, the heterologous sequence used in this invention may contain 23 nucleotides. Suitably, the heterologous sequence used in this invention may contain 24 nucleotides. Suitably, the heterologous sequence used in this invention may contain 25 nucleotides.

[0260] In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the 5' U5 domain, PBS element, SL1 element, SL2 element, SL3ψ element, SL4 element, and / or a sequence derived from the gag gene. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1, SL2, and / or SL3ψ elements. In some preferred embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1 and / or SL2 elements. In some particularly preferred embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence is located within the SL1 element.

[0261] In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains at least 7 nucleotides. In some embodiments, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains at least 9 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 7-25 (suitably 7-20, 7-15, 9-15, 7, 8, 9, 10, 11, 12, 13, 14, or 15) nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 7 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 8 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 9 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 10 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 11 nucleotides. Suitably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 12 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 13 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 14 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 15 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 16 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 17 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 18 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 19 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 20 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 21 nucleotides. Appropriately, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 22 nucleotides.

[0262] Suitablely, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 23 nucleotides. Suitablely, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 24 nucleotides. Suitablely, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 25 nucleotides. Preferably, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence contains 15 nucleotides.

[0263] Compared to lentiviral vector production without modified U1 snRNA, the binding of modified U1 snRNA to nucleotide sequences within the packaging region of the lentiviral vector genome sequence can enhance lentiviral vector titers during production.

[0264] The modified U1 snRNA can be designed by: (a) selecting a target site (pre-selected nucleotide site) for binding the modified U1 snRNA in the packaging region of the lentiviral vector genome; and (b) introducing a heterologous sequence complementary to the pre-selected nucleotide site selected in step (a) within the 5' end of the U1 snRNA, within a natural splice donor annealed sequence (e.g., 5'-ACUUACCUG-3' (SEQ ID NO: 2)).

[0265] Using conventional techniques in molecular biology, a heterologous sequence complementary to the target site is introduced at the 5' end of the endogenous U1 snRNA, either within or in place of a natural splice donor annealed sequence (e.g., 5'-ACUUACCUG-3' (SEQ ID NO: 2)). This is within the capabilities of those skilled in the art. Generally, suitable conventional methods include directed mutagenesis or substitution via homologous recombination.

[0266] Modifying the 5' end of endogenous U1 snRNA with a natural splicing donor annealed sequence (e.g., 5'-ACUUACCUG-3' (SEQ ID NO: 2)) to have a sequence identical to a heterologous sequence complementary to the target site using conventional techniques in molecular biology is within the capabilities of those skilled in the art. Suitable methods include, for example, directed or random mutagenesis, and subsequent selection of mutations to provide the modified U1 snRNA according to the invention.

[0267] The modified U1 snRNA described in this invention can be produced according to methods generally known in the art. For example, the modified U1 snRNA can be produced by chemical synthesis or recombinant DNA / RNA technology.

[0268] The introduction of the nucleotide sequence encoding the modified U1 snRNA described in this invention into cells using conventional molecular and cell biology techniques is within the capabilities of those skilled in the art. For example, an expression cassette can be used as described below.

[0269] Lentiviral vector production may include co-expression of the modified U1 snRNA of the present invention with vector components in suitable production cells as described herein. The production cells may be stable production cells containing a nucleic acid sequence encoding the modified U1 snRNA. Alternatively, cells may be transiently transfected with a nucleic acid sequence encoding the modified U1 snRNA.

[0270] Therefore, a method for producing lentiviral vectors is provided, comprising the following steps: a) Introducing a nucleotide sequence encoding a vector component and at least one nucleotide sequence encoding a modified U1 snRNA into a cell; b) Select cells containing the nucleotide sequence of the encoding vector component and at least one nucleotide sequence encoding the modified U1 snRNA of the present invention; c) Cells are further cultured in the presence of a PKC activator (and optionally an HDAC inhibitor) under conditions in which lentiviral vectors are generated; and d) Optional isolation of lentiviral vectors.

[0271] Detailed information on PKC activators (and optionally HDAC inhibitors) is provided elsewhere in this article and is used equivalently in this article.

[0272] In these methods, vector components may include the RNA genome of gag, env, rev, and / or lentiviral vectors. These vector components are encoded by nucleotide sequences described elsewhere herein.

[0273] The nucleotide sequence encoding the vector component and at least one nucleotide sequence encoding the modified U1 snRNA of the present invention can be introduced into the cell simultaneously or sequentially in any order. The nucleotide sequence encoding the vector component can be introduced into the cell before the nucleotide sequence encoding the modified U1 snRNA of the present invention. At least one nucleotide sequence encoding the modified U1 snRNA of the present invention can be introduced into the cell before the nucleotide sequence encoding the vector component.

[0274] Therefore, the methods, systems, and uses described herein that include a PKC activator (and optionally an HDAC inhibitor) may also include a modified U1 snRNA, wherein the modified U1 snRNA has been modified to bind to a nucleotide sequence within the packaging region of a lentiviral vector genome sequence.

[0275] Appropriately, the modified U1 snRNA can be modified to introduce a heterologous sequence that is complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0276] Appropriately, the modified U1 snRNA can be modified at the 5' end to introduce the heterologous sequence within 9 nucleotides at positions 3-11.

[0277] Suitable, the modified U1 snRNA can be modified at the 5' end to introduce the heterologous sequence within the natural splice donor annealed sequence. Optionally, 1-9 nucleic acids of the natural splice donor annealed sequence can be replaced with the heterologous sequence.

[0278] Appropriately, the 5' end of the modified U1 snRNA can be replaced with a heterologous sequence that is complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence, replacing the sequence covering the natural splice donor annealing sequence.

[0279] Suitable, the heterologous sequence may contain at least nine nucleotides that are complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0280] Appropriately, the heterologous sequence may comprise 15 nucleotides that are complementary to the nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

[0281] Appropriately, the packaging region of the lentiviral vector genome sequence may begin with the 5' U5- domain and extend to the end of the sequence derived from the gag gene.

[0282] Suitablely, the nucleotide sequence within the packaging region of the lentiviral vector genome sequence may be located within the 5' U5 domain, PBS element, SL1 element, SL2 element, SL3ψ element, SL4 element, and / or a sequence derived from the gag gene. Suitablely, the nucleotide sequence may be located within the SL1, SL2, and / or SL3ψ elements. Suitablely, the nucleotide sequence may be located within the SL1 and / or SL2 elements. Suitablely, the nucleotide sequence may be located within the SL1 element.

[0283] Appropriately, the modified U1 snRNA can be a modified U1A snRNA or a modified U1A snRNA variant.

[0284] Appropriately, the first two nucleotides at the 5' end of the modified U1 snRNA are not AU.

[0285] U1 snRNAs can be encoded by expression cassettes.

[0286] The modified U1 snRNA can be present within cells. In other words, cells used for producing lentiviral vectors can be used in the methods, systems, or uses of the present invention, comprising nucleotide sequences encoding viral vector components (e.g., RNA genomes including gag, env, rev, and lentiviral vectors) and at least one nucleotide sequence encoding the modified U1 snRNA as described herein. Alternatively, stable or transient production cells for producing lentiviral vectors can be used in the methods, systems, or uses of the present invention, comprising at least one nucleotide sequence encoding the modified U1 snRNA as described herein.

[0287] For example, a suitable method for producing lentiviral vectors may include the following steps: a. Introduce into cells the nucleotide sequence encoding vector components (e.g., RNA genomes including gag, env, rev, and lentiviral vectors) and at least one nucleotide sequence encoding a modified U1 snRNA as described herein; b. Optionally, select cells containing the nucleotide sequence of the encoding vector component and at least one modified U1snRNA; c. Cells are cultured in the presence of a PKC activator (and optionally an HDAC inhibitor) under conditions where the vector component is co-expressed with the modified U1 snRNA and a lentiviral vector is produced.

[0288] Table 8 provides examples of suitable modified U1 snRNA sequences. This includes, for example, sequences associated with 305U1, 179U1, and 256U1, which are used in the following Examples section to illustrate the invention. Of these modified U1 snRNAs, 256U1 is particularly preferred.

[0289] Detailed information on PKC activators (and optionally HDAC inhibitors) is provided elsewhere in this article and is used equivalently in this article.

[0290] C. Major splice donor (MSD) mutation

[0291] In the context of lentiviral vector production, specifically, the methods, viral vector production systems, and uses described herein that include a PKC activator (and optionally an HDAC inhibitor and / or modified U1 snRNA) can be used with lentiviral vector genomic molecules that include MSD mutants as further described herein. Therefore, each property described herein with respect to the PKC activator (and optionally an HDAC inhibitor and / or modified U1 snRNA) can be combined with the properties described in this section with respect to MSD mutations.

[0292] Mutations at major splice donor sites in the packaging region of the RNA genome of viral vectors have been shown to be detrimental to vector production titers and additionally activate cryptic splice donors (crSDs) adjacent to the MSD. Aberrant splicing from the MSD or CrSD results in the production of spliced ​​RNA that may not be packaged into the viral vector particle. Splicing from the MSD to cellular transcripts derived from the transcribed sequential reads of the vector integrated into transduced cells has also been reported, raising safety concerns. The inventors have previously described novel mutations within the MSD splice region that result in a less significant reduction in vector titers (in the absence of modified U1 snRNA) but lead to a further increase in titers in the presence of modified U1 snRNA. Such mutations or deletions at major splice donor sites can have an additional improving effect on vector titers, as described herein, and can be used in combination with any other aspect of the invention as described herein.

[0293] RNA splicing is catalyzed by a large RNA-protein complex called the spliceosome, which consists of five small nuclear ribonucleic acid proteins (snRNPs). The boundaries between introns and exons are marked by specific nucleotide sequences within the precursor mRNA, defining the limits where splicing will occur. These boundaries are called "splicing sites." The term "splicing site" refers to a polynucleotide that can be recognized by the splicing apparatus of a eukaryotic cell as suitable for cleavage and / or attachment to another splicing site.

[0294] Splice sites allow the excision of introns present in the precursor mRNA transcript. Typically, the 5' splice boundary is referred to as the "splicing donor site" or "5' splice site," and the 3' splice boundary as the "splicing acceptor site" or "3' splice site." Splice sites include, for example, naturally occurring splice sites, engineered or synthetic splice sites, typical or common splice sites, and / or atypical splice sites, such as cryptic splice sites.

[0295] The splice acceptor site typically consists of three separate sequence elements: a branch point or branch site, a polypyrimidine bundle, and a receptor concordant sequence. The branch point concordant sequence in eukaryotes is YNYTRAC (SEQ ID NO: 5), where Y is pyrimidine, N is any nucleotide, and R is a purine. The 3' receptor splice site concordant sequence is YAG (SEQ ID NO: 6), where Y is pyrimidine (see, for example, Griffiths et al., eds., Modern Genetic Analysis, 2nd ed., WHFreeman and Company, New York (2002)). The 3' splice acceptor site is usually located at the 3' end of the intron.

[0296] Accordingly, the major splicing donor site can be inactivated in the nucleotide sequence of the RNA genome encoding the lentiviral vector used in the methods, systems and applications described herein.

[0297] In other words, the cells used in the methods, systems and uses described herein may contain nucleic acid sequences encoding lentiviral vector components (e.g., gag, env, rev and / or the RNA genome of the lentiviral vector), wherein the major splicing donor sites in the RNA genome of the lentiviral vector are inactivated, for example, mutated or deleted.

[0298] The terms “typical splice site” or “shared splice site” are used interchangeably and refer to conserved splice sites between species.

[0299] The common sequences of the 5' donor splicing site and the 3' acceptor splicing site used in eukaryotic RNA splicing are well known in the art. These common sequences include dinucleotides that are almost unchanged at each end of the intron: GT at the 5' end of the intron and AG at the 3' end of the intron.

[0300] A typical splice donor site concordant sequence can be (for DNA) AG / GTRAGT (SEQ ID NO: 7) (where A is adenine, T is thymine, G is guanine, C is cytosine, R is purine, and " / " indicates a cleavage site). This corresponds to the more general splice donor concordant sequence MAGGURR (SEQ ID NO: 1) described herein. Splice donor sequences are well known in the art to differ from this concordant sequence, particularly in viral genomes where there are other restrictions on the same sequence, such as secondary structures, for example, within vRNA packaging regions. Atypical splice sites are also well known in the art, although they occur less frequently compared to typical splice donor concordant sequences.

[0301] The term "major splicing donor site" refers to the first (master) splicing donor site in the viral vector genome that encodes and is embedded in the natural viral RNA packaging sequence, which is usually located in the 5' region of the viral vector nucleotide sequence.

[0302] In one respect, the viral vector genome does not contain an active major splice donor site, meaning that splicing does not occur from the major splice donor site in the nucleotide sequence, and splicing activity from the major splice donor site is eliminated.

[0303] The major splicing donor site is located in the 5' packaging region of the lentiviral genome. For HIV-1, the common sequence of the major splicing donor is (for DNA) TG / GTRAGT (SEQ ID NO: 8, where A is adenine, T is thymine, G is guanine, C is cytosine, R is purine, and " / " indicates the cleavage site).

[0304] The splice donor region, which is the vector genome region containing the major splice donor site before mutation, can have the following sequences: GGGGCGGCGACTGGTGAGTACGCCAAAAAT (SEQ ID NO: 9) In one instance, the mutant splice donor region may include the following sequences: GGGGCGGCGACTGCAGACAACGCCAAAAAT (SEQ ID NO: 10, MSD-2KO) In one instance, the mutant splice donor region may include the following sequences: GGGGCGGCGAGTGGAGACTACGCCAAAAAT (SEQ ID NO: 11, MSD-2KOv2) In another instance, the mutant splice donor region may include the following sequences: GGGGAAGGCAACAGATAAATATGCCTTAAAAT (SEQ ID NO: 12, MSD-2KOm5) In one instance, prior to modification, the splice donor region may include the following sequence: GGCGACTGGTGAGTACGCC (SEQ ID NO: 13) In this paper, this sequence is also referred to as the "stem-loop 2" region (SL2). This sequence can form a stem-loop structure in the splicing donor region of the vector genome. In one instance, this sequence (SL2) can be deleted from the nucleotide sequence described in this paper.

[0305] Therefore, nucleotide sequences that do not contain SL2 can be used. Alternatively, nucleotide sequences that do not contain sequences based on the above SL2 can also be used.

[0306] The primary splice donor site can have the following shared sequence, where R is a purine and " / " is a cleavage site: TG / GTRAGT (SEQ ID NO: 8) In one instance, R can be guanine (G).

[0307] The primary and covert splice donor regions can have the following core sequences, where " / " represents the cleavage site located at the primary and covert splice donor sites: / GTGA / GTA (SEQ ID NO: 14).

[0308] In one instance, the vector genome of the MSD-mutated vector may have at least two mutations in the major splice donor and the cryptic splice donor regions, wherein the first and second “GT” nucleotides are the tight 3' ends of the major splice donor and the cryptic splice donor nucleotides, respectively.

[0309] In one aspect of the invention, the primary splice donor common sequence is CTGGT (SEQ ID NO: 15). The primary splice donor site may contain the sequence CTGGT (SEQ ID NO: 15).

[0310] In one aspect, the nucleotide sequence contains an inactivated major splice donor site that would otherwise have a cleavage site between nucleotides 13 and 14 corresponding to GGGGCGGCGACTGGTGAGTACGCCAAAAAT (SEQ ID NO: 9).

[0311] As described herein, the nucleotide sequence may also contain inactive cryptic splice donor sites. In one aspect, the nucleotide sequence does not contain an active cryptic splice donor site (3') adjacent to the major splice donor site, meaning that splicing does not occur from the adjacent cryptic splice donor and splicing from said cryptic splice donor site is eliminated.

[0312] The term "covert splice donor site" refers to a nucleic acid sequence that does not function properly as a splice donor site or is not very effective when used as a splice donor site due to the adjacent sequence environment (e.g., the presence of a nearby "preferred" splice donor), but can be activated by mutations in adjacent sequences (e.g., mutations in a nearby "preferred" splice donor) to become a more effective splice donor site.

[0313] In one respect, the occult splice donor site is the first occult splice donor site of the primary splice donor 3'.

[0314] In one aspect, the cryptic splicing donor site is located within 6 nucleotides of the major splicing donor site on the 3' side of the major splicing donor site. Preferably, the cryptic splicing donor site is located within 4 or 5, preferably 4 nucleotides, of the major splicing donor cleavage site.

[0315] In one aspect of the invention, the concealed splicing donor site has a common sequence TGAGT (SEQ ID NO: 16).

[0316] In one aspect, the nucleotide sequence contains an inactive hidden splicing donor site that would otherwise have a cleavage site between nucleotides 17 and 18 corresponding to GGGGCGGCGACTGGTGAGTACGCCAAAAAT (SEQ ID NO: 9).

[0317] In one aspect of the invention, the primary splice donor site and / or the adjacent cryptic splice donor site contain a “GT” motif. In another aspect of the invention, both the primary splice donor site and the adjacent cryptic splice donor site contain a mutated “GT” motif. The mutated GT motif can inactivate splicing activity from both the primary splice donor site and the adjacent cryptic splice donor site. Hereinafter, an example of such a mutation is referred to as “MSD-2KO”.

[0318] In one respect, the splice donor region may contain the following sequences: CAGACA (SEQ ID NO: 17) For example, in one aspect, the mutated splice donor region may contain the following sequences: GGCGACTGCAGACAACGCC (SEQ ID NO: 18) In this paper, another instance of the inactivating mutation is referred to as "MSD-2KOv2".

[0319] In one respect, the mutated splice donor region may contain the following sequences: GTGGAGACT (SEQ ID NO: 19) For example, in one aspect, the mutated splice donor region may contain the following sequences: GGCGAGTGGAGACTACGCC (SEQ ID NO: 20) For example, in one aspect, the mutated splice donor region may contain the following sequences: AAGGCAACAGATAAATATGCCTT (SEQ ID NO: 21) In one respect, the stem loop 2 region, as described above, can be missing from the splice donor region, resulting in the inactivation of both the primary splice donor site and the adjacent occult splice donor site. This missing region is referred to as “ΔSL2” in this paper.

