Molecular marker closely linked with wild apple peel color, detection primer and application of molecular marker

By developing molecular markers and detection primers closely linked to peel color in wild apple species, the problem of identifying wild apple peel color in existing technologies has been solved, enabling precise screening of peel color and improving breeding efficiency.

CN122012793APending Publication Date: 2026-05-12NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610389500.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-27
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing molecular markers cannot effectively amplify peel color bands in wild apples, resulting in a narrowing of the apple genetic pool and making it difficult to accurately identify and screen peel color traits during breeding.

Method used

A molecular marker closely linked to the peel color of wild apple species was developed, located at loci 31503385~31511919 on chromosome 9 of the Catalpa genome. Specific detection primers were designed, and the peel color was detected by PCR amplification and agarose gel electrophoresis.

Benefits of technology

This enables precise identification and screening of apple peel color, shortens the breeding cycle, saves time and resources, and promotes the targeted utilization of wild apple resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012793A_ABST
    Figure CN122012793A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker closely linked with a wild apple peel color, a detection primer and application of the molecular marker and the detection primer, and belongs to the technical field of genetic breeding. The molecular marker is located at a site 31503385-31511919 of a No.9 chromosome of a catalpa bungei genome, and is an insertion / deletion polymorphic site of an LTR retrotransposon in an upstream promoter region of an MdMYB1 gene. The invention further designs a detection primer of the molecular marker, and the nucleotide sequence of the detection primer is SEQ ID NO.2 and SEQ ID NO.3. When the amplification product of the detection primer has a strip at 536bp, the amplification product is an insertion genotype (red peel), and when the amplification product does not have a strip, the amplification product is a deletion genotype (yellow or yellow green peel). The method can quickly and accurately judge the pericarp color of the wild apple species filial generation, realizes early screening of coloring characters, greatly improves the cross breeding efficiency of wild apples, provides key technical support for genetic improvement and directional utilization of wild apple resources, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, specifically to a molecular marker and detection primer closely linked to the peel color of wild apples, and their application in assisted breeding improvement. Background Technology

[0002] The color of apple fruit is an important quality indicator and has always been a hot topic in apple molecular biology research. Takos et al. (2006) found... MdMYB1 It is expressed only in the peel of red apple varieties, not in yellow and green varieties; and MdMYB1 The SNP sites in the sample co-segregated with the pericarp color. Subsequently, numerous studies have shown that, based on... MdMYB1 Specific primers designed for the gene and its promoter region SNP sites amplified bands that co-separated with the red trait, serving as molecular markers for fruit color selection with near 100% accuracy. In 2019, Cong Peihua's research group (Zhang et al. 2019) analyzed the genomes of haploid plants of Hanfu apple and discovered that in red varieties... MdMYB1 A 4102 bp retrotransposon (named RedTE) is present upstream of the promoter; this retrotransposon is absent in yellow and green varieties. Genetic analysis indicates that this retrotransposon sequence insertion co-segregates with peel color and can be used for auxiliary selection of peel color in apple hybrids.

[0003] However, research revealed that while the pericarp of *Cathaya fupingensis* is red, the RedTE-specific primers failed to amplify the band in *Cathaya fupingensis* and its hybrid offspring. BSA-seq analysis of the *Cathaya fupingensis* × *Ruixue* hybrid population showed that the color gene was still located at Chr9. [The last sentence appears to be incomplete and unrelated to the preceding text.] MYB1 Gene sequence analysis showed that there was no RedTE sequence upstream of the gene promoter. Therefore, specific primers were designed as molecular markers based on the Catalpa spp. promoter region sequence. The results showed that the detection results of this marker were completely consistent with the pericarp color of the offspring of the Fuping Catalpa × Ruixue hybrid.

[0004] Currently, intervarietal hybridization is commonly used in apple breeding, but this long-term practice has gradually narrowed the apple genetic pool. Utilizing wild apple resources for hybridization breeding is an important means to address this narrowing genetic pool. Therefore, this invention analyzes key genes for pericarp coloring in the Fuping Catalpa fruit. MdMYB1 By studying the expression characteristics and promoter sequence variations of wild apples, promoter sequence variations were developed as core molecular markers for the peel coloring trait in wild apples. The establishment of this marker provides key technical support for the accurate identification, genetic background analysis, and targeted utilization of wild apple resources, and also lays a solid foundation for early screening and molecular-assisted breeding of coloring traits in related fruit tree breeding.

[0005] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker closely linked to the peel color of wild apple species, which is helpful for the screening and identification of apples with target peel color and the development of germplasm resources.

