Recombinant yarrowia lipolytica strain Ylscu-03 for producing scutellarin as well as construction method and application of recombinant yarrowia lipolytica strain Ylscu-03
By systematically modifying the metabolic structure of *Yersinia lipophila* strain, a recombinant strain Ylscu-03 was constructed. This optimized the biosynthetic pathway of scutellarin, increasing yield and reducing the proportion of byproducts. It solved the problems of low production stability and efficiency in existing technologies, and realized a highly efficient microbial fermentation method for production.
Patent Information
- Application Number
- CN202610253032.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-03
- Publication Date
- 2026-05-15
AI Technical Summary
The production capacity of scutellarin in existing technologies is low and the proportion of by-products is high, making it difficult to meet the needs of industrial production. Microbial fermentation methods also have stability and efficiency issues.
A recombinant Yersinia lipophila strain, Ylscu-03, was constructed. By introducing and modifying various genes and enzymes, including SlA-Tsynth7, SUMO-FNS I-Tsynth27, VPRHX, Pleu-Pxo-Ptef, F7GAT-Tsynth2, UDPGDH-Tsynth8, and TAL-Tsynth7, the metabolic network was optimized, and the expression of key enzymes and carbon flux flow to the target product synthesis pathway were enhanced.
After fermentation in a 5 L bioreactor for 84 h, the yield of scutellarin B reached 6407.63 mg/L, while the proportion of the byproduct scutellarin A was only 7.26%, achieving efficient and stable production and solving the problems of drug source stability and environmental protection.
Smart Images

Figure CN122038155A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and metabolic engineering, and in particular to a recombinant lipophilic yeast strain Ylscu-03 that produces ligustrazine, its construction method, and its application. Background Technology
[0002] Scutellarin, the main active ingredient of the traditional Chinese herbal medicine *Erigeron breviscapus*, has been proven to possess various pharmacological effects, including anti-inflammatory, antioxidant, antitumor, antidepressant, and improvement of cerebral ischemia-reducing properties. It is currently widely used in clinical treatment of various cardiovascular and cerebrovascular diseases. Statistical analysis indicates that over 10 million patients in China use scutellarin and related medications annually, demonstrating its broad market potential. Currently, extracting the active ingredient from *Erigeron breviscapus* remains the primary production method for scutellarin. However, the scutellarin content in *Erigeron breviscapus* is low, extraction is difficult, and the content varies significantly across different altitudes, making it challenging to guarantee the stability of commercial production. Chemical synthesis of scutellarin suffers from problems such as expensive raw materials, long reaction routes, low yields, and significant pollution, limiting its application to laboratory synthesis. In contrast, microbial fermentation using synthetic biology strategies offers a more efficient and environmentally friendly option for the sustainable production of scutellarin.
[0003] De novo synthesis of ligustrazine has been achieved in various microbial hosts. Liu et al. successfully elucidated the biosynthetic pathway of ligustrazine in *Erigeron breviscapus* and achieved its de novo synthesis using *Saccharomyces cerevisiae* as a host. By increasing the intracellular supply of acetyl-CoA and optimizing fed-batch fermentation strategies, they produced 108 mg / L of ligustrazine in a 3 L bioreactor. However, the byproduct ligustrazine A titer reached 185 mg / L, which was generated from the precursor apigenin by flavonoid-7-O-glucuronyltransferase (F7GAT). This indicates that the intracellular carbon flux of the recombinant *Saccharomyces cerevisiae* strain constructed in this study mainly flowed to the byproduct synthesis pathway rather than the target product synthesis pathway. Subsequently, Wang et al., using *Yarrowia lipolytica* as a host, significantly increased the synthesis ratio of ligustrazine by screening for the optimal flavonoid-6-hydroxylase (F6H) and integrating multiple copies of key enzyme genes. They were able to produce 94.79 mg / L of ligustrazine at the shake-flask level, accounting for 96.54% of the total yield. The yield was further improved by fed-batch fermentation, reaching 346 mg / L in a 1.3 L bioreactor. However, the final proportion of ligustrazine A also increased significantly, accounting for about 18% of the total yield, indicating that the set fermentation conditions were not very suitable for the scale-up of ligustrazine B fermentation. A recombinant Yersinia lipolytica strain producing ligustrazine B has also been reported, with a shake-flask yield of 703.01 mg / L and a byproduct ratio of 17.27%. It is evident that although existing reports have achieved the synthesis of ligustrazine B in different microbial hosts, the low yield still hinders industrial production. Therefore, it is still necessary to select a suitable microbial chassis and conduct more in-depth and systematic integrated research on the ligustrazine B synthesis pathway and the metabolic network of the host cell to rationally design efficient and stable microbial cell factories to meet the demand for high-performance engineered strains in industrial production. Furthermore, it is necessary to explore suitable fermentation processes to achieve effective scale-up of ligustrazine B fermentation, making the microbial fermentation method for producing ligustrazine B a potential industrial-scale product. Summary of the Invention
[0004] The purpose of this invention is to provide a recombinant Yersinia lipolytica strain Ylscu-03 that produces ligustrazine, its construction method and application, in order to solve the problems existing in the prior art. Ylscu-03 can produce ligustrazine at a yield of 6407.63 mg / L after fermentation for 84 h, and the byproduct ligustrazine A accounts for only 7.26% of the total yield.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a recombinant Yersinia lipolytica strain Ylscu-03 that produces ligustrazine. The recombinant Yersinia lipolytica strain Ylscu-03 is constructed by introducing SlA-Tsynth7, SUMO-FNS I-Tsynth27, VPRHX, Pleu-Pxo-Ptef, F7GAT-Tsynth2, UDPGDH-Tsynth8, and TAL-Tsynth7 into the recombinant Yersinia lipolytica engineered strain Ylscu2-00, replacing the original promoter of the yeast endogenous prebenzoic acid dehydratase gene PHA2 with the core promoter pPHA2-50, and introducing BbXFPK-Tsynth22 and BsPTA-Tsynth7.
