Saccharomyces cerevisiae with good ecological adaptability and capability of improving yeast fermentation capacity as well as separation method and application of saccharomyces cerevisiae

Abstract

The invention discloses saccharomyces cerevisiae with good ecological adaptability and capable of improving the fermentation capacity of yeast for making hard liquor as well as a separation method and application of the saccharomyces cerevisiae, and belongs to the field of saccharomyces cerevisiae. According to the invention, a strain of saccharomyces cerevisiae S. cerevisiae M7 with high fermenting power, which has the advantages of high temperature resistance, acid resistance, ethanol tolerance and good ecological adaptability, is separated from yeast for making hard liquor. When the saccharomyces cerevisiae is used for preparing the enhanced yeast for making hard liquor, the fermenting power of the yeast for making hard liquor can be remarkably improved, and other physicochemical indexes of the yeast for making hard liquor are not negatively influenced. The method has important values in the aspects of improving the yeast fermenting power, saving grains, saving energy, reducing emission and the like, and the benefits of wine enterprises can be increased.

Description

Technical Field

[0001] This invention relates to the field of brewing yeast, specifically to a brewing yeast with good ecological adaptability that can improve the fermentation power of Daqu (a type of starter culture), its isolation method, and its application. Background Technology

[0002] Daqu, as a saccharification and fermentation agent, contains various functional microorganisms related to brewing, such as yeast, mold, and bacteria. Its fermentation power determines the yield of baijiu and the utilization rate of grains. Developing yeasts with high fermentation power and applying them to the production of daqu can improve the fermentation power of daqu, thereby reducing energy consumption, saving grains, and increasing benefits for enterprises and society.

[0003] Baijiu fermentation is a complex natural fermentation system. The high temperature, low pH, and high ethanol conditions during baijiu production are highly unsuitable for yeast survival. Furthermore, because the system contains a variety of microorganisms, the added yeast must both grow to function effectively and not inhibit other functional microorganisms, placing further demands on the yeast's ecological adaptability. Therefore, developing superior yeast strains that can simultaneously meet these conditions remains an important research direction. Summary of the Invention

[0004] The purpose of this invention is to provide a brewing yeast with good ecological adaptability and the ability to improve the fermentation power of Daqu (a type of starter culture), as well as its separation method and application, to solve the problem that brewing yeast under the existing technology cannot simultaneously meet the requirements of high fermentation power and good adaptability.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A brewing yeast with good ecological adaptability and the ability to enhance the fermentation power of Daqu (a type of starter culture), wherein the brewing yeast is a strain S.cerevisiae M7 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) on February 6, 2026, with accession number CGMCC No. 39145. Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Furthermore, the aforementioned brewing yeast is isolated from the koji (fermentation starter) produced by the winery.

[0007] Furthermore, the aforementioned brewer's yeast grows well at 25-50℃.

[0008] Furthermore, the aforementioned brewer's yeast grows well under conditions of pH 1-9.

[0009] Furthermore, the aforementioned brewer's yeast grows well under conditions of 0-12% vol ethanol content.

[0010] Furthermore, the aforementioned brewing yeast, when applied to the production of Daqu (a type of starter culture) in a winery, can improve the fermentation power of Daqu without negatively impacting its esterification or saccharification capabilities.

[0011] A method for isolating brewing yeast with good ecological adaptability and the ability to improve the fermentation power of Daqu (a type of starter culture), comprising the following steps: Step 1: Isolate and purify yeast from the starter culture sourced from the winery; Step 2: Detect the fermentation power of the yeast obtained in Step 1, and screen out brewer's yeast strains with high fermentation power based on the detection results; Step 3: Detect the tolerance of the brewing yeast obtained in Step 2, and screen the brewing yeast strain with multiple tolerances based on the detection results; Step 4: Use brewing yeast strains that meet all the above conditions to produce fortified koji in the winery. Based on the physicochemical index detection and high-throughput sequencing results, select brewing yeast strains with good ecological adaptability.