[0007] To achieve the above objectives, this invention provides a molecular marker closely linked to the peel color of wild apples. The molecular marker is located at positions 31503385-31511919 on chromosome 9 of the *Cathaya argyrophylla* genome, and its nucleotide sequence is shown in SEQ ID NO.1. The molecular marker is... MdMYB1 The gene upstream promoter region LTR retrotransposon insertion or deletion polymorphism site, wherein the sequence number of the Catalpa genome is CM103599.1.

[0008] The present invention also provides a detection primer for detecting the molecular marker, the nucleotide sequence of which is shown in SEQ ID NO.2 and 3.

[0009] The present invention also provides a kit comprising the detection primers.

[0010] This invention also provides a method for detecting the color of apple peel, comprising the following steps: 1) Extract genomic DNA from the apple samples to be tested; 2) Using the genomic DNA as a template, perform PCR amplification using the detection primers; 3) Perform agarose gel electrophoresis on the PCR amplification products and determine the apple peel color based on the electrophoresis results.

[0011] Preferably, the PCR amplification program in the detection method is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 15 s, 60℃ annealing for 10 s, 72℃ extension for 10 s, for 35 cycles; 72℃ final extension for 5 min.

[0012] Preferably, in the detection method, when the amplification product shows a specific band at 536 bp, it is a homozygous or heterozygous insertion genotype, and its pericarp color phenotype is red; when the amplification product has no band, it is a homozygous deletion genotype, and its pericarp color phenotype is yellow or yellow-green.

[0013] The molecular markers, detection primers, or kits provided by this invention can be used to identify the peel color of hybrid offspring of wild apple species.

[0014] The molecular markers, detection primers, or kits provided by this invention can be used in marker-assisted hybridization breeding of apples, especially for the identification and screening of apple peel color traits.

[0015] The present invention has the following advantages: This invention is the first to develop a molecular marker closely linked to apple peel color, adapting to the genetic breeding needs of wild apples and solving the problem that existing molecular markers such as RedTE cannot amplify effective bands in wild apples such as *Cathaya fupingensis*. This molecular marker completely co-segregates with the red peel trait of wild apples, and the detection results can accurately predict the peel color phenotype of hybrid offspring, with no false positives / false negatives and an identification accuracy of 100%. This invention also develops detection primers for this molecular marker, enabling large-scale detection based on conventional PCR and agarose gel electrophoresis techniques.

[0016] Bioinformatics comparison and verification showed that the LTR retrotransposon insertion site is common in many red wild species of the genus Malus and is not unique to Catalpa fupingensis. It can be promoted and applied in the breeding of wild species of Malus.

[0017] The molecular markers and detection primers provided by this invention can screen for peel coloring traits in apple hybrid offspring during the seedling stage, eliminating non-target phenotype plants in advance, significantly saving time, manpower, and material costs in the breeding process, and shortening the breeding cycle. This provides key technologies for the accurate identification and genetic background analysis of wild apple resources such as *Cathaya fupingensis*, promotes the targeted utilization of wild apple resources in apple genetic improvement, and has good application prospects in quality-assisted breeding of *Cathaya fupingensis* hybrid offspring. Attached Figure Description

[0018] Figure 1 Genes of Fuping Catalpa and Ruixue and their hybrid offspring MdMYB1 Color phenotype and statistical results.

[0019] Figure 2 The results of agarose gel electrophoresis of *Cathaya fupingensis* and *Syzygium rutinum* and their hybrid offspring at this site are shown; where M represents 2000 markers, QZ represents *Cathaya fupingensis*, RX represents *Syzygium rutinum*, and the remaining lanes represent 60 random hybrid offspring. Detailed Implementation

[0020] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0022] Example 1: Segregation of pericarp color in the hybrid offspring of Fuping Catalpa and Ruixue The fruit peel color phenotypic characteristics of 139 hybrid offspring of *Chamaedorea fupingensis* and *Chamaedorea elegans* were determined and collected. A coloring grade was established based on the degree of redness of the peel, represented by numbers "0-5", with higher numbers indicating deeper coloring. The statistical results of the fruit peel color are shown below. Figure 1 As shown, the results indicate that the fruit color of the hybrid offspring of *Cathaya fupingensis* and *Ruixue* exhibits extensive genetic variation at maturity, with a yellow-green to red segregation ratio of 64:75, approximately 1:1. The constructed samples show significant phenotypic differences, enabling effective QTL mapping analysis of fruit color.