[0007] The nucleotide sequence of SlA-Tsynth7 is shown in SEQ ID NO.1, the nucleotide sequence of SUMO-FNS I-Tsynth27 is shown in SEQ ID NO.2, the nucleotide sequence of VPRHX is shown in SEQ ID NO.3, the nucleotide sequence of Pleu-Pxo-Ptef is shown in SEQ ID NO.4, the nucleotide sequence of F7GAT-Tsynth2 is shown in SEQ ID NO.5, the nucleotide sequence of UDPGDH-Tsynth8 is shown in SEQ ID NO.6, the nucleotide sequence of pPHA2-50 is shown in SEQ ID NO.7, the nucleotide sequence of TAL-Tsynth7 is shown in SEQ ID NO.8, the nucleotide sequence of BbXFPK-Tsynth22 is shown in SEQ ID NO.9, and the nucleotide sequence of BsPTA-Tsynth7 is shown in SEQ ID NO.10.
[0008] The recombinant Yersinia lipolytica engineered strain Ylscu2-00 was constructed by integrating the TEFin-ZWF1-CYCt gene expression cassette and the FBAin-GND1-Tsynth7 gene expression cassette into the D17 site of the genome of the recombinant Yersinia lipolytica engineered strain Yl-nar13, and further integrating the TEFin-VHb-Tsynth7 gene expression cassette and the aGPD-PGM2-IGG6-UGP1-Tsynth7 gene expression cassette into the EXG2 site of the genome of the recombinant Yersinia lipolytica engineered strain Yl-nar13.
[0009] The nucleotide sequence of TEFin-ZWF1-CYCt is shown in SEQ ID NO.11, the nucleotide sequence of FBAin-GND1-Tsynth7 is shown in SEQ ID NO.12, the nucleotide sequence of TEFin-VHb-Tsynth7 is shown in SEQ ID NO.13, and the nucleotide sequence of aGPD-PGM2-IGG6-UGP1-Tsynth7 is shown in SEQ ID NO.14.
[0010] The recombinant Yersinia lipolytica engineered strain Yl-nar13 was constructed by integrating the TEFin-CHS-IGG6-CHI-Tsynth7 gene expression cassette into the ACE site and D19140 site of the genome of the Yersinia lipolytica engineered strain Yl-nar11.
[0011] The nucleotide sequence of TEFin-CHS-IGG6-CHI-Tsynth7 is shown in SEQ ID NO.15.
[0012] This invention also provides a method for constructing the recombinant Yersinia lipophila strain Ylscu-03, comprising the following steps:
[0013] Using plasmid pINA1269 as a vector, VPRHX was introduced to obtain plasmid p1269-VPRHX; pEXP1 and F7GAT-Tsynth2 were fused by PCR to obtain gene expression cassette pEXP1-F7GAT-Tsynth2, and pGPD and UDPGDH-Tsynth8 were fused by PCR to obtain gene expression cassette pGPD-UDPGDH-Tsynth8. Using plasmid p1269-VPRHX as a vector, pEXP1-F7GAT-Tsynth2 and pGPD-UDPGDH-Tsynth8 were introduced to obtain plasmid p1269-VX-FU; using plasmid p1269-VX-FU as a vector, SUMO-FNS I-Tsynth27, SlA-Tsynth7 and Pleu-Pxo-Ptef were introduced to obtain plasmid p1269-VX-FU-SFSlA.
[0014] Using plasmid pCRISPR-Cas9URA as a vector, sgRNA, the upper homologous arm fragment upPHA2, and the lower homologous arm fragment dnPHA2 were introduced to obtain plasmid pCRISPR-Cas9URA-pPHA2-50; using the plasmid pCRISPR-Cas9URA-pPHA2-50 as a vector, pGPD and TAL-Tsynth7 were introduced to obtain plasmid pCRISPR-Cas9URA-pPHA2-50-TAL;
[0015] The gene expression cassette pFBAin-BbXFPK-Tsynth22 was obtained by fusion PCR of pFBAin and BbXFPK-Tsynth22, and the gene expression cassette pEXP1-BsPTA-Tsynth7 was obtained by fusion PCR of pEXP1 and BsPTA-Tsynth7. The plasmid pINA1312 was used as a vector to introduce the pFBAin-BbXFPK-Tsynth22 and the pEXP1-BsPTA-Tsynth7 to obtain the plasmid p1312-PKPTA.
[0016] Using the recombinant Yersinia lipolytica strain Ylscu2-00 as the starting strain, the plasmid p1269-VX-FU-SFSlA was transformed into the strain Ylscu2-00, and the recombinant Yersinia lipolytica strain Ylscu-01 was obtained by culturing it in YNB-Ura-Phe solid medium.
[0017] The plasmid pCRISPR-Cas9URA-pPHA2-50-TAL was transformed into the recombinant Yersinia lipolytica strain Ylscu-01, and the recombinant Yersinia lipolytica strain Ylscu-02 was obtained by culturing it in SD-Ura solid medium.
[0018] The plasmid p1312-PKPTA was transformed into the recombinant Yersinia lipolytica strain Ylscu-02, and the recombinant Yersinia lipolytica strain Ylscu-03 was obtained by culturing it in SD-Ura solid medium.
