Application of LncRNA EBLN3P in diagnosis and treatment of rheumatoid arthritis

By detecting and regulating LncRNA EBLN3P, we have solved the diagnostic and treatment challenges of rheumatoid arthritis, provided new RA detection markers and therapeutic targets, significantly improved the auxiliary diagnosis and molecular targeted therapy effects of RA, and enhanced the proliferation, migration and angiogenesis capabilities of RA-FLS.

CN122012697APending Publication Date: 2026-05-12FIRST AFFILIATED HOSPITAL OF ANHUI UNIV OF CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FIRST AFFILIATED HOSPITAL OF ANHUI UNIV OF CHINESE MEDICINE
Filing Date
2026-02-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Current technologies are insufficient for the effective diagnosis and treatment of rheumatoid arthritis, especially joint damage caused by angiogenesis and synovial pannus formation, as there is a lack of effective molecular markers and therapeutic targets.

Method used

Using LncRNA EBLN3P as a novel biomarker for RA, we designed specific small interfering RNA to interfere with its expression by detecting its expression level in peripheral blood mononuclear cells, thereby regulating miR-369-5p function, activating the JAK/STAT signaling pathway, and inhibiting synovial angiogenesis in RA.

Benefits of technology

It provides new markers for RA detection and therapeutic targets, significantly improving the auxiliary diagnosis and molecular targeted therapy of RA, enhancing the proliferation, migration and angiogenesis capabilities of RA-FLS, and providing entirely new molecular information and biological basis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012697A_ABST
    Figure CN122012697A_ABST
Patent Text Reader

Abstract

The invention provides application of LncRNA EBLN3P in diagnosis and treatment of rheumatoid arthritis, and belongs to the field of rheumatism immune molecular biology. The LncRNA EBLN3P can promote proliferation and migration of rheumatoid arthritis fibroblast-like synovial cells and secretion of angiogenesis factors, so that the LncRNA EBLN3P is applied to diagnosis of rheumatoid arthritis and preparation of a therapeutic agent. Meanwhile, the LncRNA EBLN3P can regulate and control the expression of NFIX by targeting miR-369-3p, so that the RA synovial membrane angiogenesis is promoted. Experiments prove that the LncRNA EBLN3P can play a spongy role, and is competitively combined with miR-369-3p to lose use, so that the expression of a corresponding target gene NFIX is regulated and controlled, and RA angiogenesis is promoted, thereby proving that the LncRNA EBLN3P can be used for targeted therapy of RA synovial membrane angiogenesis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rheumatology, immunology, and molecular biology, specifically relating to the application of a lncRNA, EBLN3P, in the diagnosis and treatment of rheumatoid arthritis. Background Technology

[0002] Rheumatoid arthritis (RA) is a multifactorial chronic autoimmune disease of unknown etiology that leads to progressive joint destruction. Angiogenesis, accompanied by synovial pannus formation and inflammation, forms the basis of RA joint destruction. Angiogenesis plays a crucial role in the formation of synovial pannus, being a key factor in its formation and maintenance. In an inflammatory environment, blood vessels first undergo a period of high inflammation, followed by a period of dramatic increase in vascular growth. Newly formed blood vessels provide oxygen and nutrients to proliferating synovial inflammatory cells, further promoting the progression of synovial pannus and facilitating joint invasion and destruction. RA-FLS (fibroblast-like structures within the pannus) play a central role in the persistent formation of synovial pannus and progressive articular cartilage erosion. These FLS, located within the pannus, produce pathogenic mediators such as metalloproteinases and inflammatory cytokines, exhibiting an aggressive phenotype and playing a central role in joint inflammation and cartilage destruction. Furthermore, FLS are also key participants in initiating and maintaining immune cell recruitment, inducing the migration and differentiation of other cells within the RA synovium, thereby accelerating disease progression. Furthermore, the in vitro invasiveness of FLS is correlated with radiographic joint damage in RA patients. Different angiogenic factors promote disease progression, making anti-angiogenic therapy a key focus of RA treatment.