[0012] The application of the above-mentioned brewing yeast in the production of brewing starter.

[0013] Compared with the prior art, the advantages of the present invention are: This invention provides a brewing yeast with good ecological adaptability that can improve the fermentation power of Daqu (a type of starter culture), and its isolation method. The brewing yeast of this invention can be applied to alcoholic beverages, especially Daqu production, and can improve the fermentation power of Daqu without negatively impacting its saccharification and esterification capabilities. This invention has significant value in enriching the germplasm resource bank of brewing microorganisms, saving grain, and improving efficiency. Attached Figure Description

[0014] Figure 1 This is a comparison chart of yeast fermentation capacity. Where: CK is the control yeast (a high-temperature resistant, high-activity dry yeast for baijiu production by Angel Yeast Co., Ltd.); different lowercase letters indicate significant differences (P < 0.05); all values ​​in the chart are repeated more than 3 times.

[0015] Figure 2 This is a growth curve diagram of yeast. Where: A, M3; B, M6; C, M7; D, control yeast. OD 600 The test value is the result of diluting the bacterial culture 5 times. Figure 4 The median values ​​were repeated more than 3 times.

[0016] Figure 3 This is a comparison of the growth of four yeast strains at different temperatures. Where: CK, control yeast; different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0017] Figure 4This is a comparison of the growth of four yeast strains at different pH levels. Where: CK represents the control yeast; different lowercase letters indicate significant differences (P < 0.05); all values ​​in the figure are repeated more than three times.

[0018] Figure 5 This is a comparative graph showing the growth of four yeast strains under different ethanol concentrations. Where: CK represents the control yeast; different lowercase letters indicate significant differences (P < 0.05); all values ​​in the graph are repeated more than three times.

[0019] Figure 6 Agarose gel electrophoresis images of 26S rDNA PCR products from four yeast strains, where: M, marker2000; —, negative control; A, M3; B, M6; C, M7.

[0020] Figure 7 Phylogenetic diagram of three yeast strains based on their 26S rDNA sequences.

[0021] Figure 8 This is a temperature curve of the room after the Daqu (a type of Chinese liquor) is introduced.

[0022] Figure 9 The comparison curves show the fermentation power of Daqu (a type of starter culture). Wherein: CK1, conventional Daqu; CK2, conventional Daqu; CK3, conventional Daqu; CK4, conventional Daqu; M3, Daqu enhanced with 4 L M3; M6, Daqu enhanced with 4 L M6; M7, Daqu enhanced with 4 L M7; all values ​​in the graph are repeated more than 3 times.

[0023] Figure 10 Comparison curves of saccharification power for enhanced Daqu (a type of starter culture). Wherein: CK1, regular Daqu; CK2, regular Daqu; CK3, regular Daqu; CK4, regular Daqu; M3, enhanced Daqu with 4 L M3 added; M6, enhanced Daqu with 4 L M6 added; M7, enhanced Daqu with 4 L M7 added; all values ​​in the graph are repeated more than 3 times.

[0024] Figure 11 The comparison curves show the esterification power of Daqu (a type of Chinese liquor). Wherein: CK1, conventional Daqu; CK2, conventional Daqu; CK3, conventional Daqu; CK4, conventional Daqu; M3, Daqu enhanced with 4 L M3; M6, Daqu enhanced with 4 L M6; M7, Daqu enhanced with 4 L M7; all values ​​in the graph are repeated more than 3 times.

[0025] Figure 12 This is a map showing the relative abundance distribution of fungi and bacteria at the genus level in Daqu (a type of starter culture). Where: A: fungal genus level; B: bacterial genus level. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0027] Example 1

[0028] The isolation and identification of yeasts with high fermentation power and multiple tolerances includes the following steps: Step 1: Using the distillery's koji (fermentation starter) as the screening source, single-strain cultures were isolated and purified by streak plating, and the fermentation power of the yeast was tested using the CO2 weight loss method. Initial screening was performed using 50 ml centrifuge tubes, followed by secondary screening using fermentation plugs. After extensive experiments, three strains with high fermentation power, M3, M6, and M7, were finally obtained, with fermentation power as follows: Figure 1 As shown, the fermentation power of these three strains is no less than that of the control yeast (a high-temperature resistant, high-activity dry yeast for brewing baijiu produced by Angel Yeast Co., Ltd.) (the control yeast mentioned below refers to this control yeast). Therefore, the fermentation power of M3, M6, and M7 has reached a very high level.