[0019] The nucleotide sequence of pEXP1 is shown in SEQ ID NO.16, the nucleotide sequence of pGPD is shown in SEQ ID NO.17, the nucleotide sequence of sgRNA is shown in SEQ ID NO.18, the nucleotide sequence of the upper homologous arm fragment upPHA2 is shown in SEQ ID NO.19, the nucleotide sequence of the lower homologous arm fragment dnPHA2 is shown in SEQ ID NO.20, and the nucleotide sequence of pFBAin is shown in SEQ ID NO.21.
[0020] Optionally, the YNB-Ura-Phe solid culture medium consists of 6.7 g / L YNB, 10 g / L glucose, 20 g / L agar, 0.5 g / L uracil, and 0.5 g / L phenylalanine.
[0021] The SD-Ura solid medium consists of 6.7 g / L YNB, 20 g / L glucose, 20 g / L agar, and 1.29 g / L DO Supplement-Ura.
[0022] Optionally, before transforming the plasmid p1312-PKPTA into the recombinant Yersinia lipolytica strain Ylscu-02, the method further includes culturing the recombinant Yersinia lipolytica strain Ylscu-02 in 5-FOA solid medium to lose the plasmid pCRISPR-Cas9URA-pPHA2-50-TAL.
[0023] The 5-FOA solid medium consists of 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid and 20 g / L agar.
[0024] The present invention also provides the application of the recombinant Yersinia lipophila strain Ylscu-03 in the production of scutellarin.
[0025] The present invention also provides a method for producing strychnine, comprising the step of fermentation using the recombinant Yersinia lipophila strain Ylscu-03.
[0026] Optionally, a single colony of activated recombinant Yersinia lipolytica strain Ylscu-03 is selected and inoculated into YPD liquid medium for culture as a primary seed culture. The primary seed culture is then transferred to YPD liquid medium for culture as a secondary seed culture. The secondary seed culture is then inoculated into a 5 L bioreactor for fermentation to produce scutellarin.
[0027] Optionally, the inoculum size of the secondary seed culture is 10%, the fermentation medium is a fermentation medium, the temperature is 30℃, the aeration rate is 2 L / min, and the pH is 7.0.
[0028] The fermentation medium consists of 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and 10 g / L corn steep liquor powder.
[0029] Alternatively, xylose with a final concentration of 4 g / L can be added at 12 h of fermentation for induction. When the residual sugar concentration in the fermentation broth is below 2 g / L, fed medium can be added to control the residual sugar concentration at 1.0~1.5 g / L.
[0030] Optionally, the fed culture medium consists of 600 g / L glucose, 25 g / L peptone, 55 g / L yeast extract, 9 g / L diammonium hydrogen phosphate, 10 g / L corn steep liquor powder, 2 g / L phenylalanine, and 1 g / L vitamin C.
[0031] The present invention discloses the following technical effects:
[0032] This invention constructs a highly efficient biosynthetic pathway for scutellarin based on the previously constructed high-yield recombinant lipolytic yeast strain Ylscu2-00: By fusion expression (SlA) of the key enzyme SbF6H and the N-terminus 74tATR2 (74 amino acids truncated), the SbF6H enzyme activity was enhanced, resulting in a 12.57% increase in scutellarin yield. Subsequently, the SUMO fusion tag was added to the N-terminus of the key enzyme FNS I to increase FNS I expression, resulting in a 44.33% increase in scutellarin yield. Furthermore, the xylose-induced activation system VPRHX and the bidirectional inducible promoter Pleu-Pxo-Ptef were introduced to synergistically enhance the key gene SUMO-FNS. The expression levels of I and SlA were increased to promote a greater carbon flux to the target product synthesis pathway, resulting in a 31.43% increase in scutellarin production. Next, by replacing the original promoter of the PHA2 gene in the recombinant bacterial genome with the core promoter pPHA2-50, the phenylalanine synthesis pathway was weakened, allowing a greater carbon flux to flow to the precursor tyrosine synthesis pathway. Furthermore, overexpression of the TAL gene promoted the conversion of tyrosine to p-coumaric acid, resulting in an 86.90% increase in scutellarin production. Finally, the introduction of the BbXFPK-Tsynth22 and BsPTA-Tsynth7 genes remodeled the intracellular metabolic network of *Yarrowia lipolytica*, effectively enhancing the supply of the precursor erythrosine 4-phosphate, resulting in a scutellarin production of 1184.24 mg / L after 72 h of shake-flask fermentation. Ultimately, after 84 hours of fed-batch fermentation in a 5 L bioreactor, the yield of scutellarin reached 6407.63 mg / L, which is the highest known yield produced through microbial fermentation. Furthermore, the byproduct scutellarin A accounted for only 7.26% of the total yield. This invention utilizes engineered strains of *Yarrowia lipolytica* to produce scutellarin, effectively solving the problem of stable drug supply and offering advantages such as saving plant resources, protecting the environment, and promoting a green economy. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0034] Figure 1 To investigate the biosynthetic pathway and metabolic engineering strategy of scutellarin in recombinant Yersinia lipophila strain Ylscu-03;
[0035] Figure 2 To determine the yields of scutellarin B and scutellarin A by shake-flask fermentation of different recombinant Yersinia lipophila strains;
[0036] Figure 3 To determine the yield and growth of scutellarin B and scutellarin A in a 5 L bioreactor fed batch fermentation of recombinant Ylscu-03 lipophilic yeast strain Ylscu-03.
[0037] Figure 4 This is a mass spectrometry image for identifying the target product, scutellarin, in the fermentation broth sample. Detailed Implementation
[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0043] YNB-Ura-Phe solid medium: 6.7 g / L YNB, 10 g / L glucose, 20 g / L agar, 0.5 g / L uracil and 0.5 g / L phenylalanine.