[0003] Studies show that long non-coding RNAs (lncRNAs) and microRNAs (miRNAs), which account for more than 98% of the human genome, play important roles in gene expression and regulation. Among them, long non-coding RNAs (lncRNAs) belong to the non-coding RNA family and can regulate the expression of target genes at multiple levels. Abnormal expression and dysfunction of lncRNAs are closely related to the occurrence of various human diseases. They can regulate gene expression by acting as "regulatory factors." One regulatory mechanism is that lncRNAs act as "sponge" RNAs for miRNAs, competitively binding to miRNAs and effectively reducing their expression in cells, thereby inhibiting their ability to target mRNAs. This lncRNA-miRNA-mRNA (i.e., competitive ceRNA) interaction is crucial in various biological processes. Research shows that aberrantly expressed lncRNAs, miRNAs, and mRNAs exist in the blood and synovial tissue of RA patients. These aberrantly expressed lncRNAs, miRNAs, and mRNAs can regulate a series of biological processes in FLS cells (such as cell cycle, proliferation, and migration) through this interaction, thereby affecting cytokine production and mediating disease development. Summary of the Invention

[0004] First, this invention provides a novel RA marker long non-coding RNA and its application in rheumatoid arthritis. This novel RA marker long non-coding RNA, namely LncRNA EBLN3P (GenBank sequence number: NR_036592.1), can promote the proliferation, migration, and angiogenesis factor secretion of fibroblast-like synovial cells in rheumatoid arthritis, thus enabling its application in the preparation of diagnostic and therapeutic agents for rheumatoid arthritis.

[0005] Furthermore, the present invention also proposes the application of a formulation for detecting the expression level of the LncRNA EBLN3P gene in peripheral blood mononuclear cell samples in the preparation of a rheumatoid arthritis diagnostic formulation, wherein the formulation for detecting the expression level of the LncRNA EBLN3P gene comprises primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] This invention experimentally demonstrates that the expression level of LncRNA EBLN3P is significantly increased in peripheral blood mononuclear cells of rheumatoid arthritis patients. LncRNA EBLN3P is significantly positively correlated with ESR, CRP, CCP antibody, SDS, CPRI-RA and PF scores of RA patients, and significantly negatively correlated with BP, GH and VT scores.

[0007] Next, this invention also proposes the application of a specific small interfering RNA of the LncRNA EBLN3P gene in the preparation of TNF-α-mediated rheumatoid arthritis targeted therapy agents, or that a small interfering RNA that inhibits the expression of the LncRNA EBLN3P gene can be used in the preparation of rheumatoid arthritis targeted therapy agents.

[0008] This invention designs and synthesizes a specific overexpression sequence pcDNA3.1-LncRNA EBLN3P and a small interfering sequence si-LncRNA EBLN3P targeting the full-length sequence of LncRNA EBLN3P. These are used to transfect RA-FLS, enabling LncRNA EBLN3P to be overexpressed and slightly interfered with in cells. The nucleotide sequences of the small interfering RNA Linc-EBLN3P-1734 (Si1) are shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequences of the small interfering RNA Linc-EBLN3P-2228 (Si2) are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequences of the small interfering RNA Linc-EBLN3P-3201 (Si3) are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0009] Finally, this invention also proposes a non-therapeutic application of LncRNA EBLN3P as a miRNA molecular sponge in regulating the inhibition of the function of the specific binding sequence miR-369-5p. After the function of miR-369-5p is inhibited, it can promote the expression of the NFIX gene, thereby activating the JAK / STAT signaling pathway and promoting synovial angiogenesis in RA.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0011] 1. Based on years of scientific and clinical research, the inventors' research group, combined with whole transcriptome high-throughput sequencing and bioinformatics analysis, screened LncRNA EBLN3P as a detection marker for RA, and clarified the relationship between LncRNA EBLN3P and RA, as well as the role mechanism of downstream target genes of LncRNA EBLN3P in the pathogenesis of the disease through experiments.

[0012] 2. This invention has found that the expression of LncRNA EBLN3P is significantly increased in peripheral blood mononuclear cells of RA patients. LncRNA EBLN3P is significantly positively correlated with ESR, CRP, CCP antibody, SDS, CPRI-RA and PF scores in RA patients, and significantly negatively correlated with BP, GH and VT scores.