[0320] Various types of mutations can be introduced into the nucleotide sequence of a viral vector to inactivate the main and adjacent cryptic splicing donor sites.

[0321] In one aspect, the mutation is a functional mutation that eliminates or inhibits splicing activity in the splice region. Suitable mutations will be known to those skilled in the art and are described herein.

[0322] For example, point mutations can be introduced into nucleic acid sequences. As used herein, the term "point mutation" refers to any shift in a single nucleotide. Point mutations include, for example, deletions, transitions, and transversions; when present in a protein-coding sequence, these can be classified as nonsense mutations, missense mutations, or silent mutations. An "unintentional" mutation produces a stop codon. A "missense" mutation produces a codon encoding a different amino acid. A "silent" mutation produces a codon encoding the same or a different amino acid that does not alter the protein's function. One or more point mutations can be introduced into a nucleic acid sequence containing a hidden splice donor site. For example, a nucleic acid sequence containing a hidden splice site can be mutated by introducing two or more point mutations therein.

[0323] At least two point mutations can be introduced at several locations within the nucleic acid sequence containing the primary splice donor and cryptic splice donor sites to attenuate splicing from the splice donor region. In one aspect, the mutation can be located within four nucleotides of the splice donor cleavage site; in a typical splice donor common sequence, this is A1G2 / G3T4, where " / " represents the cleavage site. It is well known in the art that splice donor cleavage sites can differ from this common sequence, particularly in viral genomes where there are other restrictions on the same sequence, such as secondary structures, for example, within vRNA packaging regions. It is well known that the G3T4 dinucleotide is generally the most immutable sequence within a typical splice donor common sequence, and mutations in G3 and / or T4 are likely to achieve the greatest attenuation. For example, for the primary splice donor site in the HIV-1 viral vector genome, this could be T1G2 / G3T4, where " / " represents the cleavage site. For example, for a cryptic splicing donor site in the HIV-1 viral vector genome, this could be G1A2 / G3T4, where " / " represents a cleavage site. Alternatively, point mutations can be introduced adjacent to the splicing donor site. For example, point mutations can be introduced upstream or downstream of the splicing donor site. In embodiments where multiple point mutations are introduced to mutate the nucleic acid sequence containing the major and / or cryptic splicing donor site, point mutations can be introduced upstream and / or downstream of the cryptic splicing donor site.

[0324] Therefore, nucleotide sequences encoding the RNA genome of lentiviral vectors can be used in the methods, systems, and uses described herein, wherein the major splicing donor site in the RNA genome of the lentiviral vector is inactivated, and wherein the cryptic splicing donor site of the major splicing donor 3' is inactivated.

[0325] Appropriately, the lentiviral vector can be a third-generation lentiviral vector.

[0326] Appropriately, the hidden splice donor site may be the first hidden splice donor site of the primary splice donor site 3'.

[0327] Appropriately, the hidden splicing donor site can be within 6 nucleotides of the primary splicing donor site.

[0328] Appropriately, major splice donor sites and cryptic splice donor sites may be mutated or deleted and / or splicing activity of major splice donor sites and cryptic splice donor sites of RNA genome from lentiviral vectors may be inhibited or eliminated (e.g., in transfected cells or in transduced cells).

[0329] Construction of splice site mutants

[0330] The splice site mutants of this invention can be constructed using various techniques. For example, a mutation can be introduced into a specific locus by synthesizing an oligonucleotide containing a mutant sequence that can be side-linked to a restriction site on a natural sequence fragment. After ligation, the resulting reconstructed sequence contains a derivative with the desired nucleotide insertion, substitution, or deletion.

[0331] Other known techniques that allow alteration of DNA sequences include recombination methods such as Gibson assembly, Golden-gate cloning, and in-fusion.

[0332] As an alternative, oligonucleotide-guided site-specific (or segment-specific) mutagenesis programs can be used to provide altered sequences based on the desired substitutions, deletions, or insertions. Deletion or truncated derivatives of splice site mutants can also be constructed by using appropriate restriction endonuclease sites adjacent to the desired deletion.

[0333] After restriction, the overhang can be filled and the DNA reconnected.

[0334] Exemplary methods for preparing the above-described alterations are disclosed in Sambrook et al. (Molecular cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, 1989). Splice site mutants can also be constructed using PCR mutagenesis, chemical mutagenesis, by forcing erroneous nucleotide incorporation (e.g., Liao and Wise, 1990), or by chemical mutagenesis using randomly mutated oligonucleotides (Horwitz et al., 1989) (Drinkwater and Klinedinst, 1986).

[0335] D. Tat-independent lentiviral vectors

[0336] In the context of lentiviral vector production, specifically, tat-independent lentiviral vectors can be used in methods, viral vector production systems, and applications that include the PKC activator (and optionally HDAC inhibitor) described herein. In one aspect, the lentiviral vector can be a third-generation lentiviral vector. For clarity, the term "tat-independent" should be understood to mean the replacement of the HIV-1 U3 promoter used to drive transcription of the vector genome cassette by a heterologous promoter. In one aspect, tat is not provided in the lentiviral vector production method, system, or application, e.g., tat is not provided in the trans form. In one aspect, the cell or vector or vector production system as described herein does not contain the tat protein.

[0337] definition

[0338] Unless otherwise stated, the practice of this invention will utilize conventional techniques of chemistry, molecular biology, microbiology, and immunology, which are within the capabilities of a person skilled in the art. These techniques are explained in the literature. See, e.g., J. Sambrook, EF Fritsch, and T. Maniatis (1989) Molecular Cloning: ALaboratory Manual, 2nd ed., Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, FM et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, pp. 9, 13, and 16, John Wiley & Sons, New York, NY; B. Roe, J. Crabtree, and A. Kahn (1996) DNA Isolation and Sequencing: EssentialTechniques, John Wiley & Sons; JM Polak and James O'D. McGee (1990) In SituHybridization: Principles and Practice; Oxford University Press; MJ Gait (editor) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and DMJ Lilley and JE Dahlberg (1992) Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these conventional textbooks is incorporated herein by reference.

[0339] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0340] As used herein, the term "protein" includes proteins, polypeptides, and peptides. As used herein, the term "protein" includes single-chain polypeptide molecules and complexes of multiple polypeptides, wherein the constituent polypeptides are linked by covalent or non-covalent linkages. As used herein, the terms "polypeptide" and "peptide" refer to polymers in which the monomers are amino acids and the monomers are linked together by peptide or disulfide bonds.

[0341] As used herein, the term "amino acid sequence" is synonymous with the terms "peptide" and / or "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

[0342] The methods, systems, and uses described herein may include one of the specified PKC activators or their analogues, derivatives, or pharmaceutical salts. The methods, systems, and uses described herein may also include one of the specified HDAC inhibitors or their analogues, derivatives, or pharmaceutical salts.

[0343] The term “analog” encompasses structural analogs. As used herein, the term “structural analog” refers to a compound that shares structural features with the indicated compound but differs structurally in other respects, such as by including or lacking one or more other chemical motifs.

[0344] The term "derivative" can refer to a molecule that has been altered in a manner that does not affect its biological activity. Derivatives can be functional derivatives of the parent molecule or biologically effective analogs.

[0345] The term "pharmaceutical-grade salt" is intended to include salts of active compounds prepared by a relatively non-toxic acid or base, based on specific substituents present on the compounds described herein. When the compounds of the present invention contain relatively acidic functionality, base addition salts can be obtained by contacting the neutral form of these compounds in pure form or in a suitable inert solvent with a sufficient amount of the desired base. Examples of pharmaceutically-grade base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salts, or similar salts. When the compounds of the present invention contain relatively basic functionality, acid addition salts can be obtained by contacting the neutral form of these compounds in pure form or in a suitable inert solvent with a sufficient amount of the desired acid. Examples of acid addition salts usable for pharmaceuticals include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, monohydrocarbonic acid, phosphoric acid, monohydrophosphoric acid, dihydrophosphoric acid, sulfuric acid, monohydrosulfuric acid, hydroiodic acid, or phosphorous acid, and those derived from relatively non-toxic organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, octanoic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. Salts of amino acids, such as arginine salts, and salts of organic acids, such as glucuronic acid or galacturonic acid, are also included (see, for example, Berge et al., “Pharmaceutical Salts”, Journal of Pharmaceutical Science, 1977, 66, 1-19). Certain specific compounds of the present invention contain basic and acidic functionalities that allow the conversion of said compounds into base or acid addition salts.

[0346] Carrier / Expression Box

[0347] Vectors are tools that allow or facilitate the transfer of entities from one environment to another. According to the present invention and by way of example, some vectors used in recombinant nucleic acid technology allow the transfer of entities, such as nucleic acid segments (e.g., heterologous DNA segments, such as heterologous cDNA segments), to target cells and their expression within those cells. Vectors can facilitate the integration of nucleotide sequences within target cells. For example, such vectors can facilitate the integration of nucleotide sequences encoding the modified U1 snRNA described herein to maintain the nucleotide sequences encoding the modified U1 snRNA described herein and their expression within target cells.

[0348] The vector may contain one or more selectable marker genes (e.g., a neomycin resistance gene) and / or tracer marker genes (e.g., a gene encoding green fluorescent protein (GFP)). The vector may be used, for example, to infect and / or transduce target cells. The vector may also contain nucleotide sequences that enable the vector to replicate in the host cells in question.

[0349] Vectors may be or may include expression cassettes (also known as expression constructs). Expression cassettes, as described herein, contain nucleic acid regions with sequences capable of being transcribed. Therefore, sequences encoding mRNA, tRNA, and rRNA are included within this definition.

[0350] The term “box”—which is synonymous with terms such as “conjugate,” “constructor,” and “hybrid”—includes a polynucleotide sequence that is directly or indirectly linked to a promoter.

[0351] Expression cassettes typically contain a promoter for expressing a nucleotide sequence that encodes the nucleotide sequence and, optionally, a regulator that encodes the nucleotide sequence. For example, an expression cassette encoding a viral vector component typically contains a promoter for expressing a nucleotide sequence that encodes the viral vector component and, optionally, a regulator that encodes the nucleotide sequence. Preferably, the cassette contains a polynucleotide sequence that is at least operatively linked to the promoter.

[0352] In the context of methods, systems, or uses incorporating the modified U1 snRNA described herein, expression cassettes can be used to deliver modified U1 snRNA to host cells. For example, an expression cassette may include a promoter for expression of a nucleotide sequence encoding the modified U1 snRNA and, optionally, a regulator encoding the nucleotide sequence of the modified U1 snRNA. The expression cassette can be used to replicate the nucleotide sequence encoding the modified U1 snRNA in vitro in compatible target cells. Therefore, modified U1 snRNA can be prepared in vitro by introducing an expression cassette encoding the modified U1 snRNA into compatible target cells and growing the target cells under conditions that lead to the expression of the modified U1 snRNA. The introduction of the expression cassettes described herein into cells using conventional molecular and cell biology techniques is within the capabilities of those skilled in the art. Modified U1 snRNA can be recovered from target cells using methods well known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines.

[0353] The choice of expression cassette, such as a plasmid, granulosome, viral, or phage vector, will generally depend on the host cell to which it will be introduced. Expression cassettes can be DNA plasmids (supercoiled, nicked, or linearized), microcircular DNA (linear or supercoiled), plasmid DNA containing only the region of interest after digestion and purification of the plasmid backbone by restriction endonucleases, or DNA produced using an enzymatic DNA amplification platform, such as doggybone DNA (dbDNA™), where the final DNA is used in a tightly ligated form or where it has been prepared (e.g., digested with restriction endonucleases) to have open nicked ends.

[0354] The methods, viral vector production systems, and uses described herein are for the production of viral vectors. As will be apparent to those skilled in the art, any suitable viral vector can be produced using the methods, viral vector production systems, and uses described herein. For example, suitable viral vectors may be selected from the following: retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, and vaccinia virus vectors. In one instance, the viral vector is a self-inactivated (SIN) viral vector.

[0355] Adenovirus and adeno-associated virus vectors

[0356] Adenoviruses can also be detected using the methods described in this article. Adenoviruses are double-stranded, linear DNA viruses that do not replicate via RNA intermediates. There are more than 50 different human serotypes of adenoviruses, which are divided into 6 subgroups based on their gene sequences.

[0357] Adenoviruses are double-stranded DNA, non-enveloped viruses capable of transducing a wide range of human and non-human cell types in vivo, in vitro, and in vitro. These cells include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiomyocytes, synovial cells, primary mammary epithelial cells, and postmitotically terminally differentiated cells, such as neurons.

[0358] Adenoviral vectors can also transduce non-dividing cells. This is crucial for diseases such as cystic fibrosis, where affected cells in the lung epithelium have a slow turnover rate. In fact, some trials are utilizing adenovirus-mediated cystic fibrosis transporter (CFTR) transfer to the lungs of suffering adult cystic fibrosis patients.

[0359] Adenoviruses have been used as vectors for gene therapy and for heterologous gene expression. Their large (36kb) genomes can accommodate up to 8kb of exogenous inserted DNA and are capable of efficient replication in complement cell lines, producing extremely high titers of up to 10¹² transduction units per milliliter. Therefore, adenoviruses are one of the best systems for studying gene expression in primary non-replicating cells.

[0360] Expressing viral or exogenous genes via the adenoviral genome does not require a replicating cell. Adenoviral vectors enter cells via receptor-mediated endocytosis. Once inside the cell, adenoviral vectors rarely integrate into the host chromosome. Instead, they act episomially (independent of the host genome) as a linear genome within the host cell nucleus.

[0361] The use of recombinant adeno-associated virus (AAV) and adenovirus-based viral vectors in gene therapy is extensive, and their production is well documented. AAV-based vectors are typically produced in mammalian cell lines (e.g., HEK293-based) or using baculovirus / Sf9 insect cell systems. AAV vectors can be produced via transient transfection of a vector component encoding DNA, typically with an auxiliary function derived from adenovirus or herpes simplex virus (HSV), or by utilizing cell lines that stably express AAV vector components. Adenovirus vectors are typically produced in mammalian cell lines that stably express adenovirus E1 function (e.g., HEK293-based).

[0362] Adenoviral vectors are typically amplified through helper-dependent replication, by repeatedly infecting production cell lines. Adenoviral vectors and their production systems comprise polynucleotides containing all or part of the adenoviral genome. Well-known adenoviruses are, without limitation, derived from Ad2, Ad5, Ad12, and Ad40. Adenoviral vectors are usually in the form of DNA encapsulated in an adenoviral capsid or packaged in adenoviral DNA in another virus or virus-like form (such as herpes simplex virus and AAV).

[0363] AAV vectors are generally understood to be derived from adenovirus-associated virus serotypes, including, without limitation, vectors of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, and AAV-8. AAV vectors may have one or more AAV wild-type genes, preferably rep and / or cap genes, completely or partially deleted, but retain a functional side-linked ITR sequence. The functional ITR sequence is essential for the rescue, replication, and packaging of AAV viral particles. Therefore, AAV vectors are defined herein to include at least those sequences in cis configuration required for viral replication and packaging (e.g., functional ITRs). The ITR does not need to be a wild-type nucleotide sequence and can be altered, for example, by nucleotide insertion, deletion, or substitution, as long as the sequence provides functional rescue, replication, and packaging. "AAV vector" also refers to its protein coat or capsid, which provides an efficient medium for the delivery of vector nucleic acids to the target cell nucleus. AAV production systems require auxiliary functions, which are typically AAV-derived coding sequences that can be expressed to provide AAV gene products, which in turn act trans-acting on productive AAV replication. Accordingly, AAV auxiliary functions include both the main AAV open reading frame (ORF) rep and cap. The rep expression product has been shown to have a variety of functions, including: recognition, binding, and nicking of the AAV origin of DNA replication; DNA snailase activity; and transcriptional regulation from AAV (other heterologous) promoters. The cap expression product provides the necessary packaging function. In this paper, AAV auxiliary functions are used to supplement the AAV trans-functions missing in AAV vectors. It should be understood that an AAV auxiliary construct generally represents a nucleic acid molecule comprising a nucleotide sequence providing AAV functions missing from the AAV vector, which will be used to generate a transduction vector for delivering the nucleotide sequence of interest. AAV auxiliary constructs are typically used to provide transient expression of the AAV rep and / or cap genes to supplement the missing AAV functions necessary for AAV replication; however, auxiliary constructs lack AAV ITRs and cannot replicate or package themselves. AAV helper constructs can be in the form of plasmids, phages, transposons, granules, viruses, or viral particles. Several AAV helper constructs have been described, such as the commonly used plasmids pAAV / Ad and plM29+45, which encode both Rep and Cap expression products. See, for example, Samulski et al. (1989) J. Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol. 65:2936-2945. Several other vectors encoding Rep and / or Cap expression products have been described. See, for example, U.S. Patent Nos. 5,139,941 and 6,376,237.Additionally, the following is common knowledge: The term "accessory function" refers to the non-AAV-derived viral and / or cellular functions upon which AAV relies for replication. Therefore, the term documents the proteins and RNA required for AAV replication, including those involved in AAV gene transcriptional activation, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of Cap expression products, and AAV capsid assembly. Virus-based accessory functions can originate from any known helper virus, such as adenoviruses, herpesviruses (except herpes simplex virus type 1), and vaccinia virus.

[0364] Herpes simplex virus vector

[0365] Herpes simplex virus (HSV) is a naturally occurring enveloped double-stranded DNA virus that infects neurons. It can hold large fragments of exogenous DNA, which makes it very attractive as a vector system and has been used as a vector for delivering genes to neurons (Manservigiet et al., Open Virol J. (2010) 4:123-156).

[0366] The use of HSV in therapeutic procedures requires attenuated strains so that they cannot establish a lysis cycle. Specifically, if the HSV vector is used for human gene therapy, it is preferable to insert a polynucleotide into the essential gene. This is because if the viral vector encounters a wild-type virus, there will be a possibility of the foreign gene being transferred to the wild-type virus through recombination. However, as long as the polynucleotide is inserted into the essential gene, this recombination transfer in the recipient virus will also result in the deletion of the essential gene and prevent the foreign gene from "escaping" into a population of replicating wild-type viruses.