[0044] SD-Ura solid medium: 6.7 g / L YNB, 20 g / L glucose, 20 g / L agar and 1.29 g / L DOSupplement-Ura.
[0045] 5-FOA solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid and 20 g / L agar.
[0046] YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 20 g / L agar.
[0047] YPD liquid medium: 20 g / L glucose, 20 g / L peptone and 10 g / L yeast extract.
[0048] Nitrogen source-based liquid culture medium: 40 g / L glucose, 4 g / L xylose, 8 g / L peptone, 10 g / L yeast extract, 7.4 g / L diammonium hydrogen phosphate, 3 g / L corn steep liquor powder, and 1 g / L vitamin C.
[0049] Fermentation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 10 g / L corn steep liquor powder.
[0050] Feeding medium: 600 g / L glucose, 25 g / L peptone, 55 g / L yeast extract, 9 g / L diammonium hydrogen phosphate, 10 g / L corn steep liquor powder, 2 g / L phenylalanine and 1 g / L vitamin C.
[0051] Genes VPRHX, F7GAT-Tsynth2, UDPGDH-Tsynth8, SlA-Tsynth7, SUMO-FNS I-Tsynth27, sgRNA, TAL-Tsynth7, BbXFPK-Tsynth22, and BsPTA-Tsynth7 were codon-optimized and synthesized by Shanghai Ruimian Biotechnology Co., Ltd.; Phanta Max Super-Fidelity DNA Polymerase and 2 × Rapid Taq Master Mix were purchased from Nanjing Novizan Biotechnology Co., Ltd.; DNA gel rapid purification kit, PCR purification kit, and pEASY were also provided. ®-The Basic Seamless Cloning and Assembly Kit for homologous recombination was purchased from Beijing TransGen Biotech Co., Ltd.; the ZYMO Frozen-EZ Yeast Transformation II Kit was purchased from Shanghai GeneRan Biotechnology Co., Ltd.; all restriction endonucleases were purchased from BioRi Biotech (Beijing) Co., Ltd.; and the plasmid miniaturization kit was purchased from Shanghai Jereh Biotechnology Co., Ltd.
[0052] Qualitative and quantitative detection methods of the products: The yields of scutellarin B and scutellarin A in the fermentation broth were determined using a high-performance liquid chromatography (Prominence-I LC2030, Shimadzu). Specifically, a reversed-phase Diamonsil C18(2) column (5 μm, 150 × 4.6 mm) and a UV-Vis detector were used for detection, and UV absorption was detected at 289 nm. The column oven was set to 40℃, the flow rate was set to 1.0 mL / min, and the injection volume was 10 µL. Phase A was 20 mM ammonium formate solution (the pH of the solution was adjusted to 3 using formic acid), and phase B was acetonitrile. The gradient elution program for 20 minutes was as follows: 0-0.05 min, maintain 2% B; 0.05-10 min, increase B from 2% to 40%; 10-15 min, decrease B from 40% to 20%; 15-18 min, decrease B from 20% to 2%; 18-20 min, maintain 2% B. High-resolution mass spectrometry analysis of the samples was performed using a Thermo Scientific Q Exactive Orbitrap mass spectrometer connected to a Shimazu LC-30AD UPLC equipped with a C18 column (2.1 × 100 mm, 1.7 μm) and monitored in positive ion mode.
[0053] The starting strain used in this invention is the recombinant Yersinia lipolytica engineered strain Ylscu2-00, which is an engineered strain obtained by integrating the TEFin-ZWF1-CYCt (SEQ ID NO.11) and FBAin-GND1-Tsynth7 (SEQ ID NO.12) gene expression cassettes into the D17 site of the genome of the high-producing naringenin Yersinia lipolytica engineered strain Yl-nar13, and further integrating the TEFin-VHb-Tsynth7 (SEQ ID NO.13) and aGPD-PGM2-IGG6-UGP1-Tsynth7 (SEQ ID NO.14) gene expression cassettes into the EXG2 site of the Yl-nar13 genome. Among them, the Yarrowia lipolytica engineered strain Yl-nar13 is an engineered strain obtained by integrating the TEFin-CHS-IGG6-CHI-Tsynth7 gene expression cassette (SEQ ID NO.15) into the ACE site and D19140 site of the Yarrowia lipolytica engineered strain Yl-nar11 genome. The Yarrowia lipolytica engineered strain Yl-nar11 has been published in the literature Yuxing Dong, Wenping Wei, Mengfan Li, Tao Qian, Jiayun Xu, Xiaohe Chu, Bang-Ce Ye, De novo biosynthesis of quercetin in Yarrowia Lipolytica through systematic metabolic engineering for enhanced yield, Bioresources and Bioprocessing, 2025, 12(1): 1-10., and was provided by the Laboratory of Microanalysis and Biosystems Engineering, East China University of Science and Technology.