[0013] 3. This invention, through cell studies, discovered that lncRNA EBLN3-FLSP is highly expressed in RA-FLS.

[0014] Overexpression of lncRNA EBLN3P significantly enhanced the proliferation, migration, and invasion capabilities of RA-FLS and the expression of related angiogenic factors (VEGF / MMP-9), while also upregulating the tube-forming ability of RA-FLS-induced HUVECs and the expression of vascular endothelial markers (CD34, CD105). Furthermore, overexpression of lncRNA EBLN3P inhibited miR-369-3p expression and upregulated NFIX expression, thereby significantly increasing the expression of JAK2, STAT3, and their phosphorylated forms p-JAK2 and p-STAT3, promoting the activation of the JAK / STAT signaling pathway. Conversely, knockdown of lncRNA EBLN3P significantly inhibited these effects.

[0015] 4. This invention provides new detection markers and therapeutic targets for RA, offering novel molecular information and biological basis for auxiliary diagnostic reagents, molecular targeted therapy reagents, or prognostic assessment reagents for this disease. Attached Figure Description

[0016] Figure 1 ROC curves representing the expression of LncRNA EBLN3P in PBMCs of RA patients and its role in RA diagnosis.

[0017] Figure 2 This study analyzed the correlation between LncRNA EBLN3P and clinical indicators in RA patients.

[0018] Figure 3 This indicates the expression of LncRNA EBLN3P in RA-FLS cells.

[0019] Figure 4 This indicates the effect of LncRNA EBLN3P on the proliferation, migration, and invasion capabilities of RA-FLS.

[0020] Figure 5 LncRNA EBLN3P acts as a competitive endogenous RNA to regulate the targeting of miR-369-3p to NFIX.

[0021] Figure 6 LncRNA EBLN3P regulates the expression levels of miR-369-3p and NFIX in RA-FLS.

[0022] Figure 7 This study indicates the effect of LncRNA EBLN3P on the expression of angiogenic factors and matrix metalloproteinases in RA-FLS.

[0023] Figure 8 This indicates the effect of LncRNA EBLN3P on lumen formation in RA-FLS-induced HUVECs.

[0024] Figure 9 This study demonstrates the effect of LncRNA EBLN3P on the expression of vascular endothelial markers in RA-FLS-induced HUVECs.

[0025] Figure 10 This indicates the effect of LncRNA EBLN3P on the regulation of the JAK / STAT signaling pathway. Detailed Implementation

[0026] Based on previous research, using whole-transcriptome high-throughput sequencing, and with p < 0.05 and a fold change > 2 as criteria, a long non-coding RNA with significantly differential expression characteristics, namely LncRNA EBLN3P (NR_036592.1), was obtained in peripheral blood mononuclear cells (PBMCs) of RA patients. The following bioinformatics analysis and experimental studies in the examples identify key long non-coding RNAs associated with angiogenesis in RA patients.

[0027] Unless otherwise specified, the experimental methods described in the following examples are generally performed under standard conditions or as recommended by the manufacturer.

[0028] Example 1

[0029] Expression of the LncRNA EBLN3P gene in PBMCs of RA patients:

[0030] After the project passed the ethics committee review, the system studied new diagnostic and therapeutic targets for human RA. Peripheral blood was drawn from RA patients, PBMCs were extracted, and the expression of the LncRNA EBLN3P gene was detected by RT-qPCR.

[0031] A total of 45 samples were collected, including 30 patients with a confirmed diagnosis of rheumatoid arthritis (RA) and 15 healthy controls. The clinical characteristics of the 30 RA patients are shown in Table 1, and the complete sample information is shown in Table 2.