[0367] vaccinia virus vector

[0368] The method described in this article can also be used to detect the presence of replicating vaccinia virus. Vaccinia virus vectors include MVA or NYVAC. Alternatives to vaccinia virus vectors include fowlpox vectors, such as chickenpox virus or canarypox virus called ALVAC, and strains derived from them, which can infect human cells and express recombinant proteins but cannot replicate.

[0369] In another example, the viral vector is a retroviral vector, preferably a lentiviral vector (e.g., a SIN lentiviral vector). Further details about these viruses are provided elsewhere in this document. Suitable lentiviral vectors may be selected from: HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV, and sheep exmyelinating virus lentiviral vectors. For example, the lentiviral vector may be selected from HIV (e.g., HIV-1, HIV-2) or EIAV lentiviral vectors.

[0370] Retroviral vector

[0371] Retroviral vectors can be derived from or can be derived from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include: murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse mammary tumor virus (MMTV), Raul's sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (MoMLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myeloid histiocytosis virus-29 (MC29), and avian myeloblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin et al. (1997), “Retroviruses”, Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus, pp. 758-763.

[0372] Retroviruses can be broadly classified into two categories: "simple" and "complex." They can even be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are lentiviruses and foam viruses. Coffin et al. (1997) provided a review of these retroviruses in the preceding article.

[0373] The basic structures of retroviral and lentiviral genomes share several common features, such as the 5' LTR and 3' LTR. Between or within these LTRs are located packaging signals that enable genome packaging, primer binding sites, integration sites that allow integration into the target cell genome, and gag / pol and env genes encoding these packaging components—these are polypeptides required for viral particle assembly. Lentivirals possess other features, such as the rev gene and RRE sequence in HIV, which enable the efficient release of integrated proviral RNA transcripts from the nucleus into the cytoplasm of the infected target cell.

[0374] In proviruses, these genes are flanked by regions called long terminal repeats (LTRs). LTRs are responsible for proviral integration and transcription. LTRs also act as enhancer-promoter sequences and can control viral gene expression.

[0375] LTRs are identical sequences, which can be divided into three elements called U3, R, and U5. U3 originates from a sequence unique to the 3' end of the RNA. R originates from sequences repeated at both ends of the RNA, and U5 originates from a sequence unique to the 5' end of the RNA. The size of these three elements can vary significantly in different retroviruses.

[0376] In a typical retroviral vector, at least a portion of one or more protein-coding regions essential for replication can be removed from the virus; for example, gag / pol and env may be absent or nonfunctional. This makes the viral vector replication-deficient.

[0377] Lentiviral vector

[0378] Lentivirals are part of the larger retrovirus family. A detailed list of lentiviruses can be found in Coffin et al. (1997), “Retroviruses”, Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus, pp. 758-763. Briefly, lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include (but are not limited to): human immunodeficiency virus (HIV) (the causative agent of human autoimmune syndrome (AIDS)) and simian immunodeficiency virus (SIV). The non-primate lentivirus group includes the prototype “lentivirus,” namely sheep demyelination virus / Medy virus (VMV), as well as related caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), Medy sheep demyelination virus (MVV), and bovine immunodeficiency virus (BIV).

[0379] Lentiviral viruses differ from retroviruses in that they have the ability to infect both dividing and non-dividing cells (Lewis et al. (1992) EMBO J 11(8):3053-3058 and Lewis and Emerman (1994) J Virol 68(1):510-516). In contrast, other retroviruses, such as MLV, cannot infect non-dividing or slowly dividing cells, such as those that make up tissues such as muscle, brain, lungs, and liver.

[0380] As used herein, a lentiviral vector is a vector containing at least one component that may be derived from a lentivirus. Preferably, this component is involved in the biological mechanism by which the vector infects or transduces target cells and expresses NOI.

[0381] Lentiviral vectors can be used to replicate NOI in vitro in compatible target cells. Therefore, this document describes a method for preparing the protein in vitro by introducing the vector of the present invention into compatible target cells and growing the target cells under conditions that induce NOI expression. The protein and NOI can be recovered from the target cells using methods well known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines, and suitable target cells are described elsewhere herein.

[0382] Vectors can contain "sparers"—gene sequences that block the interaction between promoters and enhancers and act as a barrier to readthrough from adjacent genes. Spareers can exist between one or more lentiviral nucleic acid sequences to prevent promoter interference and readthrough from adjacent genes. If a sparer is present in a vector between one or more lentiviral nucleic acid sequences, each of these isolated genes can be arranged as a single expression unit.

[0383] The basic structure of retroviral and lentiviral genomes shares several common features, such as 5' LTRs and 3' LTRs. Between or within these LTRs are located packaging signals that enable genome packaging, primer binding sites, integration sites that facilitate integration into the target cell genome, and the encoding of these packaging components. gag / pol and env Genes—these are the polypeptides required for viral particle assembly. Lentivirals possess other characteristics, such as those found in HIV. rev Genes and RRE sequences enable the integrated proviral RNA transcripts to be efficiently expelled from the nucleus into the cytoplasm of the infected target cells.

[0384] In proviruses, these genes are flanked by regions called long terminal repeats (LTRs). LTRs are responsible for proviral integration and transcription. LTRs also act as enhancer-promoter sequences and can control viral gene expression.

[0385] LTRs are identical sequences, which can be divided into three elements called U3, R, and U5. U3 originates from a sequence unique to the 3' end of the RNA. R originates from sequences repeated at both ends of the RNA, and U5 originates from a sequence unique to the 5' end of the RNA. The size of these three elements can vary significantly in different retroviruses.

[0386] In a typical lentiviral vector as described herein, at least a portion of one or more protein-coding regions essential for replication can be removed from the virus; for example... gag / pol and env It may not exist or may be non-functional. This makes the viral vector a replication defective type.

[0387] Lentiviral vectors can be derived from primate lentiviruses (e.g., HIV-1) or non-primate lentiviruses (e.g., EIAV).

[0388] Generally speaking, a typical retroviral vector production system involves isolating the viral genome from the main viral packaging function. These components are then normally supplied to separate DNA expression cassettes in the production cells (alternatively, these are referred to as plasmids, expression plasmids, DNA constructs, or expression constructs).

[0389] The vector genome contains the NOI. The vector genome typically requires a packaging signal (ψ), an internal expression cassette containing the NOI, (optionally) a post-transcriptional element (PRE), usually a central polypurine region (cppt), a 3'-ppu, and a self-inactivating (SIN) LTR. The R-U5 region is essential for the proper polyadenylation of both the vector genomic RNA and the NOI mRNA, as well as for reverse transcription. The vector genome may optionally include open reading frames, as described in WO 2003 / 064665, which enables vector production in the absence of revs.

[0390] Packaging functions include gag / pol and env Genes. These are essential for the production of vector particles in cells. Providing these functions to the genome in a trans-formation manner facilitates the production of replication-defective viral vectors.

[0391] Production systems for gamma-retroviral vectors typically require genome sequencing, gag / pol and env A three-component system for expression constructs. The production system for HIV-1-based lentiviral vectors may require additional auxiliary genes. rev Furthermore, for vector genomes, it is necessary to include rev - Reactive elements (RREs). If open reading frames (ORFs) are present within the genome, EIAV-based lentiviral vectors do not need to provide them in trans form. rev (See WO 2003 / 064665).

[0392] Typically, both the "external" promoter (which drives the vector genome cassette) and the "internal" promoter (which drives the NOI cassette) encoded within the vector genome cassette are strong eukaryotic or viral promoters, as are those that drive other vector system components. Examples of these promoters include CMV, EF1α, PGK, CAG, TK, SV40, and ubiquitin promoters. Strong "synthetic" promoters, such as those generated from a DNA library (e.g., the JeT promoter), can also be used to drive transcription. As an alternative, tissue-specific promoters, such as rhodopsin (ρ), rhodopsin kinase (RhoK), genes containing cone-rod homologous frames (CRX), neuroretinal-specific leucine zipper protein (NRL), vitrectomyces macular dystrophy 2 (VMD2), tyrosine hydroxylase, neuron-specific enolase (NSE) promoters, astrocyte-specific glial fibrillary acidic protein (GFAP) promoters, human α1-antitrypsin (hAAT) promoters, phosphoenolpyruvate carboxykinase (PEPCK), and liver fatty acid-binding protein promoters, are used. The following promoters can be used to drive transcription: Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, myodermal lignin promoter, CD68 promoter, CD14 promoter, and B29 promoter.

[0393] The production of viral vectors includes transient co-transfection of production cells with these DNA components or the use of stable production cell lines in which all components are stably integrated into the genome of the production cells (e.g., Stewart HJ, Fong-Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph GS, Mitrophanous KA and Radcliffe PA. (2011). Hum Gene Ther. Mar; 22 (3):357-69). An alternative approach is to use stable packaging cells (in which packaging components are stably integrated) and then transiently transfect them into vector genomic plasmids as needed (e.g., Stewart, HJ, MA Leroux-Carlucci, CJ Sion, KA Mitrophanous and PA Radcliffe (2009). Gene Ther. Jun; 16 (6):805-14). The following methods are also feasible: alternative, incomplete packaging cell lines (with only one or two packaging components stably integrated into the cell line) can be generated, and the missing components can be transiently transfected to generate the vector. The producing cells can also express regulatory proteins, such as members of the tet repressor (TetR) protein group of transcription regulators (e.g., T-Rex, Tet-On, and Tet-Off), members of the cumate inducible switch system group of transcription regulators (e.g., cumate repressor (CymR) proteins), or RNA-binding proteins (e.g., TRAP-tryptophan-activated RNA-binding proteins).

[0394] In one example, the viral vector was derived from EIAV. EIAV has the simplest lentiviral genome structure and is particularly preferred for the use in this invention. Except gag / pol and env In addition to the gene, EIAV encodes three other genes: tat , rev and S2 . Tat It acts as a transcriptional activator of the viral LTR (Derse and Newbold (1993) Virology 194(2):530-536 and Maury et al. (1994) Virology 200(2):632-642) and rev pass rev - Response elements (RREs) regulate and coordinate viral gene expression (Martarano et al. (1994) J Virol 68(5):3102-3111). The mechanisms of action of these two proteins are believed to be broadly similar to those in primates (Martarano et al. (1994) J Virol 68(5):3102-3111). S2 Its function is unknown. Additionally, the EIAV protein Ttm has been identified; it is formed by splicing from the transmembrane protein initiation site to… env Encoded sequence tat The first exon encodes it. In an alternative embodiment of the invention, the viral vector is derived from HIV: HIV differs from EIAV in that it does not encode S2, but unlike EIAV, it encodes vif, vpr, vpu, and nef.

[0395] The term "recombinant retrovirus or lentiviral vector" (RRV) refers to a viral particle that has sufficient retroviral genetic information to allow the RNA genome to be packaged into a target cell in the presence of packaging components.

[0396] Transduction in target cells can include reverse transcription and integration into the target cell genome. RRVs possess non-viral coding sequences that are delivered to target cells via vectors. RRVs cannot replicate independently within target cells to produce infectious retroviral particles. Typically, RRVs lack functional... gag / pol and / or env Genes, and / or other genes necessary for replication.

[0397] Preferably, the RRV vector of the present invention has a minimal viral genome.

[0398] As used herein, the term "minimal viral genome" refers to a viral vector manipulated to remove non-essential elements while retaining those essential for providing the functions required for infection, transduction, and delivery of NOI to target cells. Further details of this strategy can be found in WO 1998 / 17815 and WO 99 / 32646. Minimal EIAV vectors lack... tat , rev and S2 The genes, and not those provided in trans form in the production system. The minimal HIV vector lacks vif, vpr, vpu, tat, and nef.

[0399] Expression cassettes for generating vector genomes within production cells may include transcriptional regulatory control sequences operably linked to a retroviral genome to guide transcription of the genome in production / packaging cells. Expression plasmids for generating vector genomes within production cells may include transcriptional regulatory control sequences operably linked to a retroviral genome to guide transcription of the genome in production / packaging cells. All third-generation lentiviral vectors are deleted in the 5' U3 enhancer-promoter region, and transcription of the vector genome RNA is driven by a heterologous promoter, such as another viral promoter, for example, the CMV promoter, as discussed below. This feature enables vector production independent of tat. Some lentiviral vector genomes require additional sequences for efficient viral production. For example, specifically for HIV, an RRE sequence may be included. However, the need for RRE on (separate) GagPol cassettes (and for sequences provided in trans form) can be reduced or eliminated through codon optimization of the GagPol ORF. rev (dependency). Further details on this strategy can be found in WO2001 / 79518.

[0400] Implementation and rev Alternative sequences with the same function as the / RRE system are also known. For example, they were found in Mason Pfizer monkey virus. revThe / RRE system is a functional analogue. This is called a constitutive transport element (CTE) and contains RRE-type sequences in the genome that are believed to interact with factors in infected cells. Cytokines can be considered as... rev Analogs. Therefore, CTE can be used as... rev / RRE system alternatives. Any other functionally equivalent form of the Rev protein known or available may be relevant to this invention. For example, the Rex protein of HTLV-I is also known to functionally replace the Rev protein of HIV-1. For use in the methods described in this invention, rev RREs may be absent or nonfunctional; in alternatives rev It can exist in RRE or functionally equivalent systems.

[0401] As used herein, the term "functional substitute" refers to a protein or sequence having an alternative sequence that performs the same function as another protein or sequence. In this document, the terms "functional substitute," "functional equivalent," and "functional analogue" are used interchangeably with "functional equivalent form" and "functional analogue" to have the same meaning.

[0402] SIN vector

[0403] The viral vectors described herein can be used in a self-inactivation (SIN) configuration where the viral enhancer and promoter sequences have been deleted. For example, the lentiviral vectors described herein can be used in a SIN configuration. SIN vectors can be generated and transduced in vivo, in vitro, or extracellularly with similar potency to non-SIN vectors. Transcriptional inactivation of the long terminal repeat (LTR) in the SIN provirus should prevent vRNA mobilization and is a property that further reduces the likelihood of the formation of replicative viruses. This should also enable the regulation of gene expression from the internal promoter by eliminating any cis-acting effects of the LTR.

[0404] For example, self-inactivating retroviral vector systems have been constructed by deleting the transcriptional enhancer or enhancer and promoter in the U3 region of the 3' LTR. After one round of vector reverse transcription and integration, these changes are copied into both the 5' and 3' LTRs, resulting in a transcriptionally inactive "provirus." However, any promoters within the LTR in these vectors will still have transcriptional activity. This strategy has been used to eliminate the effects of enhancers and promoters in viral LTRs on transcription from built-in genes. These effects include increased transcription or repression of transcription. This strategy can also be used to exclude downstream transcription from the 3' LTR into genomic DNA. This is of particular concern in human gene therapy, where preventing incidental activation of any endogenous oncogenes is important. Yu et al. (1986) PNAS83: 3194-98; Marty et al. (1990) Biochimie 72:885-7; Naviaux et al. (1996) J. Virol. 70: 5701-5; Iwakuma et al. (1999) Virol. 261:120-32; Deglon et al. (2000) Human Gene Therapy 11: 179-90. The SIN lentiviral vector is described in US 6,924,123 and US 7,056,699.

[0405] Defective Replication Carrier

[0406] In the genome of a replication-defective viral vector, it is possible to... gag / pol and / or env Sequence mutations and / or they may be nonfunctional.

[0407] In typical viral vectors as described herein, at least a portion of one or more coding regions of proteins essential for viral replication can be removed from the vector. This makes the viral vector replication-defective. It is also possible to replace portions of the viral genome with NOI to produce vectors containing NOI capable of transducing non-dividing target cells and / or integrating their genome into the target cell genome.

[0408] In one instance, the viral vector was a non-integrative vector as described in WO 2006 / 010834 and WO 2007 / 071994.

[0409] In another instance, the vector has the ability to deliver sequences lacking or missing viral RNA. In yet another instance, the homology-binding domain on Gag or GagPol can be used to ensure the packaging of the RNA to be delivered. Both of these vectors are described in WO 2007 / 072056.

[0410] Carrier production systems and cells

[0411] The viral vector production system described herein contains a set of nucleotide sequences encoding the components required for viral vector production. Therefore, the vector production system contains a set of nucleotide sequences encoding the components essential for the production of viral vector particles. Typically, this set of nucleotide sequences is present within the cell.

[0412] The term "viral vector production system," "vector production system," or "production system" will be understood as a system containing the components necessary for the production of viral vectors. In this document, the terms "components necessary for vector production" and "viral vector components" are used interchangeably. A viral vector production system contains a set of nucleotide sequences encoding the components necessary for the production of viral vector particles.

[0413] A non-limiting example of a viral vector production system described herein is a lentiviral vector production system. The lentiviral vector production system of the present invention comprises a set of nucleotide sequences encoding components essential for lentiviral vector production. Therefore, the lentiviral vector production system comprises a set of nucleotide sequences encoding components essential for the production of lentiviral vector particles. As mentioned above, the nucleotide sequence set is typically present within cells.

[0414] In one instance, the nucleotide sequence set is suitable for the production of lentiviral vectors in a tat-independent system for vector production. As described herein, third-generation lentiviral vectors are U3-dependent (and use a heterologous promoter to drive transcription). In one instance, tat is not provided in the lentiviral vector production system, for example, not in the trans form. In one aspect, the viral vector production system described herein does not contain the tat protein.

[0415] In one instance, the nucleotide sequence set may contain nucleotide sequences encoding the Gag and Gag / Pol proteins, as well as the Env protein, and vector genomic sequences. The nucleotide sequence set may optionally contain nucleotide sequences encoding the Rev protein or its functional alternatives.

[0416] In one embodiment, the viral vector production system includes a modular nucleic acid construct (modular construct). A modular construct is a DNA expression construct containing two or more nucleic acids used in viral vector production. The modular construct may be a DNA plasmid containing two or more nucleic acids used in viral vector production. The plasmid may be a bacterial plasmid. The nucleic acids may encode, for example, gag-pol, rev, env, or a vector genome. Additionally, modular constructs designed to produce packaging and production cell lines may further require encoding transcriptional regulatory proteins (e.g., TetR, CymR) and / or translational repressor proteins (e.g., TRAP) and optional markers (e.g., Zeocin™, hygromycin, blastomycin, puromycin, neomycin resistance genes). Suitable modular constructs are described in EP 3502260, the entire contents of which are incorporated herein by reference.