[0054] like Figure 1As shown, this invention combines multiple modification strategies to systematically modify the recombinant Yersinia lipolytica strain Ylscu2-00 through metabolic engineering. This includes introducing a fusion expression module SbF6H-linker-74tATR2 (SlA) of the flavonoid-6-hydroxylase gene SbF6H and the P450 reductase gene ATR2, and modifying the flavonoid synthase gene FNS... The N-terminus of I is fused with the solubilizing tag SUMO, and the xylose-inducible activation system VPRHX and the bidirectional inducible promoter Pleu-Pxo-Ptef are introduced to synergistically enhance the expression levels of key genes SUMO-FNSI and SlA. The flavonoid-7-O-glucuronidase gene F7GAT-Tsynth2 and the UDP-glucose dehydrogenase gene UDPGDH-Tsynth8 are expressed to achieve the synthesis of scutellarin. The original promoter of the prebenzoic acid dehydratase gene PHA2 in the recombinant bacterial genome is replaced with the core promoter pPHA2-50. The tyrosine ammonia-lyase gene TAL is overexpressed, and the phosphoketonease gene (BbXFPK) from Bifidobacterium bifidum and the phosphoacetyltransferase gene (BsPTA) from Bacillus subtilis are introduced. The recombinant Yersinia lipolytica strain Ylscu-03, after 84 h of fed-batch fermentation, produced 6407.63 mg / L of ligustrazine, which is the highest known yield produced by microbial fermentation. The yield of the byproduct ligustrazine A was only 501.45 mg / L, accounting for only 7.26% of the total yield, indicating that strain Ylscu-03 is the dominant strain for producing ligustrazine.
[0055] Example 1 Construction of recombinant plasmid
[0056] The nucleotide sequences of the fusion expression modules SlA-Tsynth7 are shown in SEQ ID NO.1; the nucleotide sequences of SUMO-FNSI-Tsynth27 are shown in SEQ ID NO.2; the nucleotide sequences of VPRHX are shown in SEQ ID NO.3; the nucleotide sequences of Pleu-Pxo-Ptef are shown in SEQ ID NO.4; the nucleotide sequences of F7GAT-Tsynth2 are shown in SEQ ID NO.5; the nucleotide sequences of UDPGDH-Tsynth8 are shown in SEQ ID NO.6; the nucleotide sequences of the promoter pPHA2-50 are shown in SEQ ID NO.7; the nucleotide sequences of TAL-Tsynth7 are shown in SEQ ID NO.8; the nucleotide sequences of BbXFPK-Tsynth22 are shown in SEQ ID NO.9; and the nucleotide sequences of BsPTA-Tsynth7 are shown in SEQ ID NO.10.
[0057] The nucleotide sequence of pEXP1 is shown in SEQ ID NO.16, the nucleotide sequence of pGPD is shown in SEQ ID NO.17, the nucleotide sequence of sgRNA is shown in SEQ ID NO.18, the nucleotide sequence of the upper homologous arm fragment upPHA2 is shown in SEQ ID NO.19, the nucleotide sequence of the lower homologous arm fragment dnPHA2 is shown in SEQ ID NO.20, and the nucleotide sequence of pFBAin is shown in SEQ ID NO.21.
[0058] Extraction of the genome of the original Yeast lipolyticis strain: Take an appropriate amount of bacterial culture and mix it in 20 µL of 20 mM NaOH solution by pipetting. Place it on a vortex shaker and shake for 10 min to lyse the yeast cells. Take 3 µL of the lysate as the genome template.
[0059] The VRHX gene fragment was amplified using primers VRHX-F and VRHX-R, and then homologously recombined with the plasmid vector pINA1269 (containing the promoter hp4d, terminator XPR2t, and LEU2 selection markers) linearized with restriction endonucleases PmlI and KpnI to obtain plasmid p1269-VPRHX.
[0060] Using the *Yarrowia lipolyticis* genome as a template, the endogenous promoters pEXP1 and pGPD were amplified using primers pEXP1-F / R and pGPD-F / R, respectively. Gene fragments F7GAT-Tsynth2 and UDPGDH-Tsynth8 were amplified using primers F7GAT-F / R and UDPGDH-F / R, respectively. The gene expression cassettes pEXP1-F7GAT-Tsynth2 and pGPD-UDPGDH-Tsynth8 were obtained by fusion PCR and then homologously recombinated with the plasmid vector p1269-VPRHX, which was linearized with the restriction endonuclease SpeI, to obtain the plasmid p1269-VX-FU.
[0061] Using the *Yarrowia lipolyticis* genome as a template, the gene fragment SUMO was amplified using primers SUMO-F / R. The gene fragment FNS I-Tsynth27 was amplified using primers FNS IF / R, and SUMO was fused with FNS I-Tsynth27 by PCR to obtain the gene fragment SUMO-FNS I-Tsynth27. The gene fragment SlA-Tsynth7 was amplified using primers SlA-F / R, and the bidirectional inducible promoter Pleu-Pxo-Ptef was amplified using primers Pleu-Pxo-Ptef-F / R. The gene fragments SUMO-FNS I-Tsynth27, SlA-Tsynth7, and Pleu-Pxo-Ptef were homologously recombinated with the plasmid vector p1269-VX-FU, which had been linearized with the restriction endonuclease NotI, to obtain the plasmid p1269-VX-FU-SFSlA.
[0062] Using the *Yarrowia lipolyticis* genome as a template, the upper homologous arm fragment upPHA2 (1000 bp upstream of the original 500 bp promoter sequence) of the PHA2 gene was amplified using primers upPHA2-F / R, and the lower homologous arm fragment dnPHA2 (1000 bp downstream of the original 500 bp promoter sequence) of the PHA2 gene was amplified using primers dnPHA2-F / R. The sgRNA fragment (as shown in SEQ ID NO. 13), upPHA2, and dnPHA2 were ligated via homologous recombination into the linearized plasmid vector pCRISPR-Cas9URA with restriction endonucleases SacII and NotI to obtain plasmid pCRISPR-Cas9URA-pPHA2-50.
[0063] The gene fragment TAL-Tsynth7 was amplified using primers TAL-F / R, and then homologously recombined with pGPD and the plasmid vector pCRISPR-Cas9URA-pPHA2-50, which was linearized with restriction endonuclease SpeI, to obtain the plasmid pCRISPR-Cas9URA-pPHA2-50-TAL.