[0032] Table 1

[0033] Gender (Male) 9(30%) Gender (Female) 21(70%) age (52.43±11.78) years old Course of disease (9.05±8.73) years

[0034] Table 2

[0035] Serial Number CCP (U / mL) RF (U / mL) ESR (mm / h) CRP (mg / L) VEGF (pg / mL) FGF2 (pg / mL) MMP9 (pg / mL) MMP2 (pg / mL) 1 180.88 34.45 39 50.42 331.27 30.64 32.75 29.32 2 19.57 67.89 55 56.77 176.08 20.13 31.27 25.98 3 134.03 86.88 83 67.89 595.77 20.04 29.67 36.11 4 131.24 23.43 69 86.88 178.1 18.48 24.6 28.78 5 23.84 17.46 82 23.43 523.32 18.17 26.93 34.5 6 4.46 34.06 89 17.46 677.12 17.66 30.85 36.22 7 40.01 22.06 67 34.06 575.59 17.01 23.98 31.86 8 169.7 34.45 15 257.8 552.4 13.93 27.16 30.15 9 245.6 48.55 26 145.8 280.81 11.67 30.38 25.73 10 246.7 76.77 29 146.9 199.47 11.61 23.5 31.86 11 235.7 25.55 76 156.9 198.59 10.04 31.61 31.86 12 133.45 55.6 13 25.55 650.86 10.00 29.58 40.65 13 13.25 45.7 49 40.8 536.22 9.93 29.92 32.9 14 346.7 34.7 57 107.67 474.13 9.86 25.95 27.33 15 17.56 56.8 24 2.48 366.95 9.24 33.21 30.6 16 141.92 67.8 15 45.56 488.75 8.87 24.94 28.86 17 77.78 34.5 43 18.66 632.9 8.57 23.12 31.17 18 38.18 33 56 20.02 351.55 8.38 30.76 37.64 19 29.38 45 16 9.37 167.74 8.28 26.08 31.86 20 11.18 56 15 55.67 422.31 7.70 30.03 25.47 21 26.02 56 18 6.84 480.89 7.60 23.08 32.89 22 4.2 55 24 45.6 547.2 7.27 28.59 31.41 23 9.66 57.6 95 107.17 391.29 7.21 30.21 31.58 24 11.42 57.5 47 23.76 471.48 5.81 24.6 31.86 25 21.47 45 102 21.62 182.64 5.47 26.28 22.73 26 88.78 34 22 25.79 559.26 5.28 28.8 29.72 27 67.67 235.5 42 16.08 188.95 4.99 32.42 35.36 28 26.88 198.7 62 41.44 331.75 4.94 29.54 31.86 29 245.7 286.6 76 13.49 209.85 4.56 24.98 35.51 30 346.5 187.8 78 50.42 452.22 3.97 31.97 44.18

[0036] The detection method for the lncRNA EBLN3P gene includes extraction from PBMCs of RA patients, extraction of total RNA using the TRIzo1 method, determination of RNA concentration and purity, cDNA synthesis, and PCR amplification. The specific steps are as follows:

[0037] Step 1: Extraction of PBMCs from RA patients

[0038] Five mL of peripheral blood was collected from patients with rheumatoid arthritis (RA), and PBMCs were obtained by discontinuous density gradient centrifugation. Under aseptic conditions, an equal volume of PBS was thoroughly mixed with the anticoagulated blood sample to dilute it. Five mL of lymphocyte separation medium was transferred to a 15 mL conical tube using a sterile dropper. An equal volume of diluted blood sample was then slowly added to the top of the lymphocyte separation medium along the wall of the centrifuge tube. The tube was centrifuged at 2000 rpm for 20 min to separate the white, cloudy cells in the middle layer. The cells were then transferred to a new sterile centrifuge tube. PBS was added to the centrifuge tube, and the cells were thoroughly rinsed by pipetting. The tube was centrifuged at 800 rpm for 8 min, and the supernatant was discarded. This process was repeated twice to collect RA-PBMCs for later use.

[0039] Step 2: RNA extraction

[0040] 1) Collect the cell pellet and add 1 mL of TRIzol for lysis. 2) Add 0.2 mL of chloroform, vortex vigorously for 15 s, and incubate at room temperature for 5 min. 3) Centrifuge at 12000 rpm for 10 min at 4°C, and transfer the supernatant (approximately 500 μL) to another EP tube. 4) Add 0.5 mL of pre-chilled isopropanol, mix gently, and incubate on ice for 30 min. 5) Centrifuge at 12000 rpm for 15 min at 4°C and discard the supernatant. 6) Add 1 mL of pre-chilled 75% ethanol. Centrifuge at 12000 rpm for 5 min at 4°C and discard the supernatant. 7) Repeat step 6). 8) Dry the RNA pellet at room temperature, add 20–50 μL of DEPC water, and store at -80°C for later use.