[0023] Example 2: Genetic localization of retrotransposons Using the hybrid population of Fuping Catalpa and Ruixue in Example 1 and the parent plants as materials, 30 plants each with extreme red and yellow-green traits were selected to construct a BSA sequencing pool. By resequencing the mixed pool of color phenotypes, a major QTL (6.1Mb~9.6Mb) associated with fruit color was genetically located on chromosome 9 of apple.

[0024] Candidate genes were selected based on the color of the red and yellow fruit peel. MdMYB1 Amplification of CDS and upstream promoter, followed by analysis of first-generation Sanger sequencing data, revealed a correlation with the reference genome (Golden Crown). Malus domestica Compared to 'Golden Delicious' (accession number CP168773.1), some green and yellow group offspring showed a deletion of 8533 bp at this site. The marker for this deletion is located at positions 31503385 to 31511919 on chromosome 9 of the Catalpa genome (accession number CM103599.1), which is an insertion or deletion polymorphism site of an LTR (long terminal repeat) retrotransposon. Annotation based on the apple genome revealed that this variant site is a retrotransposon, with the sequence as follows: Retrotransfer of site deletion marker (SEQ ID NO.1):

[0025] Example 38533bp structural variation verification in the offspring of crosses between Catalpa fupingensis and Ruixue. Specific primers were designed to detect 8533 bp structural variation in 60 randomly selected progeny of *Cathaya fupingensis* and *Ruixue* with a red phenotype. Genomic DNA was extracted from *Ruixue*, *Cathaya fupingensis*, and hybrid progeny, and PCR amplification was performed using these DNA samples as templates with specific primers. Genotypes were verified based on the PCR amplification products.

[0026] The specific primers are as follows: The upstream primer MdMYB1-F was designed in the retrotransposon insertion region, denoted as SEQ ID NO.2, with the specific sequence: TGCATGCTGAAAGTGCGATG; the downstream primer MdMYB1-R was designed in the shared region, denoted as SEQ ID NO.3, with the specific sequence: CTTGGCCGACCCTACATCTAA. When using this pair of specific primers to amplify the target genome sample, a specific band appeared at 536 bp in the amplification product, indicating that the sample had a homozygous or heterozygous insertion genotype; no band appeared in the amplification product, indicating a homozygous deletion genotype.

[0027] The PCR amplification system consisted of 2 μL of 50 ng / μL template DNA, 10 μL of 2×DiFAST Taq PCR MasterMix, 0.4 μL each of upstream and downstream primers, and sterile ddH2O to a final volume of 20 μL.

[0028] The PCR program was as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 15 seconds; 60℃ annealing for 10 seconds; 72℃ extension for 10 seconds, for 35 cycles, and a final extension at 72℃ for 5 minutes.

[0029] The agarose gel electrophoresis results of the genetic variation locus of *QZ* and *RX* and 60 randomly selected hybrid offspring are as follows: Figure 2 As shown, the results were interpreted as follows: when the hybrid offspring showed a homozygous insertion genotype or a heterozygous insertion genotype at 536 bp, they were identified as red plants; when the hybrid offspring showed no amplification band and the phenotype was a homozygous deletion genotype, they were identified as yellow or yellow-green plants.

[0030] Based on the statistical analysis of the hybrid offspring in Example 1, the results show that, among the parents, Ruixue exhibits a del8533:del8533 homozygous phenotype at this mutation site, while Fupingqiuzi exhibits a Del8533:del8533 heterozygous phenotype at this mutation site. The hybrid offspring have a theoretical genetic segregation ratio of insertion heterozygosity to deletion of 1:1.

[0031] Therefore, it can be concluded that the QTL9 site is a major site associated with fruit color, and the insertion of the 8533 bp structural variation site is closely linked to the red trait of wild apple fruit.

[0032] Example 48533bp in other wild apple species MdMYB1 Bioinformatics alignment of upstream insertion For the specific insertion site of the target transposon, 75 bp sequences were selected at each of the two junctions: a common sequence and a retrotransposon insertion sequence. The common sequence consisted of 40 bp, and the transposon-specific sequence consisted of 35 bp. A 50 bp degenerate nucleotide N was inserted between each of the two 75 bp sequences, resulting in a full-length 200 bp sequence. BLAST was performed using NCBI, with the database being the Whole Genome Shotgun Assembly Contiguous Group (WGS), and the biosource being Malus (taxid: 3769), with an E-value ≤ 1e. -29 The sequence coverage is 75%.