[0064] Using the *Yarrowia lipolyticis* genome as a template, the endogenous promoter pFBAin was amplified using primers pFBAin-F / R. Gene fragments BbXFPK-Tsynth22 and BsPTA-Tsynth7 were amplified using primers BbXFPK-F / R and BsPTA-F / R, respectively. Gene expression cassettes pFBAin-BbXFPK-Tsynth22 and pEXP1-BsPTA-Tsynth7 were obtained by fusion PCR, and homologous recombination was performed with the linearized plasmid vector pINA1312 (containing the promoter hp4d, the terminator XPR2t, and the URA3 selection marker) using restriction endonucleases SalI and StUI to obtain the plasmid p1312-PKPTA.
[0065] Gene fragment amplification was performed using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase. The PCR system and procedure were performed according to the manufacturer's instructions, and the target fragment was recovered from the gel using a DNA gel purification kit. Homologous recombination was performed using the pEASY (simplified, seamless cloning assembly kit). ® - Use the Basic Seamless Cloning and Assembly Kit and construct and transform plasmids according to the instructions. After obtaining the correct clone, use the plasmid miniaturization kit to extract and prepare the plasmids according to the instructions.
[0066] SEQ ID NO.1 (SlA-Tsynth7):
[0067]
[0068] SEQ ID NO.2(SUMO-FNS I-Tsynth27):
[0069]
[0070] SEQ ID NO.3(VPRHX):
[0071]
[0072] SEQ ID NO.4 (Pleu-Pxo-Ptef):
[0073] tttgaatgattcttatactcagaaggaaatgcttaacgatttcgggtgtgagttgacaaggagagagagaaaagaagagaaaggtaattcggggacggtcttttatacccttggctcagggaaaaacaattttgacagatttttatctttcgattacgatttttggttatttcttgatttgaccgagatcttacttttgttgcgcaattgtacttattgcatttttc tcttcgaggaattacccagtttcatcattccatttttttgcgagcgagcgcacacttgtgaattatctcaatagcagtgtgaaataacataattgagcaactgaagggagtgcccaatattacgcatgcactgatcacgggcaaaagtgcgtatatatacaagagcgtttgccagccacagattttcactccacacaccacatcacacatacaaccacacacatccacgtg;
[0074] SEQ ID NO.5 (F7GAT-Tsynth2):
[0075]
[0076] SEQ ID NO.6(UDPGDH-Tsynth8):
[0077]
[0078] SEQ ID NO.7(pPHA2-50):
[0079] tggcgttcattagtcacaggcacacttgatcacacacattacacatcacc;
[0080] SEQ ID NO.8(TAL-Tsynth7):
[0081]
[0082] SEQ ID NO.9(BbXFPK-Tsynth22):
[0083]
[0084] SEQ ID NO.10 (BsPTA-Tsynth7):
[0085]
[0086] SEQ ID NO.11 (TEFin-ZWF1-CYCt):
[0087]
[0088] SEQ ID NO.12 (FBAin-GND1-Tsynth7):
[0089]
[0090] SEQ ID NO.13(TEFin-VHb-Tsynth7):
[0091]
[0092] SEQ ID NO.14 (aGPD-PGM2-IGG6-UGP1-Tsynth7):
[0093]
[0094] SEQ ID NO.15(TEFin-CHS-IGG6-CHI-Tsynth7:
[0095]
[0096] SEQ ID NO.16(pEXP1):
[0097]
[0098] SEQ ID NO.17(pGPD):
[0099] ggttgaaatgaatcggccgacgctcggtagtcggaaagagccgggaccggccggcgagcataaaccggacgcagtaggatgtcctgcacgggtctttttgtggggtgtggagaaaggggtgcttggagatggaagccggtagaaccgggctgcttggggggatttggggccgctgggctccaaagaggggtaggcatttcgttggggttacgtaattgcggcatttgggtcctgcgcgcatgtcccattggtcagaattagtccggataggagacttatcagccaatcacagcgccggatccacctgtaggttgggttgggtgggagcacccctccacagagtagagtcaaacagcagcagcaacatgatagttgggggtgtgcgtgttaaaggaaaaaaaaagaagcttgggttatattcccgctctatttagaggttgcgggatagacgccgacggagggcaatggcgccatggaaccttgcggatatcgatacgccgcggcggactgcgtccgaaccagctccagcagcgttttttccgggccattgagccgactgcgaccccgccaacgtgtcttggcccacgcactcatgtcatgttggtgttgggaggccactttttaagtagcacaaggcacctagctcgcagcaaggtgtccgaaccaaagaagcggctgcagtggtgcaaacggggcggaaacggcgggaaaaagccacgggggcacgaattgaggcacgccctcgaatttgagacgagtcacggccccattcgcccgcgcaatggctcgccaacgcccggtcttttgcaccacatcaggttaccccaagccaaacctttgtgttaaaaagcttaacatattataccgaacgtaggtttgggcgggcttgctccgtctgtccaaggcaacatttatataagggtctgcatcgccggctcaattgaatcttttttcttcttctcttctctatattcattcttgaattaaacacacatcaaca;
[0100] SEQ ID NO.18(sgRNA):gatattacctgccatcacaa;
[0101] SEQ ID NO.19(upPHA2):