[0041] Step 3: RT reaction

[0042] 1) In a 0.2 mL EP tube, add total RNA (1 µg), 4.0 μL of All-in-One First-Strand Synthesis MasterMix, 1.0 μL of dsDNase, and DEPC water to a final volume of 20 μL. Gently mix and centrifuge. 2) Incubate at 37 °C for 2 min, 55 °C for 15 min, and 85 °C for 5 min on a PCR instrument, then immediately incubate on ice for 1 min. 3) Remove the reaction solution; this is cDNA. Store at -20 °C for later use.

[0043] Step 4: Quantitative Real-Time PCR Reaction

[0044] 1) The cDNA was used as a template for fluorescence quantitative quantification. The reaction system is shown in Table 3:

[0045] Table 3

[0046] system volume Taq SYBR Green qPCR Premix(Universal) 10 uL Forward Primer (10µM) 0.4 uL Reverse Primer (10µM) 0.4 uL cDNA 3 uL RNase Free Water 6.2 uL Total 20 uL

[0047] 2) The reaction conditions are shown in Table 4:

[0048] Table 4

[0049] temperature time 95℃ 30 s 95℃ 15 s 60℃ 30 s

[0050] (Note: The denaturation-annealing-extension reaction process is repeated 40 times.)

[0051] 3) Primers for each detection indicator are shown in Table 5:

[0052] Table 5

[0053] Gene Amplicon Size (bp) <![CDATA[Forward primer(5 ’ →3 ’ )]]> <![CDATA[Reverse primer(5 ’ →3 ’ )]]> Hu-β-actin 96 CCCTGGAGAAGAGCTACGAG GGAAGGAAGGCTGGAAGAGT Hu-LncRNA EBLN3P 151 GTCCAGTCTTGAGGACCGA (SEQ ID NO.1) TGGTTCCTATGCCCAGATCG (SEQ ID NO.2)

[0054] Step 5: Results and Analysis

[0055] The analytical method used in this experiment was Relative Quantification Study, and the calculation method was 2. -△△Ct The expression of the LncRNA EBLN3P gene was detected.

[0056] Experimental results show that:

[0057] (1) Expression of LncRNA EBLN3P in PBMCs of RA patients and ROC curve for RA diagnosis

[0058] The results are as follows Figure 1 As shown, comparing the expression of lncRNA EBLN3P in PBMCs of RA patients and normal individuals, it was found that the expression of lncRNA EBLN3P was elevated in RA patients (p<0.01). ROC curve analysis and calculation of the area under the ROC curve (AUC) showed that the AUC value of lncRNA EBLN3P in PBMCs for diagnosing RA was 0.946. This result indicates that lncRNA EBLN3P has certain diagnostic value for RA. Data are presented as mean ± SEM (n=30). ** p<0.01.

[0059] (2) Correlation analysis of LncRNA EBLN3P with RA clinical indicators

[0060] The results are as follows Figure 2As shown, LncRNA EBLN3P was significantly positively correlated with ESR, CRP, CCP antibody, SDS, CPRI-RA and PF scores, and significantly negatively correlated with BP, GH and VT scores.

[0061] Example 2

[0062] Application of LncRNA EBLN3P overexpression sequence and small interfering sequence in RA-FLS

[0063] This embodiment designs the full-length sequence of LncRNA EBLN3P and synthesizes its specific overexpression sequence pcDNA3.1-LncRNA EBLN3P and small interfering sequence si-LncRNA EBLN3P (their nucleotide sequences are shown in Table 6). These sequences are then transfected into RA-FLS to overexpress and slightly interfere with the LncRNA EBLN3P gene in cells. Furthermore, this overexpression and small interfering gene vector is used to regulate RA-FLS.