[0029] Step 2: Test the tolerance of the three candidate strains M3, M6, and M7 obtained in Step 1. The process is as follows: (2.1) Drawing the growth curve Yeast suspension cultured for 48 h was inoculated into 50 mL of YPD medium at a 1% v / v inoculation rate and cultured at 30 °C and 180 rpm. Samples (200 μL) were taken every 4 h. 1 mL of sterile water was added to each sample, and the mixture was centrifuged at 12000 rpm for 10 min. The supernatant was discarded; this process was repeated twice. The samples were then dried, and 1 mL of sterile water was added to each sample, followed by vortexing. Sterile water was used as a blank control. The OD of the samples was measured using a microplate reader. 600 Plot the growth curve ( Figure 2 Both the experimental and control yeasts tended to stabilize after 36 hours of growth. Therefore, 36 hours was used as the measurement time for subsequent tolerance tests.

[0030] (2.2) Yeast tolerance test (2.2.1) High temperature resistance Activated yeast suspension was inoculated into YPD medium at a 1% v / v inoculum. The medium was then incubated in shakers at 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃ at 180 rpm for 36 h. OD values ​​were measured after each inoculum. 600 .like Figure 3 As shown, the OD values ​​of M3, M6, M7, and control yeasts are... 600 All showed a sharp decrease at 40℃ and 45℃; when the culture temperature was 40℃, the OD of M3, M6 and M7 decreased sharply. 600 All were higher than the control yeast; when the culture temperature was 45℃ and 50℃, the OD values ​​of M3, M6 and M7 were higher. 600All three strains showed performance no lower than the control yeast. In conclusion, compared with the control yeast, the heat resistance of M3, M6, and M7 has reached a relatively high level.

[0031] (2.2.2) Acid resistance Activated yeast suspensions were inoculated into YPD medium at pH 1, 2, 3, 5, 7, and 9 at a 1% v / v inoculation rate. The cultures were incubated at 30°C and 180 rpm for 36 h, and samples were taken afterward to detect OD. 600 .like Figure 4 As shown, the acid resistance of M3, M6, and M7 is similar to that of the control yeast, reaching a very high level.

[0032] (2.2.3) Ethanol resistance Activated yeast suspensions were inoculated at a 1% v / v inoculum into YPD media with ethanol concentrations of 0%, 3%, 6%, 9%, and 12%. The cultures were incubated at 30°C and 180 rpm for 36 h, and OD values ​​were measured afterward. 600 .like Figure 5 As shown, the ethanol tolerance of M3, M6, and M7 is similar to that of the control yeast, reaching a relatively high level.

[0033] Based on the data on the high temperature resistance, acid resistance, ethanol resistance and fermentation power of the above yeast strains, these three yeast strains were found to be excellent in all aspects, and therefore they were selected as candidate strains for subsequent applications.

[0034] Step 3: Identification of the strain The three candidate strains obtained in this example were subjected to molecular biological identification, and the identification process is as follows: (3.1) Extraction of genomic DNA from the strain Genomic DNA was extracted from M3, M6, and M7 using a thermal lysis method.

[0035] (3.2) PCR amplification Genomic DNA was used as a template for PCR amplification, and the D1 / D2 region DNA fragment was amplified using universal primers NL1 / NL4. The PCR reaction system is shown in Table 1. The PCR amplification program was: 96℃ for 10 min; 98℃ for 10 s, 53℃ for 15 s, 72℃ for 15 s, 30 cycles; 72℃ for 10 min.