[0102] tctgccaatgcatccacccaggctgacgttctggctcgataccaggataagctgaagcagaaggctgccgccgagggcgtggagtctgttgacgagctcaaggagaagcttgctccagagattgaggctactctcaagaagctcaatgagtctgatcctctcgccaaggtgctggaacaggcctggagtgaaaaaaagacgatccttgaagagggaggagaggaggccaagactctgactgagaagcttggcgaggttccccccgttccgaagaacgagctcaagaacctcgacagcttcgtcaagctggacaagtttaaggaacttggaaagcaagaaattgagttcctgtggagagcccgacatattaacaacgagcgcgctctgtgtgctgtcgttgacccccagctcttctacaagatgttcctcaatggccgaaagcaccccatgttcgttctgccactgcccaagggagacgagggatgtgagatgcacattgtgcagtggaactttgttggagagcacctgacccacgtcatcttcaccactctggccgagttcaagctccaccaggacttcgctagaccccatacaactctcatgttccacactgaccttgctgctgacaaggactgtgttcttctgaatggtcaggtcgagaaggactctgccatgtctctccaggatgcccagttccttatcctggctctccaggagttctacggagctaccatcaccgacccagagaccacaaagcgacgacaagctcttctgcagtccttcacagagggctccgacaacttccccatcgatatggtgatcgaggagattgaggctttcaccaagtgaccattgtagatagaagtacatactgaattgatagacgtacatactgtaagtgtgcgaatgaactgttgttgtgtaccttgcgatctactgaagaccatataaagacataaagacgagattaattaatataactggcactacaattgactgg;
[0103] SEQ ID NO.20(dnPHA2):
[0104] tggcgttcattagtcacaggcacacttgatcacacacattacacatcaccatgacaaccacagaggaaatcgcctttctcggaccgttatacacgtattcacacgcagccgcaaaacagtaccaggatactctggcagtgcccacgaccctgcgaccggccaaatcaatcgaagagtgtttccagctactggactcgggagaagtcaagctggcggtcgtgccgtttgaaaactccactaacggatcggttgtttggacactagactttctgcgacaacggcttctcggcgacgactacttctactctgcgactgccgagctgctggttcccgtgagccactgtttcttctccaatgttagtgacaaaaaggacatcaccaaaatttactcacaccctcaggtctggggccagtgcgtcgaattcctcaaacagtaccccaatgtcgagcggatcgacgtggcaagtaccgccaaggcagctgagctggctgccaatgaaccaaacgcaggagctatcagctcggaaatggccggagcagctgctggcatcaagctggtggagaccaacattgcagacaagaaaaacaataccacccggttcctgggccttagtagtctcgatgacgtgcagaacccaccacctacaaaggacgatctgtccctcatctccttcaccaccactcacaacaaccccggagctctgtgtgcagttttggaggagttccgaaagcacgacattgatctgagcagtatcaactcgcgaccgtcgctacaggactcgtggcactacatctttttcgtcgaatgccgagcccacgtcagcgaagaacgcatgaaaaataccctcaaggccatggaaagcatctgctcttctctgacggtgatcggatccttccccagatgtcctggcagagacgcttagacggttcagcgtttctgtctaggtgaattatgctcaaatgaagcacaataagcgaagcgctcgtactacaagtacag;
[0105] SEQ ID NO.21(pFBAin):
[0106] cagtgtacgcagtactatagaggaacaattgccccggagaagacggccaggccgcctagatgacaaattcaacaactcacagctgactttctgccattgccactaggggggggcctttttatatggccaagccaagctctccacgtcggttgggctgcacccaacaataaatgggtagggttgcaccaacaaagggatgggatggggggtagaagatacgaggataacggggctcaatggcacaaataagaacgaatactgccattaagactcgtgatccagcgactgacaccattgcatcatctaagggcctcaaaactacctcggaactgctgcgctgatctggacaccacagaggttccgagcactttaggttgcaccaaatgtcccaccaggtgcaggcagaaaacgctggaacagcgtgtacagtttgtcttagcaaaaagtgaaggcgctgaggtcgagcagggtggtgtgacttgttatagcctttagagctgcgaaagcgcgtatggatttggctcatcaggccagattgagggtctgtggacacatgtcatgttagtgtacttcaatcgccccctggatatagccccgacaataggccgtggcctcatttttttgccttccgcacatttccattgctcggtacccacaccttgcttctcctgcacttgccaaccttaatactggtttacattgaccaacatcttacaagcggggggcttgtctagggtatatataaacagtggctctcccaatcggttgccagtctcttttttcctttctttccccacagattcgaaatctaaactacacatcacacaatgcctgttactgacgtccttaagcgaaagtccggtgtcatcgtcggcgacgatgtccgagccgtgagtatccacgacaagatcagtgtcgagacgacgcgttttgtgtaatgacacaatccgaaagtcgctagcaacacacactctctacacaaactaacccagctctcc;
[0107] The primer sequences used are as follows:
[0108] VPRHX-F: 5′-acatcacacatacaaccacacacatccacgtgatggactacaaggacgacgacgacaag-3′, SEQ ID NO.22;
[0109] VPRHX-R: 5′-gcaacgtggggacaggccatggaggtaccttacaacatgacctcgctatttacatcgcg-3′, SEQ ID NO.23;
[0110] pEXP1-F: 5′-aggagtttggcgcccgttttttcgag-3′, SEQ ID NO.24;
[0111] pEXP1-R: 5′-ccaacccccttacacacaagacatatctacagca-3′, SEQ ID NO.25;
[0112] pGPD-F: 5′-ggttgaaatgaatcggccgacgctcg-3′, SEQ ID NO.26;
[0113] pGPD-R: 5′-tgttgatgtgtgtttaattcaagaatgaatatagagaagaga-3′, SEQ ID NO.27;
[0114] F7GAT-F: 5′-cccccttacacacaagacatatctacagcaatggagaacatcgtcgtgatgttcccct-3′, SEQ ID NO.28;
[0115] F7GAT-R: 5′-caccgaaacgcgcgaggcagcagatccactagtgggcccgggatccgaattctttgaa-3′, SEQ ID NO.29;
[0116] UDPGDH-F: 5′-tattcattcttgaattaaacacacatcaacaatggtgaagatctgttgtatcggcgcc-3′, SEQ ID NO.30;
[0117] UDPGDH-R:5′-gccgcataggccactagtgctatgaccatgattacgccaagcttt-3′,SEQ IDNO.31;