[0064] Table 6

[0065] Gene Amplicon Size (bp) <![CDATA[Forward primer(5 ’ →3 ’ )]]> <![CDATA[Reverse primer(5 ’ →3 ’ )]]> Hu-β-actin 96 CCCTGGAGAAGAGCTACGAG GGAAGGAAGGCTGGAAGAGT Hu-Linc-EBLN3P 151 GTCCAGTCTTTGAGGACCGA TGGTTCCTATGCCCAGATCG Linc-EBLN3P-(NC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT Linc-EBLN3P-1734(Si1) CAUUAAACAUCCUGAAGAATT (SEQ ID NO.3) UUCUUCAGGAUGUUUAAUGTT (SEQ ID NO.4) Linc-EBLN3P-2228(Si2) CUGAAGAGAUGGAAUAUAATT (SEQ ID NO.5) UUAUAUUCCAUCUCUUCAGTT (SEQ ID NO.6) Linc-EBLN3P-3201 (Si3) GGGAAGGAUUGUUAUAUAATT (SEQ ID NO.7) UUAUAUAACAAUCCUUCCCTT (SEQ ID NO.8)

[0066] The specific steps are as follows:

[0067] Step 1: RA-FLS cell culture

[0068] FLS and RA-FLS were purchased from Cybio Biotechnology Co., Ltd. DEME (high glucose) medium containing 10% fetal bovine serum was used, and the cells were cultured in a cell culture incubator with 5% CO2 and 37°C under saturated humidity. When the cells reached 90% confluence, they were passaged, and the 7th generation cells were selected for subsequent experiments.

[0069] Step 2: RA-FLS cell transfection and grouping

[0070] Passaged RA-FLS cells were seeded in 6-well plates. Following the instructions of the Lipofectamine™ 2000 transfection kit, pcDNA3.1-NC, pcDNA3.1-LncRNA EBLN3P, siRNA-NC, and siRNA-LncRNA EBLN3P plasmids (all purchased from Gene Pharma) were transfected into RA-FLS cells. Cells were collected after 48 h, and transfection efficiency was assessed by RT-PCR. Stably transfected cells constructed from these plasmids were divided into four groups: pcDNA3.1-NC group, pcDNA3.1-LncRNA EBLN3P group, siRNA-NC group, and siRNA-LncRNA EBLN3P group.

[0071] The specific methods for virus packaging and cell transfection are as follows:

[0072] (1) When 293T cells reach 80-90% confluence in a 6cm dish, discard the culture medium and wash the cells twice with 3 mL PBS; (2) Add 1 mL Trypsin-EDTA solution, mix well, carefully aspirate the trypsin solution, and incubate at 37℃ for 3 min; (3) Add 2 mL of DMEM culture medium containing 10% FBS, and pipette to form a single-cell suspension; (4) Count the cells using a hemocytometer and dilute the cells to 3 x 10^6 cells / mL. 5 Cells / mL; (5) at 5x10 3 Cells / well concentrations were seeded into 96-well plates, mixed, and cultured at 37°C and 5% CO2 for 24 h; (6) Lipofectamin2000 transfection reagent was used to transfect overexpression plasmids, and the dosage was shown in Table 7. Each dosage was set up in triplicate wells.

[0073] Table 7

[0074] Lipo (uL) 0.2 0.3 0.4 Plasmid (ug) 0.2 0.3 0.5

[0075] (7) Add 75 μL (25 μL / well * 3 wells) of serum-free DMEM to a 1.5 mL EP tube, then add the different doses of plasmid calculated according to the table above, mix well, take another 1.5 mL EP tube, add 75 μL (25 μL / well * 3 wells) of serum-free DMEM, add the corresponding dose of Lipofectamin 2000 calculated according to the table above, mix well, place at room temperature for 5 min, then mix the two groups of tubes, place at room temperature for 20 min, aspirate the culture medium in the 96-well plate, add 50 μL of serum-free DMEM culture medium to each well; (8) Add the transfection mixture dropwise to the 96-well plate, mix well, and incubate in an incubator for 5 h; (9) For the transfected plasmid group, aspirate the transfection medium, replace with complete culture medium, and observe after incubation in an incubator for 24 h; (10) After 48 h, detect the infection efficiency of 293T by RT-qPCR; (11) 48 h later, the supernatant of 293T cells was collected into a 15 mL centrifuge tube and centrifuged at 1500 rpm for 5 min at 4℃. The cell pellet was discarded, filtered through a 0.45 μm filter, and transferred to a 1.5 mL centrifuge tube. The cells were then frozen at -80℃. (12) RA-FLS cells to be infected with recombinant lentivirus were inoculated into six-well plates at a density of 5~8×10⁻⁶. 5 / well culture; (13) aspirate the culture medium, add 1 mL of recombinant lentivirus solution and 8 μL of polybrene (final concentration 1 μg / μL), and incubate in an incubator; (14) change half of the medium after 4 h; (15) change the medium completely after 24 h; (16) detect the infection efficiency of RA-FLS by RT-qPCR after 48 h.