[0036] Table 1 Preparation of PCR reaction solution reagents Usage PrimeSTAR Max Premix (2×) 12.5 μL Primer NL1 0.5 μL Primer NL4 0.5 μL DNA template 1 μL Sterilized water 10.5μL (3.3) Gel electrophoresis detection of amplification products Take 3 μL of the amplification product, add 1 μL of loading buffer; mix well, and then perform electrophoresis on a 1% agarose gel. The results are as follows: Figure 6 As shown, the amplification bands of the three strains were all relatively simple, with lengths ranging from 500 to 750 bp, indicating that the PCR amplification was successful.

[0037] (3.4) DNA sequencing and sequence alignment The purified PCR products were sent to BGI Genomics Co., Ltd. in Shanghai for sequencing to obtain the 26S rDNA sequences of strains M3, M6, and M7. The sequence information is as follows.

[0038] D1 / D2 sequence of M3 26S rDNA: GAAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTC ATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAG TACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCA GCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTT D1 / D2 sequence of M6 26S rDNA: GAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCT D1 / D2 sequence of 26S rDNA of M7: GAGGAAAAGAAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTC TATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCT AAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGT TTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCC The sequences were compared with those in the NCBI database, and the results showed that all three yeast strains were *Saccharomyces cerevisiae*. Saccharomyces cerevisiae A phylogenetic tree is constructed based on the sequence, such as... Figure 7 As shown, they are all related to S. cerevisiae They are grouped into one category. Therefore, they are named as follows: S. cerevisiae M3 S. cerevisiae M6 S. cerevisiae M7.

[0039] Example 2

[0040] This embodiment discloses three strains of Saccharomyces cerevisiae obtained in Example 1. S. cerevisiae The application of M3, M6, and M7 in Daqu (a type of Chinese liquor) and the testing of their ecological adaptability are explained in detail below: (1), Daqu production The bacterial cultures of the three brewing yeast strains M3, M6, and M7 obtained in Example 1 were uniformly added to the raw materials for making medium- and high-temperature koji. The bacterial culture addition scheme is shown in Table 2.

[0041] Table 2 Bacterial Solution Addition Scheme Group Room number Add strain name Bacterial solution addition volume Regular large-scale music CK1 South 2-2 none none Regular large-scale music CK2 North 2-2 none none Regular large-scale music CK3 South 2-5 none none Regular large-scale music CK4 North 2-5 none none Optimize Daqu M3 South 2-3 M3 4L Optimize Daqu M6 North 2-4 M6 4L Optimize Daqu M7 South 2-4 M7 4L (2) Temperature monitoring of Daqu After the Daqu (a type of starter culture) is placed in the room, its temperature is recorded daily at 8:00 AM until it is removed from the room after 30 days. The temperature curve of the Daqu is shown below. Figure 8 As shown, the temperature changes in the seven Daqu (a type of starter culture) cells were basically consistent, indicating that the management during the Daqu cultivation process was stable.

[0042] (3) Selection of Daqu samples Five samples of Daqu (a type of starter culture) were selected from each chamber using a five-point sampling method (one sample from each point). The Daqu samples obtained from the same chamber were then ground, pulverized, and mixed evenly before being used in subsequent experiments.

[0043] (4) Detection of moisture content of Daqu The test results are shown in Table 3. The moisture content of all groups is less than 13%, which meets the requirements for Daqu production.

[0044] Table 3 Moisture content of Daqu (a type of starter culture) Daqu Group Moisture content M3 11.32% M6 11.16% M7 12.28% CK1 10.85% CK2 12.30% CK3 11.99% CK4 12.73% (5) Detection of physical and chemical properties of Daqu To determine the application effects of these three yeast strains, the relevant physicochemical indicators of Daqu (a type of starter culture) were tested.

[0045] Fermentation power results as follows Figure 9 As shown, adding yeast significantly enhances the fermentation power of Daqu (a type of starter culture). Among them, Daqu M7 exhibits the highest fermentation power, reaching 0.56 g / g dry starter at 3 days and 3.38 g / g dry starter at 12 days; the fermentation power of Daqu M3 gradually increases from 3 to 15 days, also rising to 3.26 g / g dry starter at 15 days; the fermentation power of Daqu M6 gradually increases with time, reaching 2.83 g / g dry starter at 27 days.