[0033] The sequence is as follows: The retrotransposon insertion upstream has a total sequence length of 40 bp, denoted as (SEQ ID NO.4): ATTTAGAGTAAAACTTAATTTTAAGTTATAAATCTACCCC; The specific sequence at the front end of the retrotransposon is 35 bp, denoted as (SEQ ID NO.5): AACTTACTCTAACCCTTAGGTCAAATATGAGTTTT; The posterior end-specific sequence of the retrotransposon is 35 bp, denoted as (SEQ ID NO.6): CGTTTCAAATTTTGGGACCACGATTTGCTGGATCG; The retrotransposon insertion downstream has a total sequence length of 40 bp, denoted as (SEQ ID NO.7): ATCAGTAGAATTCTCACTTCGTAATTTACTAATCTTAGCT; Adding 50bp of degenerate nucleotide N results in a final 200bp sequence, denoted as (SEQ ID NO.8): ATTTAGAGTAAAACTTAATTTTAAGTTATAAATCTACCCCAACTTACTCTAACCCTTAGGTCAAATATGAGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTTCAAATTTTGGGACCACGATTTGCTGGATCGATCAGTAGAATTCTCACTTCGTAATTTACTAATCTTAGCT.

[0034] The comparison results of the above 200bp sequence with the NCBI WGS database indicate that it is found in other red wild species of the genus Malus (see Table 1 for details). MdMYB1 Upstream, there is also an insertion of this reversible.

[0035] Table 1. Comparison results of WGS database In summary, this invention addresses the technological gap where existing molecular markers for apple peel coloring cannot be adapted to wild apples. Using *Cathaya fupingensis* as the core research material, and through phenotypic identification and resequencing techniques, it located a major-effect QTL on chromosome 9 of the apple that is closely associated with peel coloring in wild apples, and discovered... MdMYB1 The insertion / deletion polymorphism site of the 8533 bp LTR retrotransposon in the upstream promoter region of the gene is a key genetic molecular marker. Specific upstream and downstream detection primers were designed for this marker, and a standardized PCR-agarose gel electrophoresis detection method was established, clarifying the correspondence between genotype and peel color: insertion genotypes (homozygous / heterozygous) correspond to red peel, and deletion genotypes (homozygous) correspond to yellow or yellowish-green peel. Through population validation of hybrid offspring and bioinformatics comparison with wild species of the genus *Malus*, it was confirmed that this molecular marker co-segregates 100% with the red peel trait of wild apples and is prevalent in multiple red wild species of *Malus*. This invention applies this molecular marker and primers to the determination of peel color in wild apple hybrid offspring and to molecular-assisted breeding for coloring traits, enabling early and accurate screening of coloring traits in wild apples.

[0036] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A molecular marker closely linked to the peel color of wild apples, characterized in that, The molecular marker is located at positions 31503385~31511919 on chromosome 9 of the *Cathaya argyrophylla* genome, and its nucleotide sequence is shown in SEQ ID NO.

1. The molecular marker is... MdMYB1 The gene upstream promoter region LTR retrotransposon insertion or deletion polymorphism site, wherein the sequence number of the Catalpa genome is CM103599.

1.

2. A detection primer for detecting the molecular marker of claim 1, characterized in that, The nucleotide sequences of the detection primers are shown in SEQ ID NO.2 and 3.

3. A kit comprising the detection primers as described in claim 2.

4. A method for detecting the color of apple peel, characterized in that, Includes the following steps: 1) Extract genomic DNA from the apple samples to be tested; 2) Using the genomic DNA as a template, PCR amplification is performed using the detection primers described in claim 2; 3) Perform agarose gel electrophoresis on the PCR amplification products and determine the apple peel color based on the electrophoresis results.

5. The detection method according to claim 4, characterized in that, The PCR amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 15 s, 60℃ annealing for 10 s, 72℃ extension for 10 s, for 35 cycles; 72℃ final extension for 5 min.

6. The detection method according to claim 4, characterized in that, When the amplification product shows a specific band at 536bp, it indicates a homozygous or heterozygous insertion genotype, and its pericarp color phenotype is red; when the amplification product shows no band, it indicates a homozygous deletion genotype, and its pericarp color phenotype is yellow or yellow-green.

7. The application of the molecular marker as described in claim 1, the detection primer as described in claim 2, or the kit as described in claim 3 in identifying the peel color of hybrid offspring of wild apple species.

8. The application of the molecular marker as described in claim 1, the detection primer as described in claim 2, or the kit as described in claim 3 in apple molecular marker-assisted hybridization breeding.

9. The application according to claim 8, characterized in that, The application includes the identification and screening of apple peel color traits.