[0076] In this way, RA-FLS with LncRNA EBLN3P overexpression and small interference is obtained.

[0077] Step 3: Results and Analysis

[0078] The analytical method used in this experiment was Relative Quantification Study, and the calculation method was 2. -△△Ct The expression of the LncRNA EBLN3P gene was detected.

[0079] Experimental results show that:

[0080] (1) The expression of LncRNA EBLN3P in RA-FLS cells was significantly increased, as shown in the following results. Figure 3 As shown.

[0081] (2) LncRNA EBLN3P promotes the proliferation and migration of RA-FLS cells, and the results are as follows: Figure 4 As shown.

[0082] The proliferation and migration abilities of RA-FLS were assessed using the EdU and scratch assays, respectively. Compared with the control group, the proliferation and migration activities of the model group were significantly increased (P < 0.01). Compared with the model group, treatment with the lncRNA EBLN3 overexpression plasmid further enhanced the proliferation and migration of RA-FLS (P < 0.01), while knockdown of EBLN3P expression significantly inhibited this process (P < 0.01). In the Transwell assay, cells showed a similar trend to those observed in the EdU and scratch assays.

[0083] (3) The results of LncRNA EBLN3P regulating the targeting of miR-369-3p to NFIX as a competitive endogenous RNA (ceRNA) are as follows: Figure 5 As shown.

[0084] To verify the targeting relationship among LncRNAs EBLN3P, miR-369-3p, and NFIX, we constructed a luciferase reporter gene vector containing binding sites for both wild-type (WT) and mutant (MUT) LncRNAs EBLN3P and NFIX. The miR-369-3p mimics and NFIX mimics were co-transfected into cells with the reporter gene vector to form a dual-luciferase reporter gene expression plasmid. The results showed that in the LncRNA EBLN3P-WT group, transfection with miR-369-3p mimics significantly reduced luciferase activity (P < 0.01). In the NFIX-WT group, transfection with miR-369-3p mimics significantly reduced luciferase activity (P < 0.05).

[0085] (4) LncRNA EBLN3P regulates the expression levels of miR-369-3p and NFIX in RA-FLS, such as Figure 6 As shown.

[0086] The expression levels of miR-369-3p and NFIX were detected using qRT-PCR. Compared with the control group, the expression level of miR-369-3p in the model group was significantly decreased (P<0.01), while the expression level of NFIX was significantly increased (P<0.01). Compared with the model group, treatment with the LncRNA EBLN3P overexpression plasmid significantly decreased miR-369-3p expression (P<0.01), while the expression level of NFIX was significantly increased (P<0.01). In contrast, knockdown of EBLN3P expression increased miR-369-3p expression (P<0.01), while NFIX showed a significant decreasing trend (P<0.05).

[0087] (5) LncRNA EBLN3P promotes the expression of angiogenic factors and matrix metalloproteinases in RA-FLS.

[0088] The expression levels of VEGF, FGF2, MMP9, and MMP2 in RA-FLS were detected using ELISA. Compared with the control group, the expression levels of VEGF, FGF2, MMP9, and MMP2 in the model group were significantly increased (P<0.05). Compared with the model group, the expression levels of VEGF, FGF2, MMP9, and MMP2 increased significantly after intervention with the LncRNA EBLN3P overexpression plasmid (P<0.05), while the opposite result was observed after knocking down EBLN3P expression (P<0.05). Figure 7 ).