[0417] Because modular constructs contain nucleic acid sequences encoding two or more viral components within a single construct, the safety profile of these modular constructs is considered, and additional safety features are directly engineered into the constructs. These features include the use of insulators for multiple open reading frames of the viral vector components and / or the specific orientation and arrangement of viral genes within the modular construct. It is believed that by using these features, direct readthrough of replicating viral particles will be prevented.

[0418] Nucleic acid sequences encoding viral vector components can be in reverse and / or alternating transcriptional orientations within a modular construct. Therefore, nucleic acid sequences encoding viral vector components do not exist in the same 5' to 3' orientation, thus allowing viral vector components to be generated from different mRNA molecules. Reverse orientation can mean that at least two coding sequences of different vector components exist in a "head-to-head" and "tail-to-tail" transcriptional orientation. This can be achieved by providing a coding sequence for one vector component, e.g., env, on one strand of the modular construct and a coding sequence for another vector component, e.g., rev, on the opposite strand. Preferably, when there are more than two coding sequences for vector components in the modular construct, at least two coding sequences exist in a reverse transcriptional orientation. Therefore, when there are more than two coding sequences for vector components in the modular construct, each component can be oriented so that it exists in the opposite 5' to 3' orientation to all adjacent coding sequences of the other vector components adjacent to it; that is, alternating 5' to 3' (or transcriptional) orientations can be used for each coding sequence.

[0419] Modular constructs can contain nucleic acid sequences encoding two or more of the following vector components: gag-pol, rev, env, and vector genome. Modular constructs can contain nucleic acid sequences encoding any combination of vector components. In one instance, a modular construct may include nucleic acid sequences encoding the following: i) The RNA genome of a retroviral vector and rev or its functional substitutes; ii) RNA genome and gag-pol of retroviral vectors; iii) The RNA genome and env of retroviral vectors; iv) gag-pol and rev or their functional alternatives; v) gag-pol and env; vi) env and rev or their functional alternatives; vii) RNA genome of retroviral vectors, rev or its functional alternatives, and gag-pol; viii) The RNA genome of the retroviral vector, rev or its functional alternatives, and env; ix) RNA genome of retroviral vectors, gag-pol and env; or x) gag-pol, rev or their functional alternatives, and env, The nucleic acid sequences are in reverse and / or alternating orientations.

[0420] In some instances, the retroviral vector can be a lentiviral vector.

[0421] As indicated elsewhere herein, the viral vector production systems described herein typically contain nucleic acid sequences encoding components of a viral vector within the cell (in other words, the cell contains nucleic acid sequences encoding components of a viral vector). In one instance, the cell of the viral vector production system may contain nucleic acid sequences encoding any one of combinations i) through x) above, wherein the nucleic acid sequences are located at the same gene locus and are in reverse and / or alternating orientations. The same gene locus may represent a single extrachromosomal locus in the cell, for example, a single plasmid, or a single locus in the cell genome (i.e., a single insertion site). The cell may be a stable or transient cell used to produce retroviral vectors, such as lentiviral vectors.

[0422] The DNA expression construct may be a DNA plasmid (supercoiled, nicked, or linearized), microcircular DNA (linear or supercoiled), plasmid DNA containing only the region of interest after the plasmid backbone has been removed by restriction endonuclease digestion and purification, or DNA produced using an enzymatic DNA amplification platform, such as doggybone DNA (dbDNA™), wherein the final DNA is used in a tightly ligated form or wherein it has been prepared (e.g., by restriction endonuclease digestion) to have open nicked ends.

[0423] "Viral vector production cell," "vector production cell," or "production cell" will be understood as a cell capable of producing viral vectors or viral vector particles. A viral vector production cell can be either a "production cell" or a "packaging cell." One or more DNA constructs of a viral vector system can be stably integrated or genetically maintained within the viral vector production cell. Alternatively, all DNA components of the viral vector system can be transiently transfected into the viral vector production cell. In another alternative, production cells stably expressing some components can be transiently transfected with the remaining components required for vector production.

[0424] As used herein, the term "packaging cell" refers to a cell that contains the elements necessary for the production of viral vector particles but lacks the vector genome. Optionally, these packaging cells contain elements capable of expressing viral structural proteins (such as...). gag , gag / pol and env One or more expression boxes.

[0425] Production / packaging cells can be any suitable cell type. Production cells are generally mammalian cells, but can be, for example, insect cells.

[0426] As used herein, the terms "producer / producing cell" or "vector production / producing cell" refer to a cell containing all the elements necessary for the production of viral vector particles. The producing cell can be a stable production cell line or transiently obtained, or it can be a stable packaging cell in which the viral genome is transiently expressed.

[0427] The cells used to produce the vector can be cells cultured in vitro, such as tissue culture cell lines. Suitable cell lines include (but are not limited to) mammalian cells, such as cell lines derived from murine fibroblasts or human cell lines. Preferably, the cells used to produce the vector are derived from human cell lines.

[0428] Cells and production methods

[0429] The methods, viral vector production systems, and applications described in this article are used to produce viral vectors of interest.

[0430] General methods for producing viral vectors from cells (producers / producing cells) containing nucleic acid sequences encoding viral vector components are well known in the art. These methods involve culturing cells under conditions suitable for producing viral vectors, optionally accompanied by further steps of isolating the produced viral vectors.

[0431] Suitable production cells for producing viral vectors can be cells capable of producing viral vectors or viral vector particles when cultured under appropriate conditions. Therefore, the cells typically contain nucleotide sequences encoding vector components, which may include the genomes of gag, env, rev, and the viral vector. Suitable cell lines include (but are not limited to) mammalian cells, such as cell lines derived from murine fibroblasts or human cell lines. They are generally mammalian, including human cells such as HEK293T, HEK293, CAP, CAP-T, or CHO cells, but can be, for example, insect cells such as SF9 cells. Preferably, the vector-producing cells are derived from human cell lines. Therefore, these suitable production cells can be used in any method or application of the present invention.

[0432] Methods for introducing nucleotide sequences into cells are well known in the art and have been previously described. Therefore, the introduction of nucleotide sequences encoding the genomes of vector components, including gag, env, rev, and viral vectors, into cells using conventional techniques in molecular and cell biology is within the capabilities of those skilled in the art.

[0433] Stable production cells can be either packaging or production cells. To generate production cells from packaging cells, a vector genomic DNA construct can be stably or transiently introduced. This can be done using one of the expression vector components, namely the genomic DNA as described in WO 2004 / 022761. gag-polThe components and envelope of the retroviral vector are transduced into suitable cell lines to produce packaging / production cells. Alternatively, a nucleotide sequence can be transfected into the cells, followed by infrequent and random integration into the production cell genome. Transfection methods can be implemented using techniques well-known in the art. For example, stable transfection methods can use constructs engineered to assist in cascading. In another instance, calcium phosphate or commercially available formulations such as Lipofectamine can be used. TM 2000CD(Invitrogen, CA)、FuGENE ® The transfection method is performed using HD or polyethylene imine (PEI). Alternatively, the nucleotide sequence can be introduced into production cells via electroporation. Those skilled in the art will know methods to induce the integration of the nucleotide sequence into production cells. For example, linearization of the nucleic acid construct can be helpful if it is naturally circular. Less random integration methods may include nucleic acid constructs containing regions with shared homology to the endogenous chromosome of mammalian host cells to guide integration to selected sites within the endogenous genome. Furthermore, if recombination sites are present on the construct, these can be used to target recombination. For example, the nucleic acid construct may contain… loxP The site allows for combination with Cre recombinase (i.e., using Cre / derived from P1 phage). lox (System) targeted integration. Alternatively, or otherwise, the recombination site is... att Sites (e.g., from λ phage), where att The site allows for targeted integration in the presence of λ integrase. This allows viral genes to be targeted to loci within the host cell genome, resulting in high and / or stable expression.

[0434] Other targeted integration approaches are well known in the art. For example, methods for inducing targeted cleavage of genomic DNA can be used to promote targeted recombination at selected chromosomal sites. These methods typically involve inducing double-strand breaks (DSBs) in the endogenous genome, e.g., nicking to induce break repair via physiological mechanisms such as non-homologous end joining (NHEJ). This can be achieved by using specific nucleases, such as engineered zinc finger nucleases (ZFNs), transcription-activator-like effector-free nucleases (TALENs), CRISPR / Cas9 systems with engineered crRNA / tracrRNA (“single-stranded guide RNA”) to guide specific cleavage, and / or using Argonaute-based systems (e.g., from *Thermophilus*). T. thermophilus The nuclease cleaves the nuclease.

[0435] Packaging / production cell lines can be generated by integrating nucleotide sequences using either virus-only transduction or nucleic acid-only transfection methods, or a combination of both.

[0436] Methods for producing retroviral vectors from production cells are described in WO 2009 / 153563, and specifically the processing of retroviral vectors.

[0437] In one instance, the production cell may contain an RNA-binding protein (e.g., tryptophan RNA-binding attenuating protein, TRAP) and / or a Tet repressor (TetR) protein or an alternative regulatory protein (e.g., CymR).

[0438] The production of viral vectors from production cells can be achieved through transfection methods from stable cell lines, which may include an induction step (e.g., doxycycline induction) or a combination of both. Transfection methods well known in the art can be implemented, and examples have been previously described.

[0439] Culture production cells, whether packaging or production cell lines, or those transiently transfected with viral vector-encoded components to increase cell and virus numbers and / or viral titers. Cell culture is performed to enable them to metabolize, and / or grow, and / or divide, and / or produce the viral vector of interest. This can be accomplished by methods well known to those skilled in the art, and methods include (but are not limited to) providing nutrients to the cells, e.g., in a suitable culture medium. Methods may include adherent growth, suspension growth, or a combination thereof. For example, cultures can be performed in tissue culture flasks, tissue culture multiwell plates, culture dishes, roller flasks, corrugated bags, or bioreactors using batch, fed-batch, or continuous systems. For large-scale production of viral vectors via cell culture, cells capable of suspension growth are preferred in the art. The conditions suitable for culturing cells are known (see, for example, Tissue Culture, Academic Press, Kruse and Paterson, eds. (1973) and RI Freshney, Culture of animal cells: A manual of basic technique, 4th edition (Wiley-Liss Inc., 2000, ISBN 0-471-34889-9).

[0440] Cells are initially “stacked” in tissue culture flasks or bioreactors and then grown in multilayer culture containers or large bioreactors (greater than 50L) to produce carrier-produced cells.

[0441] Cells can grow in an adherent mode to produce carrier-based cells. Alternatively, cells can grow in a suspension mode to produce carrier-based cells.

[0442] Nucleotide sequence, including the nucleotide of interest (NOI).

[0443] As used herein, the term "nucleotide sequence" is synonymous with the terms "polynucleotide" and / or "nucleic acid sequence." In relation to this invention, the term "nucleotide sequence" can refer to a double-stranded or single-stranded molecule and includes genomic DNA, cDNA, synthetic DNA, RNA, and chimeric DNA / RNA molecules. Typically, nucleotide sequences covered by this invention are prepared using recombinant DNA techniques (i.e., recombinant DNA). These techniques are well known in the art.

[0444] The polynucleotides of this invention may comprise DNA or RNA. They may be single-stranded or double-stranded. Those skilled in the art will understand that due to the degeneracy of the genetic code, many different polynucleotides can encode the same polypeptide. Furthermore, it should be understood that those skilled in the art can use conventional techniques to prepare nucleotide substitutions that do not affect the sequence of the polypeptide encoded by the polynucleotides of this invention to reflect the codon usage of any particular host organism in which the polypeptides of this invention will be expressed.

[0445] The polynucleotide can be modified by any method available in the art. These modifications can be implemented to enhance the in vivo activity or lifespan of the polynucleotide described in this invention.

[0446] Polynucleotides, such as DNA polynucleotides, can be produced by recombination, synthesis, or any means available to those skilled in the art. They can also be cloned using standard techniques.

[0447] Recombinant methods, such as polymerase chain reaction (PCR) cloning, are typically used to produce longer polynucleotides. This involves preparing a pair of primers (e.g., about 15 to 30 nucleotides) side-linked to the target sequence to be cloned, contacting the primers with mRNA or cDNA obtained from animal or human cells, performing PCR under conditions that result in amplification of the desired region, isolating the amplified fragment (e.g., by purifying the reaction mixture with an agarose gel), and recovering the amplified DNA. Primers can be designed to contain suitable restriction endonuclease recognition sites, allowing the amplified DNA to be cloned into a suitable vector.

[0448] General viral vector elements

[0449] Promoters and enhancers

[0450] The expression of NOI and polynucleotides can be controlled using control sequences, such as transcriptional regulatory elements or translational repressor elements. These include promoters, enhancers and other expression regulatory signals (e.g., the tet repressor (TetR) system) or transgene repression (TRIP) in vector-producing cell systems or other regulators of NOI as described herein.

[0451] Prokaryotic promoters and promoter functions can be used in eukaryotic cells. Tissue-specific or stimulus-specific promoters can be used. Chimeric promoters containing sequence elements from two or more different promoters can also be used.

[0452] Suitable promoter sequences are strong promoters, including those derived from the genomes of viruses such as polymorphonuclear virus, adenovirus, fowlpox virus, bovine papillomavirus, avian sarcoma virus, cytomegalovirus (CMV), retrovirus, and simian virus 40 (SV40), or those derived from heterologous mammalian promoters such as actin promoter, EF1α, CAG, TK, SV40, ubiquitin, PGK, or ribosomal protein promoters. As an alternative, tissue-specific promoters, such as rhodopsin (ρ), rhodopsin kinase (RhoK), genes containing cone-rod homologous frames (CRX), neuroretinal-specific leucine zipper protein (NRL), vitrectomyces macular dystrophy 2 (VMD2), tyrosine hydroxylase, neuron-specific enolase (NSE) promoters, astrocyte-specific glial fibrillary acidic protein (GFAP) promoters, human α1-antitrypsin (hAAT) promoters, phosphoenolpyruvate carboxykinase (PEPCK), and liver fatty acid-binding protein promoters, are used. The following promoters can be used to drive transcription: Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, fibronectin promoter, endoglin promoter, elastase-1 promoter, myodermal lignin promoter, CD68 promoter, CD14 promoter, and B29 promoter.

[0453] Transcription of NOI can be further enhanced by inserting enhancer sequences into the vector. Enhancers are relatively orientation- and position-independent; however, enhancers from eukaryotic viruses, such as the SV40 enhancer and the CMV early promoter enhancer, can be used. The enhancer can be spliced ​​into the vector at the 5' or 3' position of the promoter, but is preferably located at the 5' position of the promoter.

[0454] Promoters may additionally include properties to ensure or enhance expression in suitable target cells. For example, these properties may be conserved regions, such as Pribnow boxes or TATA boxes. Promoters may contain other sequences to influence (thereby maintain, enhance, or degrade) the expression levels of nucleotide sequences. Suitable other sequences include Sh1-introns or ADH introns. Other sequences include inducible elements, such as temperature, chemical, light, or stress-induced elements. Additionally, elements suitable for enhancing transcription or translation may be present.

[0455] NOI regulators

[0456] The complexity in the generation of retroviral packaging / production cell lines and the production of retroviral vectors lies in the constitutive expression of certain retroviral vector components, and NOI is cytotoxic, causing cell death in cells expressing these components and thus preventing vector production. Therefore, the expression of these components (e.g., gag-pol and envelope proteins such as VSV-G) can be regulated. The expression of other non-cytotoxic vector components, such as rev, can also be regulated to minimize the metabolic burden on the cell. Therefore, modular constructs or nucleotide sequences encoding vector components, as described herein, and / or cells, can contain cytotoxic and / or non-cytotoxic vector components associated with at least one regulatory element. As used herein, the term "regulatory element" refers to any element capable of influencing, i.e., increasing or decreasing the expression of a related gene or protein. Regulatory elements include gene switch systems, transcriptional regulatory elements, and translational repressor elements.

[0457] Several prokaryotic regulatory systems have been adapted to generate gene switches in mammalian cells. Gene switch systems (e.g., tetracycline and cumate-inducible switch systems) have been used to control cell lines leading to retroviral packaging and production, thus enabling the expression of one or more retroviral vector components to be switched on during vector production. Gene switch systems include those from the transcription regulator (TetR) protein group (e.g., T-Rex, Tet-On, and Tet-Off), those from the transcription regulator cumate-inducible switch system group (e.g., CymR proteins), and those involving RNA-binding proteins (e.g., TRAP).

[0458] One such tetracycline-inducible system is the tetracycline repressor (TetR) system based on the T-REx™ system. For example, in this system, the tetracycline operon (TetO2) is positioned such that the first nucleotide is 10 bp from the 3' end of the last nucleotide of the TATATAA element of the human cytomegalovirus major immediate early promoter (hCMVp), allowing TetR to function as a repressor independently (Yao F, Svensjo T, Winkler T, Lu M, Eriksson C, Eriksson E., 1998). Hum Gene Ther (9: 1939-1950). In this system, NOI expression can be controlled via the CMV promoter, which contains two copies of the TetO2 sequence inserted in tandem. In the absence of an inducer (tetracycline or its analogue doxycycline [dox]), the TetR homodimer binds to the TetO2 sequence and physically blocks transcription from the upstream CMV promoter. In its presence, the inducer binds to the TetR homodimer, causing an allosteric change that prevents it from binding to the TetO2 sequence, leading to gene expression. The TetR gene can undergo codon optimization, as this has been found to improve translation efficiency, resulting in more stringent control over TetO2-controlled gene expression.