[0046] The results of glycation power are as follows Figure 10 As shown, the saccharification powers of Daqu M6 and M7 were 728.13 and 602.38 U, respectively, which were higher than the 519.52 U of the control group, indicating that the addition of M6 or M7 had no negative impact on saccharification power. In contrast, the saccharification power of M3 was 258.87 U, which was lower than the control group, indicating that the addition of M3 had a significant negative impact on saccharification power.

[0047] The esterification power results are as follows Figure 11 As shown, the esterification power of Daqu M7 was 4.04 mg / g·100h, which was higher than that of the control group (3.59 mg / g·100h), indicating that the addition of M7 had no negative impact on the esterification power. In contrast, the addition of M3 and M6 resulted in a lower esterification power of Daqu than the control, indicating that the addition of M3 and M6 had a negative impact on the esterification power.

[0048] In summary, the addition of yeast M7 can significantly improve the fermentation power of Daqu (a type of starter culture) without negatively affecting its saccharification and esterification capabilities, which also demonstrates that yeast M7 has good ecological adaptability.

[0049] (6) High-throughput sequencing of large-scale qu High-throughput sequencing technology was used to sequence the experimental and control cultures, and the fungal and bacterial communities were analyzed. The results are as follows: Figure 12 As shown.

[0050] At the fungal level, the proportion of *Saccharomyces cerevisiae* in the control koji was extremely low, while the proportion of *Saccharomyces cerevisiae* was higher in the experimental koji, especially in Daqu M7, indicating that the *Saccharomyces cerevisiae* added to the experimental koji successfully colonized and grew. Furthermore, the experimental koji reduced harmful bacteria. Penicillium The proportion of (Penicillium).

[0051] At the bacterial level, experimental samples related to flavor compound synthesis... Kroppenstedtia (Cropensi) and Bacillus The relative abundance of (Bacillus) is relatively high, especially M7, which enhances... Bacillus The proportion is the most obvious.

[0052] Based on the results of fermentation power, saccharification power, esterification power, and sequencing, yeast M7 showed the best ecological adaptability.

[0053] In summary, this study isolated a highly fermentable brewing yeast strain with good ecological adaptability and tolerance to high temperatures, acids, and ethanol. S.cerevisiae M7. Its application in the production of fortified koji (a type of starter culture) can significantly improve the fermentation power of the koji and exhibit good ecological adaptability. This invention has significant value in saving grain, improving efficiency, and reducing energy consumption and emissions; its application in enterprises can increase corporate and social benefits.

[0054] The embodiments described herein are merely preferred embodiments of the invention and are not intended to limit the concept and scope of the invention. Any modifications and improvements made by those skilled in the art to the technical solutions of the invention without departing from the design concept of the invention should fall within the protection scope of the invention. All the technical contents protected by the invention are described in the claims.

Claims

1. A brewing yeast with good ecological adaptability and the ability to improve the fermentation power of Daqu (a type of starter culture). Saccharomyces cerevisiae ), characterized in that, The brewer's yeast is a strain S. cerevisiae M7 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) on February 6, 2026, with accession number CGMCC No. 39145.

2. The superior brewing yeast according to claim 1, characterized in that, It grows well at 25-50℃.

3. The superior brewing yeast according to claim 1, characterized in that, It grows well under conditions with pH ranges of 1-9.

4. The superior brewing yeast according to claim 1, characterized in that, It grows well under conditions with ethanol content of 0-12% vol.

5. The superior brewing yeast according to claim 1, characterized in that, When applied to Daqu (a type of starter culture), it can improve the fermentation power of Daqu, without negatively affecting esterification and saccharification power, and has good ecological adaptability.

6. The application of the brewing yeast as described in any one of claims 1-5 in the production of brewing yeast and alcoholic beverages.

Images