[0089] (6) LncRNA EBLN3P promotes RA-FLS-induced midtube formation in HUVECs

[0090] To further evaluate the effect of lncRNA EBLN3P on angiogenesis, we assessed its tube formation in vitro. The results showed that the model group exhibited increased tube formation ability compared to the control group (P<0.01). Compared to the model group, further intervention with the lncRNA EBLN3P overexpression plasmid significantly enhanced tube formation ability (P<0.01), while knockdown of EBLN3P expression significantly reduced tube formation ability (P<0.05). Figure 8 ).

[0091] (7) LncRNA EBLN3P promotes the expression of vascular endothelial markers in RA-FLS-induced HUVECs.

[0092] Immunofluorescence assays were used to detect the expression of vascular endothelial markers CD34 and CD105 in RA-FLS-induced HUVECs. Compared with the control group, the expression levels of CD34 and CD105 in the model group were significantly upregulated (P<0.01). Compared with the model group, treatment with the LncRNA EBLN3P overexpression plasmid significantly increased the expression of CD34 and CD105 (P<0.01). Conversely, knockdown of EBLN3P expression significantly decreased the expression levels of CD34 and CD105 (P<0.01). Figure 9 ).

[0093] (8) LncRNA EBLN3P can activate the JAK / STAT signaling pathway.

[0094] To assess the effect of lncRNA EBLN3P on the activation of the JAK / STAT signaling pathway, the mRNA levels of JAK2 and STAT3 in RA-FLS were detected by qRT-PCR. Figure 4 (AB). Knockdown of EBLN3P expression significantly downregulated the expression of JAK2 and STAT3, while treatment with lncRNA EBLN3P overexpression plasmid showed the opposite trend in JAK2 and STAT3 expression. To further verify the activation status of the JAK / STAT signaling pathway, Western blotting was used to detect the protein expression levels of JAK2, STAT3, and their phosphorylated forms p-JAK2 and p-STAT3. JAK2 and STAT3 exhibited constitutive activation in RA-FLS, and overexpression of lncRNA EBLN3P significantly increased the protein expression levels of p-JAK2 and p-STAT3. Conversely, inhibition of EBLN3P expression significantly decreased the expression levels of p-JAK2 and p-STAT3. Figure 10 )。

Claims

1. A long non-coding RNA for rheumatoid arthritis (RA), namely LncRNA EBLN3P, can promote the proliferation, migration, and angiogenesis factor secretion of fibroblast-like synovial cells in rheumatoid arthritis, and thus can be applied to the preparation of diagnostic and therapeutic agents for rheumatoid arthritis.

2. The application of a lncRNA EBLN3P in the diagnosis of rheumatoid arthritis, characterized in that, The formulation for detecting the expression level of the LncRNA EBLN3P gene in peripheral blood mononuclear cell samples can be used in the preparation of a rheumatoid arthritis detection formulation, wherein the detection formulation includes primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.

2.

3. The application as described in claim 2, characterized in that, The expression level of LncRNA EBLN3P in peripheral blood mononuclear cells of rheumatoid arthritis patients was significantly increased. LncRNA EBLN3P was significantly positively correlated with ESR, CRP, CCP antibody, SDS, CPRI-RA and PF scores of RA patients, and significantly negatively correlated with BP, GH and VT scores.

4. The application of a lncRNA EBLN3P in the treatment of rheumatoid arthritis, characterized in that, Formulations containing small interfering RNAs that inhibit the expression of the LncRNA EBLN3P gene can be used in the preparation of targeted therapies for TNF-α-mediated rheumatoid arthritis. The nucleotide sequences of small interfering RNAs Linc-EBLN3P-1734 (Si1) are shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequences of small interfering RNAs Linc-EBLN3P-2228 (Si2) are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequences of small interfering RNAs Linc-EBLN3P-3201 (Si3) are shown in SEQ ID NO.7 and SEQ ID NO.

8.

5. The application of a lncRNA EBLN3P as a miRNA molecular sponge for non-therapeutic purposes in regulating the inhibition of the function of the specific binding sequence miR-369-3p, characterized in that, Inhibition of miR-369-3p function can promote the expression of the NFIX gene, thereby activating the JAK / STAT signaling pathway and promoting angiogenesis in the RA synovium.