[0459] The TRIP system is described in WO 2015 / 092440, which provides an alternative way to suppress NOI expression in production cells during vector production. TRAP binding sequence (e.g., TRAP-tbs) interactions form the basis of a transgenic protein repressive system for the production of retroviral vectors when constitutive and / or strong promoters, including tissue-specific promoters, are desired to drive transgenes, and particularly when expression of transgenic proteins in production cells leads to a decrease in vector titer and / or an immune response is elicited in vivo due to viral vector delivery of transgenic proteins. (Maunder et al., NatCommun. (2017) Mar 27; 8)

[0460] Briefly, the TRAP-tbs interaction results in translation blockade, thereby inhibiting the translation of transgenic proteins (Maunder et al., Nat Commun. (2017) Mar 27; 8). Translation blockade is effective only in production cells and therefore does not impede DNA- or RNA-based vector systems. The TRiP system is capable of inhibiting translation when transgenic proteins are expressed from constitutive and / or strong promoters, including tissue-specific promoters from monocistronic or polycistronic mRNAs. Unregulated expression of transgenic proteins has been shown to reduce vector titers and affect vector product quality. For transient and stable PaCL / PCL vector production systems, inhibition of transgenic proteins is beneficial for preventing vector titer reduction in production cells when: toxicity or molecular burden issues may lead to cellular stress; when viral vector delivery of transgenic proteins induces an immune response in vivo; when the use of gene-edited transgenes may lead to on-target / off-target effects; or when transgenic proteins may affect vector and / or envelope glycoprotein rejection.

[0461] Encapsulation and pseudomorphization

[0462] In a preferred aspect, lentiviral vectors, as described herein, have been pseudotyped. In this respect, pseudotyped vectors can provide one or more advantages. For example, for HIV-based vectors… env The gene product will restrict these vectors to infect only cells expressing a protein called CD4. However, if these vectors contain... env Genes from other enveloped viruses env Sequence substitutions can give them a broader spectrum of infection (Verma and Somia (1997) Nature 389 (6648):239-242). For example, researchers have pseudotyped HIV-based vectors with glycoproteins derived from VSV (Verma and Somia (1997) Nature 389 (6648):239-242).

[0463] In another alternative, the Env protein can be a modified Env protein, such as a mutant or engineered Env protein. Modifications can be made or selected to introduce targeting capabilities or reduce toxicity or for other purposes (Valsesia-Wittman et al. 1996 J Virol 70: 2056-64; Nilson et al. (1996) Gene Ther 3(4):280-286; and Fielding et al. (1998) Blood 91(5):1802-1809 and references cited therein).

[0464] The carrier can be pseudomorphized using any type of molecule.

[0465] As used in this article, “env” should refer to an endogenous lentiviral envelope or a heterogeneous envelope as described in this article.

[0466] VSV-G

[0467] The envelope glycoprotein (G) of vesicular stomatitis virus (VSV, a rod-shaped virus) is an envelope protein that has been shown to pseudotype certain enveloped viruses and viral vector particles.

[0468] Emi et al. (1991) Journal of Virology 65:1202-1207 first demonstrated its ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope proteins. WO1994 / 294440 taught that retroviral vectors can be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors can be used to transduce a wide range of mammalian cells. More recently, Abe et al. (1998) J Virol 72(8) 6356-6361 taught that non-infectious retroviral particles can be made infectious by adding VSV-G.

[0469] Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-7 successfully pseudotyped retroviral MLV using VSV-G, resulting in vectors with altered host range compared to their native form. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells but also cell lines derived from fish, reptiles, and insects (Burns et al. (1993), ibid.). They have also shown to be more effective than conventional amphiphilic envelopes for a variety of cell lines (Yee et al., (1994)). Proc. Natl. Acad. Sci. USA 91:9564-9568, Emi et al. (1991) Journal of Virology (65:1202-1207). The VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail can interact with the retroviral core.

[0470] The provision of non-retroviral pseudotyped envelopes (such as VSV-G protein) will have the advantage that vector particles can be concentrated to high titers without loss of infectivity (Akkina et al. (1996)). J. Virol.(70:2581-5). Retroviral envelope proteins are clearly unable to withstand the shear forces during ultracentrifugation, likely because they consist of two non-covalently linked subunits. Centrifugation can disrupt the interactions between these subunits. In contrast, VSV glycoproteins consist of a single unit. Therefore, VSV-G protein pseudotypening could potentially offer advantages for efficient target cell infection / transduction and production processes.

[0471] WO 2000 / 52188 describes the generation of pseudotyped retroviral vectors from stable production cell lines with vesicular stomatitis virus G protein (VSV-G) as a membrane-bound viral envelope protein, and provides the gene sequence of the VSV-G protein.

[0472] Ross River Virus

[0473] The Ross River virus envelope has been used to pseudotype nonprimate lentiviral vectors (FIVs), followed by systemic administration primarily transducing the liver (Kang et al., 2002). J. Virol. (76:9378-9388). It was reported to be 20 times more efficient than that obtained with the VSV-G pseudotyped vector, and to cause lower cytotoxicity, as measured by serum levels of liver enzymes that indicate hepatotoxicity.

[0474] Baculovirus GP64

[0475] The baculovirus GP64 protein has been proven to be an alternative to the VSV-G viral vector used in the large-scale production of high-titer viruses required for clinical and commercial applications (Kumar M, Bradow BP, Zimmerberg J (2003)). Hum Gene Ther 14(1):67-77). Compared with the VSV-G pseudotyped vector, the GP64 pseudotyped vector has similar broad tropism and similar native titers. Since GP64 expression does not kill cells, constitutively GP64-expressing HEK293T-based cell lines can be generated.

[0476] Alternative coating

[0477] Other envelopes that provide suitable titers when used for pseudotyped EIAV include mokola virus, rabies virus, Ebola virus, and LCMV (lymphocytic choriomeningitis virus). Intravenous infusion of lentivirus pseudotyped with 4070A into mice induced maximum gene expression in the liver.

[0478] Packaging sequence

[0479] As used in the context of this invention, the term "packaging signal" may be used interchangeably with "packaging sequence" or "psi," referring to the non-coding, cis-acting sequence required for capsidation of the retroviral RNA strand during viral particle formation. In HIV-1, this sequence has been located extending at least upstream of the major splice donor site (SD) to... gag Start codon (may include some or all) gag The locus (to the 5' sequence of nucleotide 688). In EIAV, the packaging signal contains the 5' coding region from the R region to Gag.

[0480] As used herein, the terms "extended package signal" or "extended package sequence" refer to signals that have a directional orientation around the psi sequence. gag Further extensions of the gene sequence. Including these additional packaging sequences can improve the efficiency of vector RNA insertion into viral particles.

[0481] It has been confirmed that the capsidation determinants of feline immunodeficiency virus (FIV) RNA are discrete and discontinuous, comprising a region located at the 5' end of the genomic mRNA (R-U5) and a region located at... gag Another region within the proximal 311nt (Kaye et al., JVirol. Oct;69(10):6588-92 (1995)).

[0482] Internal ribosome entry site (IRES)

[0483] Insertion of RES elements allows expression of multiple coding regions from a single promoter (Adam et al. (above); Koo et al. (1992) Virology 186:669-675; Chen et al. 1993 J. Virol 67:2142-2148). IRES elements were first discovered at the untranslated 5' end of parvoviruses, where they initiate cap-independent translation of viral proteins (Jang et al. (1990) Enzyme 44:292-309). When located between open reading frames in RNA, IRES elements facilitate ribosome entry at the IRES element, subsequently initiating downstream translation, thereby allowing efficient translation of downstream open reading frames.

[0484] Mountford and Smith presented a review of IRES (TIG May 1995, Vol. 11, No. 5: 179-184). Several different IRES sequences are known, including those from encephalocardiitis virus (EMCV) (Ghattas, IR et al., Mol. Cell. Biol., 11: 5848-5859 (1991); BiP protein [Macejak and Sarnow, Nature 353: 91 (1991)]; those from Drosophila antennal leg genes (exons d and e) [Oh et al., Genes & Development, 6: 1643-1653 (1992)]; and those from poliovirus (PV) [Pelletier and Sonenberg, Nature 334: 320-325 (1988); see also Mountford and Smith, TIG 11, 179-184 (1985)].

[0485] IRES elements from PV, EMCV and porcine vesicular virus have previously been used in retroviral vectors (Coffin et al., above).

[0486] The term “IRES” includes any sequence or combination of sequences that performs or improves the function of an IRES. IRES can be viral (such as EMCV IRES, PV IRES, or FMDV 2A-like sequences) or cell-derived (such as FGF2 IRES, NRF IRES, Notch 2 IRES, or EIF4 IRES).

[0487] In order for IRES to be able to initiate the translation of each polynucleotide, it should be located between or before the polynucleotides in the modular building block.

[0488] Nucleotide sequences used to develop stable cell lines require the addition of selectable markers to select cells for stable integration. These selectable markers can be expressed as a single transcriptional unit within the nucleotide sequence, or the translation of selectable markers in polycistronic information can preferably be initiated using IRES elements (Adam et al. 1991 J. Virol. 65, 4985).

[0489] Genetic orientation and insulators

[0490] It is well known that nucleic acids are directional, and this ultimately affects cellular mechanisms such as transcription and replication. Therefore, when genes are part of the same nucleic acid construct, they can have relative orientations to each other.

[0491] In some instances, at least two nucleic acid sequences at the same locus in a cell or construct may be in reverse and / or alternating orientations. In other words, consecutive gene pairs at that particular locus will not have the same orientation. This can help prevent transcription and translation from reading through each other when the region is expressed at the same physical location in the host cell.

[0492] When producing the required nucleic acids based on vectors located at the same gene loci within the cell, alternating orientations are advantageous for viral vector production. This, in turn, can improve the safety of the resulting constructs to prevent the generation of replicative viral vectors.

[0493] When nucleic acid sequences are in reverse and / or alternating orientations, the use of insulators can prevent the incorrect expression or silencing of NOI from its genetic environment.

[0494] The term "sparistemon" refers to a class of DNA sequence elements that, when bound to a sparistemon-binding protein, protect genes from signals from surrounding regulators. There are two types of sparists: enhancer-blocking and chromatin barrier. When a sparistemon is located between a promoter and an enhancer, its enhancer-blocking function protects the promoter from the transcriptional enhancement effects of the enhancer (Geyer and Corces 1992; Kellum and Schedl 1992). Chromatin barrier sparists function by preventing the advance of nearby condensed chromatin, which would cause transcriptionally active chromatin regions to become transcriptionally inactive chromatin regions, leading to gene silencing. Sparists that inhibit heterochromatin diffusion, thereby inhibiting gene silencing, recruit enzymes involved in histone modification to prevent this process (Yang J, Corces VG. 2011;110:43-76; Huang, Li et al. 2007; Dhillon, Raab et al. 2009). Sparists can possess one or both of these functions, and the chicken β-globulin sparistemon (cHS4) is an example of this. This type of insulator is the most widely studied vertebrate insulator, rich in G+C, and possesses both enhancer blocking and heterochromatin barrier functions (Chung JH, Whitely M, Felsenfeld G Cell. 1993;74:505–514). Other insulators with enhancer blocking functions are not limited to this type, but include the following: human β-globulin insulator 5 (HS5), human β-globulin insulator 1 (HS1), and chicken β-globulin insulator (cHS3) (Farrell CM1, West AG, Felsenfeld G., Mol Cell Biol. 2002 Jun;22(11):3820-31; J Ellis et al. EMBO J. 1996 Feb 1; 15(3): 562–568). In addition to reducing unwanted distal interactions, insulators also help prevent promoter interference between adjacent viral nucleic acid sequences (i.e., when a promoter from one transcription unit impairs the expression of an adjacent transcription unit). Using insulators between each viral vector nucleic acid sequence can reduce direct readout and help prevent the formation of replicating viral vector particles.

[0495] Insulators can be present between each viral nucleic acid sequence. In one implementation, the use of insulators prevents promoter-enhancer interactions from one NOI expression cassette that interacts with another NOI expression cassette in a nucleotide sequence encoding a vector component.

[0496] Vector genome and gag-polInsulators can exist between sequences. This limits the possibility of generating replicative viral vectors and “wild-type” RNA transcripts, thereby improving the safety profile of the construct. Moriarity et al., Nucleic Acids Res. 2013 Apr;41(8):e92, cited the use of insulator elements to improve the expression of stably integrated multi-gene vectors.

[0497] Carrier titer

[0498] Technicians will understand that there are several different methods for determining viral vector titers (e.g., lentiviral vector, SIN vector viral titers). Titers are typically described as transduction units per mL (TU / mL). Titers can be increased by increasing the number of vector particles and by increasing the specific activity of the vector formulation.

[0499] Therapeutic uses

[0500] Viral vectors as described herein or cells or tissues transduced with viral vectors as described herein can be used in medicine.

[0501] Additionally, viral vectors as described herein, production cells or tissues transduced with lentiviral vectors as described herein, can be used to prepare pharmaceutical agents to deliver nucleotides of interest to target sites for which they are desired. As previously mentioned, these uses of viral vectors or transduced cells can be for therapeutic or diagnostic purposes.

[0502] Therefore, cells transduced via viral vectors as described herein are provided.

[0503] "Cells transduced via viral vector particles" should be understood as cells that have been transduced with nucleic acids carried by viral vector particles, specifically target cells.

[0504] Nucleotides of interest

[0505] In one embodiment of the invention, the nucleotide of interest is translated in target cells lacking TRAP.

[0506] "Target cells" should be understood as cells in which NOI is desired to be expressed. NOI can be introduced into target cells using the viral vector of this invention. Delivery to target cells can be performed in vivo, in vitro, or ex vivo.

[0507] In a preferred embodiment, the nucleotide of interest resulted in a therapeutic effect.

[0508] NOIs can have therapeutic or diagnostic applications. Suitable NOIs include (but are not limited to) sequences encoding the following: enzymes, cofactors, cytokines, chemokines, hormones, antibodies, antioxidant molecules, engineered immunoglobulin-like molecules, single-chain antibodies, fusion proteins, immunostimulatory molecules, immunomodulatory molecules, chimeric antigen receptors, transdomain negative mutants of target proteins, toxins, conditional toxins, antigens, transcription factors, structural proteins, reporter proteins, subcellular localization signals, tumor suppressor proteins, growth factors, membrane proteins, receptors, vasoactive proteins and peptides, antiviral proteins and ribozymes and their derivatives (such as derivatives with associated reporter groups). NOIs can also encode microRNAs. It is believed, without being bound by theory, that microRNA processing will be inhibited by TRAP.

[0509] In one implementation, NOI can be used to treat neurodegenerative diseases.

[0510] In another implementation, NOI can be used to treat Parkinson's disease and multiple system atrophy.

[0511] In another embodiment, the NOI may encode one or more enzymes involved in dopamine synthesis. For example, the enzyme may be one or more of the following: tyrosine hydroxylase, GTP-cyclohydrolase I, and / or aromatic amino acid dopa decarboxylase. The sequences of all three genes are available (GenBank® accession numbers No. X05290, U19523, and M76180, respectively).

[0512] In another embodiment, the NOI may encode vesicular monoamine transporter 2 (VMAT2). In an alternative embodiment, the viral genome may contain both an NOI encoding an aromatic amino acid dopa decarboxylase and an NOI encoding VMAT2. Such a genome could be used to treat Parkinson's disease, particularly in conjunction with peripheral administration of L-DOPA.

[0513] In another implementation, the NOI may encode a therapeutic protein or a combination of therapeutic proteins.

[0514] In another embodiment, the NOI may encode one or more proteins selected from the following: glial cell-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), neurotrophic factor-3 (NT-3), acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), interleukin-1β (IL-1β), tumor necrosis factor-α (TNFα), insulin-like growth factor-2, VEGF-A, VEGF-B, VEGF-C / VEGF-2, VEGF-D, VEGF-E, PDGF-A, PDGF-B, PDFG-A, and heterodimers and homodimers of PDFG-B.

[0515] In another embodiment, the NOI may encode one or more anti-angiogenic proteins selected from the following: angiotensin, endostatin, platelet factor 4, pigment epithelial-derived factor (PEDF), placental growth factor, restin, interferon-α, interferon-inducible protein, gro-β and tubedown-1, interleukin-1 (IL-1), IL-12, retinoic acid, anti-VEGF antibodies or fragments / variants thereof, such as aflibercept, platelet-reactive protein, VEGF receptor proteins, such as those described in US 5,952,199 and US 6,100,071, and anti-VEGF receptor antibodies.

[0516] In another embodiment, the NOI may encode an anti-inflammatory protein, antibody, or fragment / variant of a protein or antibody selected from the following: NF-κB inhibitors, IL1β inhibitors, TGFβ inhibitors, IL-6 inhibitors, IL-23 inhibitors, IL-18 inhibitors, tumor necrosis factor α and tumor necrosis factor β, lymphotoxin α and lymphotoxin β, LIGHT inhibitors, α-synuclein inhibitors, Tau inhibitors, β-amyloid inhibitors, IL-17 inhibitors, IL-33 inhibitors, IL-33 receptor inhibitors, and TSLP inhibitors.

[0517] In another implementation, NOI can encode the cystic fibrosis transmembrane conduction modulator (CFTR).

[0518] In another implementation, NOI can encode proteins that are typically expressed in visual cells.

[0519] In another implementation, NOI may encode proteins that are typically expressed in photoreceptor cells and / or retinal pigment epithelial cells.

[0520] In another embodiment, the NOI may encode a protein selected from the following: RPE65, aryl hydrocarbon interacting receptor protein-like 1 (AIPL1), CRB1, lecithin retinal acetyltransferase (LRAT), photoreceptor-specific homeobox (CRX), retinal guanylate cyclase (GUCY2D), RPGR interacting protein 1 (RPGRIP1), LCA2, LCA3, LCA5, dystrophin, PRPH2, CNTF, ABCR / ABCA4, EMP1, TIMP3, MERTK, ELOVL4, MYO7A, USH2A, VMD2, RLBP1, COX-2, FPR, harmonin, Rab guard protein 1, CNGB2, CNGA3, CEP 290, RPGR, RS1, RP1, PRELP, glutathione pathway enzyme, and opticin.

[0521] In other implementations, the NOI may encode human coagulation factor VIII or factor IX.

[0522] In other embodiments, the NOI may encode one or more proteins involved in metabolism, selected from: phenylalanine hydroxylase (PAH), methylmalonyl-CoA mutase, propionyl-CoA carboxylase, isovaleryl-CoA dehydrogenase, branched-chain ketoate dehydrogenase complex, glutaryl-CoA dehydrogenase, acetyl-CoA carboxylase, propionyl-CoA carboxylase, 3-methylcrotonyl-CoA carboxylase, pyruvate carboxylase, carbamoyl phosphate synthase (AM), ornithine transcarbamoylase, α-galactosidase A, glucosamine β, cysteine, glucosamine (N-acetyl)-6-sulfatase, N-acetyl-α-glucosidase, glucose-6-phosphatase, ATP7B, ATP8B1, ABCB11, ABCB4, TJP2, N-sulfoglucosamine sulfonyl hydrolase, galactosamine-6-sulfatase, arylsulfatase A. Cytochrome B-245β , ABCD1 Ornithine carbamoyltransferase, arginine succinate synthase, arginine succinate lyase, arginase 1, alanine glycolate aminotransferase, ATP-binding cassette and subgroup B members.

[0523] In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) or a T-cell receptor (TCR). In one embodiment, the CAR is an anti-5T4 CAR. In other embodiments, the NOI may encode B-cell maturation antigen (BCMA), CD19, CD22, CD20, CD138, CD30, CD33, CD123, CD70, prostate-specific membrane antigen (PSMA), Lewis antigen, etc. Y antigen (LeY), tyrosine-protein kinase transmembrane receptor (ROR1), mucin 1, cell surface-associated protein (Muc1), epithelial cell adherent molecule (EpCAM), endothelial growth factor receptor (EGFR), insulin, protein tyrosine phosphatase, non-receptor type 22, interleukin-2 receptor α, helicase C domain 1-induced interferon, human epidermal growth factor receptor (HER2), phosphatidylinositol proteoglycan 3 (GPC3), disialotetrazolium ganglioside (GD2), mesothelin, vesicle endothelial growth factor receptor 2 (VEGFR2), Smith antigen, double-stranded DNA, phospholipids, proinsulin, islet tumor antigen 2 (IA-2), 65 kDa isoform of glutamate decarboxylase (GAD65), chromogranin A (CHGA), islet amyloid polypeptide (IAPP), islet-specific glucose-6-phosphatase catalytic subunit-associated protein (IGRP), zinc transporter 8 (ZnT8).

[0524] In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) against the NKG2D ligand, selected from: ULBP1, 2 and 3, H60, Rae-1a, b, g, d, MICA, MICB.

[0525] In other embodiments, NOI may encode SGSH, SUMF1, GAA, the common γ-chain (CD132), adenosine deaminase, WAS protein, globulin, α-galactosidase A, δ-aminolevulinic acid (ALA) synthase, δ-aminolevulinic acid dehydratase (ALAD), hydroxymethylcholanthane (HMB) synthase, uroporphyrinogen (URO) synthase, uroporphyrinogen (URO) decarboxylase, and coproporphyrinogen (COPRO) oxidation. Enzymes, protoporphyrinogen (PROTO) oxidase, ferrous chelate, α-L-iduronase, iduronate sulfatase, heparin sulfonamide, N-acetylglucosamine glycosidase, heparin-α-aminoglucosinolate N-acetyltransferase, 3N-acetylglucosamine-6-sulfatase, galactose-6-sulfatase, β-galactosidase, N-acetylgalactosamine-4-sulfatase, β-glucuronase, and hyaluronidase.

[0526] In addition to NOI, vectors can also contain or encode siRNA, shRNA, or regulated shRNA. (Dickins et al. (2005) Nature Genetics 37: 1289-1295; Silva et al. (2005) Nature Genetics 37: 1281-1288).

[0527] Indications

[0528] The vectors according to the present invention, including retroviruses and AAV vectors, can be used to deliver one or more NOIs useful in treating the conditions listed in WO 1998 / 05635, WO 1998 / 07859, and WO 1998 / 09985. The nucleotide of interest can be DNA or RNA. Examples of these conditions are shown below: It responds to the following conditions: cytokine and cell proliferation / differentiation activity; immunosuppressive or immunostimulatory activity (e.g., for the treatment of immunodeficiency, including infection with human immunodeficiency virus; regulation of lymphocyte growth; treatment of cancer and various autoimmune diseases; and prevention of transplant rejection or induction of tumor immunity); regulation of hematopoiesis (e.g., treatment of bone marrow or lymphatic diseases); promotion of the growth of bone, cartilage, tendons, ligaments, and nerve tissue (e.g., for wound healing, treatment of burns, ulcers, and periodontal diseases, as well as neurodegeneration); and inhibition or activation of follicle-stimulating hormone (regulation of fertility). Chemotactic / chemopromoting activities (e.g., for mobilizing specific cell types to sites of injury or infection); hemostatic and thrombolytic activities (e.g., for treating hemophilia and stroke); anti-inflammatory activities (e.g., for treating septic shock or Crohn's disease); macrophage-suppressive activities and / or T-cell-suppressive activities and the resulting anti-inflammatory activities; anti-immune activities (i.e., suppression of cellular and / or humoral immune responses, including responses unrelated to inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, and upregulated fas receptor expression in T cells.

[0529] Malignant tumor conditions, including cancer, leukemia, growth, invasion and spread of benign and malignant tumors, angiogenesis, metastasis, ascites and malignant pleural effusion.

[0530] Autoimmune diseases, including arthritis, including rheumatoid arthritis, allergies, psoriasis, Sjögren's syndrome, allergic reactions, asthma, systemic lupus erythematosus, type 1 diabetes, collagen diseases, and other diseases.

[0531] Vascular diseases, including arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vasculitis, acute respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent antithrombotic syndrome, stroke, cerebral ischemia, ischemic heart disease or other diseases.

[0532] Gastrointestinal diseases, including peptic ulcers, ulcerative colitis, Crohn's disease, and other diseases.

[0533] Liver diseases, including liver fibrosis, cirrhosis, and amyloidosis.

[0534] Hereditary metabolic disorders, including phenylketonuria (PKU), Wilson's disease, organic acidemia, glycogen storage disease, urea cycle disorders, cholestasis, and other diseases or conditions.

[0535] Kidney and urinary tract diseases, including thyroiditis or other glandular diseases, glomerulonephritis, lupus nephritis or other diseases.

[0536] Ear, nose, and throat conditions, including otitis or other ear, nose, and throat diseases, dermatitis, or other skin diseases.

[0537] Dental and oral conditions, including periodontitis, gingivitis, or other dental / oral diseases.

[0538] Testicular diseases, including orchitis or epididymo-orchitis, infertility, testicular trauma, or other testicular diseases.

[0539] Gynecological diseases, including placental dysfunction, placental insufficiency, recurrent miscarriage, eclampsia, preeclampsia, endometriosis and other gynecological conditions.

[0540] Ophthalmic diseases, including Leber congenital amaurosis (LCA) (LCA10), posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, choroidal retinitis, uveoretinitis, optic neuritis, glaucoma, including open-angle glaucoma and juvenile congenital glaucoma, intraocular inflammation such as retinitis or cystoid macular edema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, macular degeneration, including age-related macular degeneration (AMD) and juvenile macular degeneration, including Best disease, Best vitrectomyces macular degeneration, Sturges disease, Ussell's syndrome, Dorn's celluloid retinal dystrophy, Sorby's macular dystrophy, and glaucoma. Retinoschisis, cone-rod dystrophy, corneal dystrophy, Fuch dystrophy, Leber congenital cataract, Leber hereditary optic neuropathy (LHON), Addie syndrome, microstomia, degenerative fundus disease, visual trauma, ocular inflammation caused by infection, proliferative vitreoretinopathy, acute ischemic optic neuropathy, excessive scarring, for example, after glaucoma filtration surgery, reaction to eye implants, corneal graft rejection, and other ophthalmic conditions such as diabetic macular edema, retinal vein occlusion, RLBP1-related retinal dystrophy, choroidal agenesis, and color blindness.

[0541] Neurological and neurodegenerative diseases, including Parkinson's disease, complications and / or side effects of Parkinson's disease treatment, AIDS-related dementia syndrome, HIV-related encephalopathy, Dweck's disease, Sidnam's chorea, Alzheimer's disease and other degenerative diseases, CNS conditions or symptoms, stroke, post-poliomyelitis syndrome, mental illness, myelitis, encephalitis, subacute sclerosing panencephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, hypercystinemia, Pompe disease, metachromatic leukodystrophy, Wiscott's disease. Aldrich syndrome, adrenoleukodystrophy, β-thalassemia, sickle cell anemia, Guillain-Barré syndrome, Sidnuma chorea, myasthenia gravis, pseudotumor of the brain, Down syndrome, Huntington's disease, CNS compression or trauma or infection, muscle atrophy and malnutrition, diseases of the central and peripheral nervous systems, conditions or symptoms, motor neuron diseases, including amyotrophic lateral sclerosis, spinal muscular atrophy, spinal cord and lacerations.

[0542] Other diseases and conditions, such as cystic fibrosis, mucopolysaccharidosis, including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, Morchucci syndrome, ADA-SCID, X-related SCID, X-related chronic granulomatous disease, porphyria, hemophilia A, hemophilia B, post-traumatic inflammation, bleeding, blood clotting and acute phase response, cachexia, anorexia, acute infection, septic shock, infectious diseases, diabetes, surgical complications or side effects, bone marrow transplantation or other transplant complications and / or side effects, complications and side effects of gene therapy, for example, due to infection with viral vectors or AIDS, to suppress or inhibit humoral and / or cellular immune responses, thereby used for the prevention and / or treatment of transplant rejection in the case of transplantation of natural or artificial cells, tissues and organs, such as cornea, bone marrow, organs, lens, pacemaker, natural or artificial skin tissue.

[0543] siRNA, microRNA and shRNA

[0544] In some other implementations, the NOI comprises microRNA. MicroRNAs are a very large group of small RNAs naturally occurring in organisms, at least some of which regulate the expression of target genes. The basic members of the microRNA family are... let-7 and lin-4 . let-7 The gene encodes a small, highly conserved RNA substance that regulates the expression of endogenous protein-coding genes during worm development. This active RNA substance is initially transcribed into a ~70 nt precursor, which is then post-transcribed into a mature ~21 nt form. let-7 and lin-4 Both are transcribed into hairpin RNA precursors, which are then processed into their mature forms by the Dicer enzyme.

[0545] In addition to NOI, vectors can also contain or encode siRNA, shRNA, or regulated shRNA (Dickins et al. (2005) Nature Genetics 37: 1289-1295; Silva et al. (2005) Nature Genetics 37: 1281-1288).

[0546] Posttranscriptional gene silencing (PTGS) mediated by double-stranded RNA (dsRNA) is a conserved cellular defense mechanism controlling the expression of exogenous genes. It is believed that random integration of elements, such as transposons or viruses, induces dsRNA expression, which activates sequence-specific degradation of homologous single-stranded mRNA or viral genomic RNA. This silencing effect is known as RNA interference (RNAi) (Ralph et al. (2005) Nature Medicine 11:429-433). The mechanism of RNAi involves processing long dsRNA into a double helix of RNA approximately 21-25 nucleotides (nt). These products, called small interfering RNAs or silencing RNAs (siRNAs), are sequence-specific mediators of mRNA degradation. In differentiated mammalian cells, dsRNAs >30 bp have been found to activate interferon responses, leading to the cessation of protein synthesis and nonspecific mRNA degradation (Stark et al., Annu Rev Biochem 67:227-64 (1998)). However, this response can be bypassed by using a 21nt siRNA double helix (Elbashir et al., EMBO J. Dec 3;20(23):6877-88 (2001); Hutvagner et al. Science. Aug 3, 293(5531):834-8. Eupub Jul 12 (2001)), thus allowing the analysis of gene function in cultured mammalian cells.

[0547] Pharmaceutical Composition

[0548] Pharmaceutical compositions are provided that comprise a viral vector as described herein or cells or tissues transduced with a viral vector as described herein, and a carrier, diluent, or excipient suitable for use with the pharmaceutical.

[0549] A pharmaceutical composition is provided for treating an individual with gene therapy, wherein the composition comprises a therapeutically effective amount of a viral vector. The pharmaceutical composition may be used in humans or animals.

[0550] The composition may contain a pharmaceutically available carrier, diluent, excipient, or adjuvant. The selection of the pharmaceutical carrier, excipient, or diluent may be based on the intended route of administration and standard pharmaceutical practice. The pharmaceutical composition may contain, or in addition to a carrier, excipient, or diluent, any suitable binder, lubricant, suspending agent, coating agent, solubilizer, and other carrier agents (such as, for example, lipid delivery systems) that may assist or enhance the carrier's entry into the target site.

[0551] Where appropriate, the composition may be administered by any one or more of the following methods: inhalation; suppository or vaginal suppository form; topical application as a lotion, solution, cream, ointment, or powder; by use of a skin patch; orally, in the form of tablets containing excipients (such as starch or lactose), or in the form of capsules or ovules alone or in combination with excipients, or in the form of elixirs, solutions, or suspensions containing flavorings or colorings; or they may be administered parenterally, for example, intracavernosal, intravenous, intramuscular, intracranial, intraocular, intraperitoneal, or subcutaneous injection. For parenterally administration, the composition is preferably used in the form of a sterile aqueous solution, which may contain other substances, such as sufficient salt or monosaccharides, to make the solution isotonic with blood. For oral or sublingual administration, the composition may be administered in the form of tablets or lozenges formulated by conventional methods.

[0552] The viral vectors described herein can also be used for in vitro transduction of target cells or tissues, followed by transfer of said target cells or tissues to patients in need. Examples of such cells may be autologous T cells, and examples of such tissues may be donor corneas.

[0553] Variants, derivatives, analogs, homologs and fragments

[0554] In addition to the specific proteins and nucleotides mentioned herein, this invention also covers the use of their variants, derivatives, pharmaceutically available salts, analogs, homologs, and fragments.

[0555] A variant of any given sequence is a sequence in which a particular sequence of residues (whether amino acid residues or nucleic acid residues) is modified in such a way that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. Variant sequences can be obtained by adding, deleting, substituting, modifying, replacing, and / or altering at least one residue present in a naturally occurring protein.

[0556] In contrast to proteins or peptides, the term “derivative” as used herein includes any substitution, alteration, modification, replacement, deletion, and / or addition of one (or more) amino acid residues of a sequence, provided that the resulting protein or peptide retains at least one of its intrinsic functions.

[0557] In contrast to polypeptides or polynucleotides, the term "analyte" as used herein includes any mimicry, i.e., a compound having at least one of the endogenous functions of the polypeptide or polynucleotide it mimics.

[0558] Typically, one, two, or three to ten or twenty substitutions can be made to replace amino acids, as long as the modified sequence retains the desired activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues.

[0559] The proteins used in this article can also have deletions, insertions, or substitutions of amino acid residues, which produce silencing changes and result in functionally equivalent proteins. Careful amino acid substitutions can be made based on the similarity of residue polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties, as long as the endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with similar hydrophilicity values ​​containing uncharged polar head groups include asparagine, glutamine, serine, threonine, and tyrosine.

[0560] For example, conservative substitutions can be made according to the table below. Amino acids in the same cell of the second column and, preferably, amino acids in the same row of the third column, can be substituted for each other:

[0561] The term "homology" refers to an entity that shares a specific homology with wild-type amino acid sequences and wild-type nucleotide sequences. The term "homology" can be equated with "identity".

[0562] In the context of this invention, homologous sequences include amino acid sequences that have at least 50%, 55%, 65%, 75%, 85%, or 90% identity with the subject sequence, preferably at least 95%, 97%, or 99%. Typically, homologs will include the same active sites as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of this invention, homology is preferably expressed in terms of sequence identity.

[0563] In the context of this invention, homologous sequences include nucleotide sequences that are at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the subject sequence, preferably at least 95%, 97%, 98%, or 99%. Although homology can also be considered in terms of similarity, in the context of this invention, homology is preferably expressed in terms of sequence identity.

[0564] Homology comparisons can be performed visually, or more commonly, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percentage of homology or identity between two or more sequences.

[0565] Homology percentages can be calculated for continuous sequences by aligning one sequence to another, directly comparing each amino acid in one sequence to the corresponding amino acid in the other, one residue at a time. This is called "ungapped" alignment. Typically, ungapped alignments are only performed on relatively short groups of residues.

[0566] While this is a very simple and consistent approach, it fails to consider, for example, that in an otherwise identical pair of sequences, an insertion or deletion in a nucleotide sequence could cause subsequent codon misalignment, potentially leading to a significantly reduced percentage of homology when performing a global alignment. Therefore, most sequence alignment methods are designed to produce optimal alignments that account for possible insertions and deletions without excessively deducting from the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to attempt to maximize local homology.

[0567] However, these more sophisticated methods assign a "vacancy penalty" to each vacancy that occurs during alignment, such that for the same number of identical amino acids, an alignment with the fewest possible vacancy and reflecting a higher correlation between the two compared sequences will receive a higher score than an alignment with multiple vacancyes. The "Affine vacancy penalty" is typically used to impose a relatively high penalty on the presence of a vacancy and a lower penalty on each subsequent residue within that vacancy. This is the most commonly used vacancy scoring system. Of course, a high vacancy penalty will naturally produce the best alignment with fewer vacancyes. Most alignment programs allow modification of the vacancy penalty. However, when using such software for sequence alignment, the default values ​​are preferred. For example, when using the GCG Wisconsin Bestfit package, the default vacancy penalty for amino acid sequences is -12 for one vacancy and -4 for each extension.

[0568] Therefore, calculating the maximum percentage of homology first requires considering the space penalty to produce the optimal alignment. A suitable computer program for performing this alignment is the GCG Wisconsin Bestfit software package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12:387). Examples of other software capable of sequence comparison include (but are not limited to) the BLAST software package (see Ausubel et al. (1999) ibid. – Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410), and the GNEWORKS comparison tool suite. Both BLAST and FASTA can be used for offline and online searches (see Ausubel et al. (1999) ibid., pp. 7-58 to 7-60). However, for some applications, the GCG Bestfit program is preferred. Another tool called BLAST 2 Sequences can also be used to compare protein and nucleotide sequences (see FEMS Microbiol Lett (1999) 174(2):247-50; FEMS Microbiol Lett (1999) 177(1):187-8).

[0569] Although the final percentage of homology can be measured in terms of identity, the alignment process itself is not typically based on all-or-nothing pairwise comparisons. Instead, a plotted similarity score matrix is ​​usually used, which assigns a score to each pairwise comparison based on chemical similarity or evolutionary distance. A commonly used example of such a matrix is ​​the BLOSUM62 matrix—the default matrix in the BLAST program suite. The GCG Wisconsin program typically uses common defaults or a custom symbol comparison table (if provided) (see the user manual for further details). For some applications, it is preferred to use the common defaults of the GCG package, or, in the case of other software, a default matrix such as BLOSUM62.

[0570] Once the software produces an optimal alignment, it can calculate the percentage of homology, preferably the percentage of sequence identity. The software typically performs this as part of the sequence comparison and produces numerical results.

[0571] "Fragment" is also a variant, and the term generally refers to a selected region of a polypeptide or polynucleotide of interest in its function or, for example, in a assay. Therefore, "fragment" refers to an amino acid or nucleic acid sequence that is part of a full-length polypeptide or polynucleotide.

[0572] These variants can be prepared using standard recombinant DNA techniques, such as site-directed mutagenesis. In cases where an insertion is to be performed, synthetic DNA can be prepared encoding the insertion and 5' and 3' flanking regions corresponding to the naturally occurring sequence on either side of the insertion site. These flanking regions will contain appropriate restriction sites corresponding to the sites in the naturally occurring sequence, allowing the sequence to be cleaved with a suitable enzyme, and the synthetic DNA can be ligated into the cleavage. The DNA is then expressed according to the invention to prepare the encoded protein. These methods are merely illustrative of the various standard techniques known in the art for manipulating DNA sequences, and other known techniques may also be used.

[0573] All variants, fragments, or homologs of the regulatory proteins suitable for use in the cells and / or modular constructs of this invention will retain the ability to bind to the homologous binding site of NOI, thereby inhibiting or preventing the translation of NOI in viral vector production cells.

[0574] All variants, fragments, or homologs of the binding site will retain the ability to bind homologous RNA-binding proteins, thereby inhibiting or preventing NOI translation in viral vector-producing cells.

[0575] Codon optimization

[0576] The polynucleotides used in this paper (including the NOI and / or components of the vector production system) can be codon-optimized. Codon optimization has been previously described in WO 1999 / 41397 and WO 2001 / 79518. Different cells differ in their specific codon usage. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in a cell type. By altering the codons in the sequence, thereby adjusting them to match the relative abundance of the corresponding tRNA, it is possible to increase expression. For the same reason, it is possible to decrease expression by intentionally selecting codons for the corresponding tRNA that are known to be rare in a particular cell type. Therefore, other degrees of translational control are available.

[0577] Many viruses, including retroviruses, use a large number of rare codons and alter these codons to correspond to commonly used mammalian codons to enhance the expression of genes of interest in mammalian production cells, such as NOI or packaging components. Codon usage tables are known in the art for mammalian cells as well as for many other organisms.

[0578] Codon optimization of viral vector components offers several other advantages. Through changes to their sequences, the nucleotide sequences encoding the packaging components of the viral particles required for assembly in production / packaging cells, in addition to these sequences, possess RNA-instability instability (INS) sequences. Simultaneously, the amino acid sequence encoding the packaging components is preserved, ensuring that the viral components encoded by these sequences remain identical, or at least sufficiently similar, so that the packaging component function is not impaired. In lentiviral vectors, codon optimization also overcomes the Rev / RRE requirement, making the optimized sequence Rev-independent. Codon optimization also reduces the inter-construction (e.g., ) between different constructs within the vector system. gag-pol and env Homologous recombination (between overlapping regions in the open reading frame). Therefore, the overall impact of codon optimization is a significant increase in viral titer and an improvement in security.

[0579] In one implementation, only the codons related to INS are codon-optimized. However, in a more preferred and practical implementation, codon optimization is performed on the entire sequence, though there are exceptions, such as those containing... gag-pol The sequence of the frameshift sites (see below).

[0580] Lentiviral vectors gag-pol Genes contain coding gag-pol Two overlapping reading frames of the protein. Expression of both proteins is based on frameshifts during translation. This frameshift is caused by ribosome "slip" during translation. This slip is thought to be at least partially caused by RNA secondary structures terminated by the ribosome. These secondary structures are present in... gag-pol Downstream of the frameshift site in the gene. For HIV, the overlapping region extends from... gag Initiator (where nucleotide 1 is) gag The downstream nucleotide 1222 of ATG (A) extends to gag The end (nt 1503). Therefore, the 281bp fragment covering the frameshift site and overlap region of both reading frames is preferably not codon-optimized. Retaining this fragment will enable more efficient expression of the Gag-Pol protein. For EIAV, the overlap initiation is located at nt 1262 (where nucleotide 1 is the end of the frameshift site and overlap region). gag The A in ATG) and the overlapping end is located at nt 1461. This is to ensure that the frameshift site and... gag-pol The overlap has preserved the wild-type sequence from nt 1156 to 1465.

[0581] Derivation can be performed based on optimal codon usage, for example, to accommodate suitable restriction sites, and conserved amino acid changes can be introduced into Gag-Pol proteins.

[0582] In one instance, codon optimization is based on lightly expressed mammalian genes. The third, and sometimes the second and third, bases can be altered.

[0583] Due to the degeneracy of the genetic code, skilled workers will be able to achieve a variety of [benefits / achievements]. gag-pol Sequence. Furthermore, the various retroviral variants described can be used to generate codon-optimized sequences. gag-pol The starting point of the sequence. Lentiviral genomes can be quite variable. For example, there are multiple still-functional quasi-species of HIV-1. The same is true for EIAV. These variants can be used to enhance specific parts of the transduction process. Examples of HIV-1 variants can be found at http: / / hiv-web.lanl.gov, the HIV database run by Los Alamos National Laboratory LLC. Detailed information on EIAV clones can be found in the National Center for Biotechnology Information (NCBI) database at http: / / www.ncbi.nlm.nih.gov.

[0584] gag-pol The codon optimization strategy for the sequence can be used in conjunction with any retrovirus. This will be applicable to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1, and HIV-2. Additionally, this method can be used to enhance gene expression in HTLV-1, HTLV-2, HFV, HSRV, and human endogenous retroviruses (HERV), MLV, and other retroviruses.

[0585] Codon optimization can gag-pol The expression is independent of Rev. To make it resistant rev While RRE factors may be usable in lentiviral vectors, it will be necessary to make the viral vector production system completely independent of Rev / RRE. Therefore, the genome also needs to be modified. This is achieved by optimizing the vector genome components. Advantageously, these modifications also lead to the development of a safer system lacking all other proteins in both production cells and transduction cells.

[0586] The patent publications discussed herein are provided only for those published prior to the filing date of this invention application. Nothing herein should be construed as an admission that these publications constitute prior art to the claims appended herein.

[0587] The invention will now be further described by way of example, which is intended to assist those skilled in the art in carrying out the invention and is not intended to limit the scope of the invention in any way.

[0588] Readers should take note of all documents submitted concurrently with or prior to this specification in connection with this application of the invention, and these documents are open to public examination of this specification, the contents of which are incorporated herein by reference.

[0589] All features disclosed in this specification (including any appended claims, abstract, and drawings) and / or all steps of any method or process disclosed thereby may be combined in any combination except for at least some mutually exclusive combinations of such features and / or steps.

[0590] Unless otherwise expressly stated, each feature disclosed in this specification (including any appended claims, abstract, and drawings) may be replaced by alternative features that serve the same, equivalent, or similar purpose. Therefore, unless otherwise expressly stated, each disclosed feature is merely one example of a general series of equivalent or similar features.

[0591] This invention is not limited to the details of any of the above embodiments. The invention extends to any novel feature or combination of novel features disclosed in this specification (including any appended claims, abstract, and drawings), or to any novel step or combination of novel steps in any method or process disclosed herein.

[0592] This invention is not limited to the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein may be used to practice or test embodiments of the invention disclosed herein. Numerical ranges include values ​​within defined ranges. Unless otherwise stated, any nucleic acid sequence is written from left to right in 5' to 3' orientation; amino acid sequences are written from left to right in amino to carboxyl orientation.

[0593] When a numerical range is provided, unless the context explicitly specifies otherwise, it should be understood that each intermediate value (accurate to one-tenth of the lower limit unit) between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any declared or intermediate values ​​within the declared range, and any other declared or intermediate value within the declared range, is covered within this invention. The upper and lower limits of these smaller ranges may be independently included in or excluded from the range, and each range that includes, excludes, or includes either of the two limiting values ​​is also covered within this disclosure, depending on the limiting value explicitly excluded from the declared range. When a declared range includes one or both of the limiting values, ranges that exclude either or both of those limiting values ​​are also included within this disclosure.

[0594] It must be noted that, as used herein and in the appended claims, the singular forms “a” and “said” include a plurality of objects unless the context clearly specifies otherwise.

[0595] As used herein, the terms “including,” “comprising,” and “including” are synonymous with “containing,” “comprising,” or “containing,” and are inclusive or open-ended, and do not exclude other members, elements, or method steps not listed. The terms “including,” “comprising,” and “including” also include the term “consisting of.”

[0596] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd Edition, John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, HarperPerennial, NY (1991) provide comprehensive dictionaries for those skilled in the art of the various terms used in this invention. Although any methods and materials similar to or equivalent to those described herein are used in the practice of this invention, preferred methods and materials are described herein. Therefore, the following terms, defined immediately, are described more fully by reference to this specification as a whole.

[0597] The aspects of the invention are illustrated by the following non-limiting examples.

[0598] Example

[0599] Example 1: Preliminary evaluation of small molecule inducers for improving carrier production in HEK293T

[0600] The inventors conducted a preliminary study on the use of alternative small molecule inducers to increase vector titers in transiently transfected adherent HEK293T cells. The standard procedure in the transient process was to induce vector production 24 h after transfection with 10 mM sodium butyrate and an aliphatic HDAC inhibitor. Preliminary high-throughput molecular screening was used to identify the effects of using alternative HDAC inhibitors (sodium valproate, valerate, SAHA, and TSA), HAT inhibitors (tannic acid), cell differentiation agents (HMBA), PKC agonists (prostratin and PMA), and antioxidants (N-acetylcysteine) on titers.

[0601] Materials and methods

[0602] Adherent cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0603] HEK293T cells were maintained at 37°C and 5% CO2 in complete medium (Dalberg modified Eagle medium (Sigma) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco), 2 mM L-glutamine (Sigma), and 1% non-essential amino acids (NEAA) (Sigma).

[0604] HIV CMV-GFP vector was produced on a 12-well plate scale under the following conditions: HEK293T cells were seeded into complete culture medium and transfected with Genome, Gag-Pol, Rev, and VSV-G approximately 24 hours later. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in OptiPRO, according to the manufacturer's (Life Technologies) protocol.

[0605] An automated liquid processor was used to prepare 1 mL of induction mixture by diluting the stock solution in complete culture medium to the final concentration listed in Table 1. Cells were induced approximately 24 hours post-transfection by discarding the culture medium and replacing it with 0.8 mL of induction mixture. The vector supernatant was harvested after 24 hours and filtered using a MultiScreen-GV 0.22 μm 96-well plate (Millipore).

[0606]

[0607] Table 1. Concentration of test inducer added to 12-well plates

[0608] Lentiviral vector titration assay

[0609] HEK293T cells were seeded into complete medium using a lentiviral vector titrated with a GFP marker. Transduction wells were filled approximately 24 hours after seeding with 270 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then overflowed with 530 μL of complete medium between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using a TrypLE and resuspended in complete medium for flow cytometry. Live / Singlet / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP. +Cell percentage, 1×10 during transduction 5 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0610]

[0611] result

[0612] These results indicate that several tested HDAC inhibitors are inducible in HEK293T, with optimal carrier production observed at concentrations of 5 mM sodium butyrate, 10 mM sodium valproate, 20 mM valerate, and 2.5 μM SAHA. Figure 2 TSA failed to improve vector titers in HEK293T cells at levels greater than 20 mM sodium butyrate. The antioxidant NAC itself had no positive effect on titers; basal vector production remained the same as the uninduced control in the presence of 1–4 mM NAC. Tannins had a significantly adverse effect on vector production, resulting in measurable vector production. Transcription activators, as individual compounds, showed vector-inducing potential, eliciting the highest vector induction via the PKC activators PMA and propranin. Randomized combination screening ( Figure 3 The results showed that the highest titers were achieved when HDAC inhibitors were combined with transcription activators, which is consistent with reports of increased viral production when HDAC inhibitors were combined with latency reversal agents in latent HIV therapy (Reuse et al., 2009).

[0613] discuss

[0614] The inventors have demonstrated that the combined use of HDAC inhibitors and PKC activators stimulates the maximum increase in carrier titer.

[0615] Example 2: Evaluation of small molecule inducers used to improve the production of the carrier in HEK293T

[0616] The inventors further investigated the use of alternative small molecule inducers to increase vector titers in transiently transfected HEK293T cells. The standard procedure in the transient process involved inducing vector production 24 hours after transfection with 10 mM sodium butyrate, an aliphatic HDAC inhibitor. A high-throughput screening method was reported to investigate the use of two alternative aliphatic compounds (sodium valproate and valerate) and an oxime compound (SAHA) as HDAC inhibitors. Furthermore, the inventors investigated the effects of combining HDAC inhibitors with transcription activators HMBA (a cell differentiation agent) and prostratin and PMA (PKC agonists) to increase titers.

[0617] Materials and methods

[0618] Experiment 1

[0619] Adherent cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0620] HEK293T cells were maintained at 37°C and 5% CO2 in complete medium (Dalberg modified Eagle medium (Sigma) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco), 2 mM L-glutamine (Sigma), and 1% non-essential amino acids (NEAA) (Sigma).

[0621] HIV CMV-GFP vector was produced on a 12-well plate scale under the following conditions: HEK293T cells were seeded into 1 mL of complete culture medium, and after approximately 24 hours, the cells were transfected with Genome, Gag-Pol, Rev, and VSV-G. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in OptiPRO, according to the manufacturer's (Life Technologies) protocol.

[0622] An automated liquid processor was used to prepare 1.2 mL of induction mixture by diluting the stock solution in complete culture medium to the final concentration listed in Table 2. Cells were induced approximately 24 hours post-transfection by discarding the culture medium and replacing it with 1 mL of induction mixture. The vector supernatant was harvested approximately 24 hours later and filtered using a MultiScreen-GV 0.22 μm 96-well plate (Millipore).

[0623]

[0624] Table 2. Concentration of test inducer added to 12-well plates

[0625] Lentiviral vector titration assay

[0626] HEK293T cells were seeded into complete medium using a lentiviral vector titrated with a GFP marker. Transduction wells were filled approximately 24 hours after seeding with 265 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then overflowed with 530 μL of complete medium between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using TrypLE (Gibco) and resuspended in complete medium for flow cytometry. Live / Singlet / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP.+ Cell percentage, 8.46 × 10⁻⁶ during transduction 4 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0627]

[0628] Experiment 2

[0629] Adherent cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0630] HEK293T cells were maintained at 37°C and 5% CO2 in complete medium (Dalberg modified Eagle medium (Sigma) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco), 2 mM L-glutamine (Sigma), and 1% non-essential amino acids (NEAA) (Sigma).

[0631] HIV CMV-GFP vector was produced on a 12-well plate scale under the following conditions: HEK293T cells were seeded into 1 mL of complete culture medium, and after approximately 24 hours, the cells were transfected with Genome, Gag-Pol, Rev, and VSV-G. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in OptiPRO, according to the manufacturer's (Life Technologies) protocol.

[0632] JMP was used to generate 3×3×2 all-factor DOEs for screening sodium butyrate, prostratin, and HMBA, and 2×2×2 all-factor DOEs for screening alternative HDAC inhibitors, prostratin, and HMBA. An automated liquid processor was used to prepare 1.2 mL induction mixtures by diluting the stock solution in complete culture medium to the final concentrations listed in Table 3. Cells were induced approximately 24 hours post-transfection by discarding the culture medium and replacing it with 1 mL of induction mixture. The vector supernatant was harvested after 24 hours and filtered using a MultiScreen-GV 0.22 μm 96-well plate (Millipore).

[0633]

[0634] Table 3. Concentration of test inducer added to 12-well plates

[0635] Lentiviral vector titration assay

[0636] HEK293T cells were seeded into complete medium using a lentiviral vector titrated with a GFP marker. Transduction wells were filled approximately 24 hours after seeding with 265 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then overflowed with 530 μL of complete medium between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using TrypLE (Gibco) and resuspended in complete medium for flow cytometry. Live / Singlet / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP. + Cell percentage, 7.98 × 10⁻⁶ during transduction 4 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0637]

[0638] result

[0639] Experiment 1

[0640] Results (see) Figure 4 The values ​​indicate that the tested HDAC inhibitors had similar inducing effects, with the optimal concentrations being 10 mM sodium valproate, 10 mM valerate, and 1 μM SAHA. Transcription activators all showed excellent inducing effects on cells, with optimal concentrations of 16 mM HMBA, 16 μM prostratin, and 32 nM PMA producing titers approximately 4-fold higher than the uninduced control. Notably, the combination of HDAC inhibitors with the tested PKC agonists (prostratin and PMA) induced the largest increases in vector titers, both inducing similar increases between 1.6 and 2.0-fold higher than the corresponding HDAC concentrations. In contrast to prostratin, the combination of HMBA with an HDAC inhibitor showed no or only a slight improvement in titers compared to those induced by equivalent concentrations of the HDAC inhibitor alone.

[0641] No changes in MFI were observed in GFP FACS within the concentration range of 0.5 to 8 μM prostratin. However, at 16 μM prostratin, MFI increased by 26%, indicating that a residual concentration of 0.4 μM prostratin was sufficient to affect transgene synthesis in transduced cells after vector dilution (40-fold).

[0642] Experiment 2

[0643] Experiment 2 aimed to investigate whether HMBA, in combination with HDAC inhibitors and prostratin, had any positive effect on titer. To study the interaction between different concentrations of sodium butyrate, prostratin, and HMBA, a 3×3×2 total factorial DOE (DOE) study was conducted. Figure 5 The presence of prostratin in combination with 10 mM sodium butyrate showed excellent improvement in carrier production, with a 92% increase in titer at the 10 μM prostratin concentration. Predictive analyzers indicated that the presence of higher concentrations of prostratin provided a higher expected score compared to 1 or 5 μM prostratin. Figure 5 (B). Although it showed an inducing effect on its own in Experiment 1, the titer showed a significant decrease in the presence of 8 mM HMBA in combination with prostratin and sodium butyrate compared to the condition in which HMBA was not present.

[0644] Similarly, HMBA showed an adverse effect on titers when combined with alternative HDAC inhibitors: sodium valproate, valerate, and SAHA, indicating that HMBA as an additive does not provide any enhancing benefit compared to HDAC inhibitors and prostratin. Nevertheless, positive induction enhancement of prostratin from 1 to 10 μM was common among all tested HDAC inhibitors, supporting the effectiveness of PKC agonists as potential enhancers of carrier-induced titers. Figure 6 ).

[0645] discuss

[0646] These experiments concluded that the combined use of HDAC inhibitors and PKC activators resulted in carrier titers that were 1.6 to 2.0 times higher than those expected when induced by the corresponding HDAC inhibitor alone. Consistent with their structural and functional similarities, PMA showed a similar enhancing effect to prostratin. However, due to its non-tumorigenic properties, the use of prostratin (or other similar analogues) can be more favorable for inducing drug carrier production compared to PMA. It should be noted that HMBA does not have any positive effect on titer when combined with other small molecule inducers.

[0647] Example 3: Evaluation of small molecule inducers for improving carrier production in HEK1.65S

[0648] The inventors investigated the use of alternative small molecule inducers to increase vector titers in transiently transfected suspension-adapted HEK293T (HEK1.65s) cells. The standard procedure in the transient process involved inducing vector production 24 h after transfection with 10 mM sodium butyrate, an aliphatic HDAC inhibitor. A high-throughput screening method was reported to investigate the use of two aliphatic compounds (sodium valproate and valerate) and oxamyl acid (SAHA) as alternative HDAC inhibitors. Furthermore, the inventors investigated the effects of combining these HDAC inhibitors with the non-tumor-promoting PKC activator prostratin to increase GFP-HIV vector titers.

[0649] Materials and methods

[0650] Experiment 1

[0651] Suspension cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0652] HEK1.65s cells were grown in serum-free freestyle (FS) medium with 0.1% cholesterol lipid concentrate (CLC) (Gibco) at 37°C in a shaking incubator with 5% CO2.

[0653] HIV CMV-GFP vector was produced in 24-well low-attachment plates under the following conditions: HEK1.65s cells were seeded in 1 mL of serum-free medium and transfected with Genome, Gag-Pol, Rev, and VSV-G approximately 24 hours later. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in serum-free medium, according to the manufacturer's (Life Technologies) protocol. During vector production, cells were cultured in a shaking incubator at 37°C and 5% CO2.

[0654] For each HDACi, JMP was used to prepare 2×2 full-factor conditioned matrices, with each condition having 2× center points and 2× replicates. An automated liquid processor was used to prepare 96-well plates with 250 μL of 12× concentrated induction mixture. 100 μL of 12× concentrated induction mixture was pipetted into the corresponding well of each 24-well plate to provide the final concentrations listed in Table 4. The carrier supernatant was harvested after 2 days and filtered using a MultiScreen-GV 0.22 μM 96-well filter plate (Millipore).

[0655]

[0656] Table 4. Final concentrations of the inducing reagents tested when added to 24-well plates.

[0657] Lentiviral vector titration assay

[0658] HEK293T cells were seeded into complete medium using a lentiviral vector titrated with a GFP marker. Transduction wells were filled approximately 24 hours after seeding with 160 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then overflowed with 320 μL of complete medium between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using TrypLE (Gibco) and resuspended in complete medium for flow cytometry. Live / Singlet / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP. + Cell percentage, 6.7 × 10⁻⁶ during transduction 4 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0659]

[0660] Experiment 2

[0661] Suspension cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0662] HEK1.65s cells were grown in serum-free freestyle (FS) medium with 0.1% cholesterol lipid concentrate (CLC) (Gibco) at 37°C in a shaking incubator with 5% CO2.

[0663] HIV CMV-GFP vector was produced in 24-well low-attachment plates under the following conditions: HEK1.65s cells were seeded in 1 mL of serum-free medium and transfected with Genome, Gag-Pol, Rev, and VSV-G approximately 24 hours later. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in serum-free medium, according to the manufacturer's (Life Technologies) protocol. During vector production, cells were cultured in a shaking incubator at 37°C and 5% CO2.

[0664] JMP was used to prepare 4×5 full-factor condition matrices, with each condition having 2× center points and 2× replicates. An automated liquid processor was used to prepare 96-well plates with 250 μL of 12× concentrated induction mixture. 100 μL of 12× concentrated induction mixture was pipetted into the corresponding well of each 24-well plate to provide the final concentrations listed in Table 5. The carrier supernatant was harvested after 2 days and filtered using a MultiScreen-GV 0.22 μM 96-well filter plate (Millipore).

[0665]

[0666] Table 5. Final concentrations of the inducing reagents tested when added to 24-well plates.

[0667] Lentiviral vector titration assay

[0668] HEK293T cells were seeded into complete medium using a lentiviral vector titrated with a GFP marker. Transduction wells were filled approximately 24 hours after seeding with 270 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then filled with 540 μL of complete medium between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using TrypLE (Gibco) and resuspended in complete medium for flow cytometry. Live / Singlet / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP. + Cell percentage, 1.18 × 10⁻⁶ during transduction 5 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0669]

[0670] result

[0671] Experiment 1

[0672] Among the different HDACi assays performed on HEK1.65s cells, sodium butyrate induced the highest LV titer ( Figure 7Surprisingly, SAHA showed the lowest induction effect and yielded the lowest LV titer, although the data above indicated that SAHA stimulated LV yields comparable to sodium butyrate in transiently transfected HEK293T cells. In almost all cases, the addition of prostratin and HDACi led to increased titers, thus supporting the anticipated use of PKC agonists as inducers in HEK1.65s. Considering the results of Experiment 1, Experiment 2 was performed to establish a more detailed model of the combined effects of the best-performing HDAC inhibitor (sodium butyrate) and prostratin to determine the optimal concentrations of each inducer.

[0673] Experiment 2

[0674] The results of Experiment 2 showed that in transiently transfected HEK1.65s suspension cells, prostratin, in combination with sodium butyrate, had a significant positive effect on titer. Figure 8 Based on the data presented in this paper, prostratin concentrations as low as 2–4 μM were observed to induce titer increases, with further increases observed at concentrations of 8–16 μM. Interestingly, these data also support previous findings: prostratin alone promotes carrier titer increases, in this case, at concentrations between 8–16 μM, resulting in a ~13-fold increase compared to the uninduced control, and showing approximately half the inducing effect of the optimal sodium butyrate concentration.

[0675] The obtained titers were returned to the JMP DOE software to generate a model of the interaction between sodium butyrate and prostratin on LV titers. Figure 9 "Actual Values ​​vs. Predicted Values" chart ( Figure 9 B) shows a strong fit between the DOE model and the variations in the collected data due to random effects. Sodium butyrate (11.5), prostratin (8.8), sodium butyrate Sodium butyrate (4.9) and prostratin The log values ​​(Worth values) of prostratin (4.9) were all greater than 2, indicating that the significance of each effect greatly exceeded the p-value threshold of 0.01. Predictive analyzer ( Figure 9 C) shows that the optimal predicted concentrations of the combined inducers are 8 mM sodium butyrate and 11 μM prostratin. Under these optimal conditions, the LV titer increases by 1.93-fold at concentrations greater than the optimal concentration of sodium butyrate alone (8 mM).

[0676] Cell viability measurements showed that, compared to the 4% loss observed in sodium butyrate-treated cells (Table 6), prostratin-treated cells did not exhibit any further loss of cell viability in the 2–32 μM concentration range. These results indicate that prostratin has very low cytotoxicity to cells during the 48-hour vector production cycle.

[0677]

[0678] Table 6. Measurement of cell viability

[0679] discuss

[0680] The results showed that prostratin was an effective enhancer of LV titers in transiently transfected HEK1.65s. Induction of transfected cells with 8–16 μM prostratin alone resulted in a >10-fold increase in vector titers compared to the uninduced control. Furthermore, at the optimal concentrations established in this DOE model, 11 μM prostratin and 8 mM sodium butyrate increased LV titers by nearly 2-fold compared to induction with optimal sodium butyrate conditions. Apart from its inductive effect, no decrease in cell viability due to prostratin exposure was observed. Although some induction was observed with alternative aliphatic HDAC inhibitors (3 mM sodium valproate and 10 mM valerate), the oxime HDAC inhibitor SAHA showed the weakest induction, and none of the alternative HDAC inhibitors could increase titers above those of sodium butyrate at the concentrations tested in this experiment. This confirms that prostratin, either alone or in combination with sodium butyrate, is a candidate small molecule for induction in standard transient vector production methods.

[0681] Example 4: Prostratin as a carrier-induced small molecule enhancer: a study in a 40 ml shake flask

[0682] Prostratin is a small-molecule, non-tumor-promoting regulator of protein kinase C (PKC), which has been shown to have promising therapeutic properties for the treatment of cancer (Alotaibi et al., 2018) and Alzheimer's disease (Hongpaisan & Alkon, 2007). In Example 3, the inventors demonstrated that, in a transient LV production method using HEK1.65s at a 24-well plate scale, prostratin combined with an HDAC inhibitor was effective in increasing GFP-HIV LV titers by ≥2-fold. The inventors performed the following scale-up experiments to determine whether the prostratin-enhanced HEK cell production capacity could be converted to a shake flask volume (40 mL).

[0683] Materials and methods

[0684] Suspension cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0685] HEK1.65s cells were grown in serum-free freestyle (FS) medium with 0.1% cholesterol lipid concentrate (CLC) (Gibco) at 37°C in a shaking incubator with 5% CO2.

[0686] HIV CMV-GFP vectors were produced in six 125 mL Erlenmeyer shake flasks under the following conditions: HEK1.65s cells were seeded in 40 mL serum-free medium and transfected with Genome, Gag-Pol, Rev, and VSV-G approximately 24 hours later. Transfection was mediated by mixing DNA with Lipofectamine 2000 CD in serum-free medium, according to the manufacturer's (Life Technologies) protocol. Cells were cultured in a shaking incubator at 37°C and 5% CO2 throughout the vector production process.

[0687] The carrier production in shake flasks 1-6 was induced using sodium butyrate at a final concentration of 8 mM. Simultaneously with sodium butyrate induction, DMSO was added to flasks 3 & 4 to provide a final concentration of 0.2% (v / v) DMSO, and prostratin (dissolved in DMSO) was added to flasks 5 & 6 to provide a final concentration of 11 μM prostratin and 0.2% (v / v) DMSO (Table 7). The carrier supernatant was harvested approximately 24 hours after induction and filtered through a 0.45 μm filter.

[0688]

[0689] Table 7. Inducing compositions for shake flasks

[0690] Lentiviral vector titration assay

[0691] For FACS-titrated lentiviral vectors, HEK293T cells were seeded into complete medium. Transduction wells were filled approximately 24 hours after seeding with 157 μL of vector diluted in complete medium + 8 μg / mL polybrene, and then 314 μL of complete medium was used to fill the wells between 3 and 6 hours post-transduction. Transduced cells were cultured at 37°C for 3 days at 5% CO2. Cells were isolated using TrypLE (Gibco) and resuspended in complete medium for flow cytometry. Live / Single / GFP was used. + Set a gate to measure the percentage of GFP expression. Use the following equation based on GFP. + Cell percentage, 4.4 × 10⁻⁶ during transduction4 The titer was calculated based on cell count, vector dilution factor, and vector volume during transduction.

[0692]

[0693] For lentiviral vector titration as determined by double-strand qPCR integration, HEK293T cells were seeded into complete culture medium. Transduction wells were filled approximately 24 hours after seeding with 500 μL of vector diluted in complete culture medium + 8 μg / mL polybrene, and the wells were filled with 1 mL of complete culture medium between 3 and 6 hours post-transduction. The culture was prepared from 1×10⁻⁶ cells / mL. 6 Cultures were passaged for 10 days before host DNA extraction from individual cell particles. Double-strand quantitative PCR was performed on HIV packaging signal (ψ) and RRPH1 using the FAM primer / probe set, and vector titers (TU / mL) were calculated using the following factors: transduction volume, vector dilution, and RRPH1-normalized HIV-1 ψ copies detected per reaction.

[0694] Results and Discussion

[0695] Successful transformation to shake-flask scale under DOE-optimized induction conditions (8 mM sodium butyrate + 11 μM prostratin: Example 3) demonstrated an increase in HIV-GFP titer. In the presence of prostratin, the vector titer was 2.4 to 2.9 times higher than that achieved by inducing HEK1.65s cells with sodium butyrate alone. Figure 10 (A & B). The identical titers reported for VRC and VRC+55nM prostratin confirm that the titers determined by the integration assay are unaffected by the residual concentration of prostratin retained after carrier dilution. Figure 10 B).

[0696] Example 5: An exemplary modified U1 snRNA expression construct that can be co-expressed during SIN-lentiviral vector production in the context of this invention.

[0697] The inventors have previously shown that U1 snRNA can be modified and co-expressed with a lentiviral vector (LV), resulting in enhanced production titers. Figure 11An example of a modified U1 snRNA molecule is shown. Briefly, the annealing sequence (nucleotides 1-11) of the natural splice-donor site can be replaced with a sequence complementary to the “target” sequence within the 5' region of the lentiviral vector RNA (vRNA)—typically within the core packaging region—and expressed simultaneously with the vRNA and other vector components, resulting in an increased vector titer. Not wishing to be bound by theory, it is assumed that the modified U1 snRNA binds to the nuclear vRNA and ultimately stabilizes / enhances the steady-state mixing pool of vRNA available for packaging into viral particles. The inventors have previously shown that the major splice donor (MSD) region embedded within the packaging signal of the lentiviral vector genomic vRNA can be highly heterogeneous, splicing to strong or occult splice acceptors within the transgenic sequence (even in the presence of revs), resulting in a reduced amount of full-length vRNA available for packaging (see [link to previous work]). Figure 1 This aberrant splicing activity is eliminated through functional mutations or deletions of the MSD, and the cryptic splicing donor encodes a small number of downstream nucleotides (see [link to original text]). Figure 14 (A). Such modifications to LV lead to a decrease in production titer; however, by providing modified U1 snRNA during LV production while maintaining blockade against aberrant splicing, the titer was enhanced / restored (see A). Figure 13 and 14 ).

[0698] The inventors wish to evaluate whether the use of Prostratin in the production of MSD-mutant LV can lead to an enhanced yield titer, and whether Prostratin and modified U1 snRNA can be used together.

[0699] Suspension cell culture, transfection, and production of third-generation SIN-lentiviral vectors

[0700] HEK293T.1-65s suspension cells were grown in Freestyle + 0.1% CLC (Gibco) at 37°C, 5% CO2, in a shaking incubator (set to 190 RPM, 22 mm orbital). HEK293T cells were cultured at 8 × 10⁻⁶ cells / year. 5 Cells were seeded per ml in serum-free medium and cultured with shaking at 37°C and 5% CO2 during vector production. Approximately 24 hours post-seedling, at transfection, cells were transfected using the following plasmids per unit effective final volume of culture at the following mass ratios: Genome, Gag-Pol, Rev, VSV-G, and 0.01 to 0.2 μg / mL of modified U1 snRNA plasmid (when used).

[0701] Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM, according to the manufacturer's (Life Technologies) protocol. After 18 hours, sodium butyrate (Sigma) was added to a final concentration of 10 mM, and optionally, prostratin was added together with sodium butyrate to a final concentration of 11 μM. Typically, the vector supernatant was harvested after 20–24 hours, filtered (0.22 μm), and frozen at -20 / -80°C. As a positive control for nuclease treatment, Benzonase® was typically added to the harvest at 5...

Claims

1. A method for producing a viral vector, the method comprising culturing cells containing a nucleic acid sequence encoding a component of a viral vector in a cell culture medium containing a PKC activator.

2. The method according to claim 1, wherein the viral vector is a self-inactivating viral vector.

3. The method according to any one of the preceding claims, wherein the PKC activator is prostratin or phorbol 12-myristate 13-acetate, its analogues, derivatives or a salt of a pharmaceutically available drug.

4. The method according to claim 3, wherein: a) Prostratin is present in cell culture medium at a concentration of at least about 0.5 μM, optionally wherein prostratin is present at a concentration of about 0.5 to about 32 μM; or b) Phlorizol 12-myristate 13-acetate is in a cell culture medium at a concentration of at least about 1 nM, optionally wherein phorbolol 12-myristate 13-acetate is in a concentration of about 1 to about 32 nM.

5. The method according to any one of the preceding claims, wherein the viral vector is a lentiviral vector and the modified U1 snRNA is co-expressed with the lentiviral vector component, wherein the modified U1 snRNA binds to a nucleotide sequence within the packaging region of the lentiviral vector genome sequence.

6. The method according to any one of the preceding claims, wherein the viral vector is a lentiviral vector and wherein splicing activity from the major splice donor region of the lentiviral vector genome has been functionally eliminated.

7. The method according to any one of the preceding claims, wherein the viral vector is a lentiviral vector, wherein the lentiviral vector genome has been mutated in the major splice donor region or in the major splice donor region and at least one cryptic splice donor region.

8. The method according to any one of the preceding claims, wherein the cell culture medium further comprises an HDAC inhibitor.

9. The method according to claim 8, wherein the HDAC inhibitor is an aliphatic HDAC inhibitor or an oxime HDAC inhibitor.

10. The method of claim 9, wherein the aliphatic HDAC inhibitor is sodium butyrate, sodium valproate, or valerate, or a salt thereof, analogue, derivative, or pharmaceutically available.