[0118] SUMO-F:5′-cacatcacacacaaccacacacatccacgtgatgtctgaggaaacacagcccaaggt-3′,SEQ ID NO.32;
[0119] SUMO-R:5′-cggtgatggtggtaggggcggatccagaggatccgcagccagctgctcctggtga-3′,SEQ ID NO.33;
[0120] FNS IF:5′-cttggtggctgcggatcctctggatccgccctaccaccatcaccgccctg-3′,SEQID NO.34;
[0121] FNS IR:5′-atgagctttaccgcagcagatccgcggcccgggcccgggatccttgaaagatgatac-3′,SEQ ID NO.35;
[0122] SlA-F:5′-gcatttccttctgagtataagaatcattcaaaatggagctgtcctctgtcatctacggt-3′,SEQ ID NO.36;
[0123] SlA-R:5′-tggtcatagcactagtggcctat gcggcccgggcccgggatccttgaaaaaatttat-3′,SEQ ID NO.37;
[0124] Pleu-Pxo-Ptef-F:5′-cacgtggatgtgtgtggttgtatgtgtgtgtg-3′,SEQ ID NO.38;
[0125] Pleu-Pxo-Ptef-R:5′-tttgaatgattcttatactcagaaggaaatgcttaacg-3′,SEQ IDNO.39;
[0126] upPHA2-F:5′-aatttttcttttttttctgtacagacgcgtccgcggtctgccaatgcatccacccaggc-3′,SEQ ID NO.40;
[0127] upPHA2-R:5′-gactaatgaacgccaactagtccagtcaattgtagtgccagttatattaattaatctcg-3′,SEQ ID NO.41;
[0128] dnPHA2-F:5′-cactacaattgactggactagttggcgttcattagtcacaggcacacttg-3′,SEQID NO.42;
[0129] dnPHA2-R:5′-gatctagagttgtgtcaacttttgcaactgggctgtacttgtagtacgagcgcttcgct-3′,SEQ ID NO.43;
[0130] TAL-F:5′-ctatattcattcttgaattaaacacacatcaacaatggctcctcgacctacttcgcag-3′,SEQ ID NO.44;
[0131] TAL-R:5′-ttgaaaaaatttatttctagacagttatatactaggcaagcatcttaagaagcacgttg-3′,SEQ ID NO.45;
[0132] pFBAin-F:5′-gctcgaaaaaacgggcgccaaactcctcagtgtacgcagtactatagaggaacaattgc-3′,SEQ ID NO.46;
[0133] pFBAin-R:5′-aggagttccaatgacgggagaggtcatggagagctgggttagtttgtgtagagagtgt-3′,SEQ ID NO.47;
[0134] BbXFPK-F:5′-acactctctacacaaactaacccagctctccatgacctctcccgtcattggaactcct-3′,SEQ ID NO.48;
[0135] BbXFPK-R: 5′-caaagcactttgctagatagagtcgaccctttgaaagatgatactctttatttctagac-3′, SEQ ID NO.49;
[0136] BsPTA-F: 5′-aacccccttacacacaagacatatctacagcaatggctgacctgttctctaccgtgca-3′, SEQ ID NO.50;
[0137] BsPTA-R: 5′-gaccaagctctgtacaccgagaaacaggcctgggcccgggatcctttgaaaaaatttat-3′, SEQ ID NO. 51.
[0138] Example 2 Yeast transformation of recombinant plasmids
[0139] The free plasmid pCRISPR-Cas9URA-pPHA2-50-TAL, used for genome integration, can be directly transformed into yeast.
[0140] The integrated plasmid p1269-VX-FU-SFSlA needs to be linearized by restriction endonuclease BsrGI before transformation. The digestion system (200 μL) consists of 180 μL plasmid, 20 μL buffer, and 3 μL restriction endonuclease BsrGI. The system is incubated at 37°C for 4 h. After digestion, the digested plasmid is purified and recovered using a PCR purification kit according to the manufacturer's instructions.
[0141] The integrative plasmid p1312-PKPTA needs to be linearized by restriction endonuclease NotI before transformation. The digestion system (200 μL) consists of 140 μL plasmid, 20 μL each of 0.1% BSA, 10×H Buffer, and 0.1% Triton, and 3 μL of restriction endonuclease NotI. The mixture is incubated at 37°C for 4 h. After digestion, the digested plasmid is purified and recovered using a PCR purification kit according to the manufacturer's instructions.
[0142] The plasmid was transformed into *Yersinia lipolytica* using the ZYMO Frozen-EZ Yeast Transformation II Kit. An appropriate amount of the yeast culture to be transformed was inoculated into 5 mL of YPD liquid medium and cultured in a shaker at 220 rpm and 30°C for 24 h as the seed culture. 400–1000 µL of the seed culture was transferred to a 1.5 mL centrifuge tube, centrifuged at 6000 rpm for 2 min, and the supernatant was discarded. The precipitate was resuspended in 500 µL of Solution I solution, allowed to stand at room temperature for 5–30 min, centrifuged at 6000 rpm for 2 min, and the supernatant was discarded. The precipitate was resuspended in 50 µL of Solution II solution. Then, 500 µL of Solution III solution and 0.2–1 µg of plasmid (volume less than 10 µL) were added, mixed thoroughly, and incubated in a 30°C water bath for 2–3 h. Four times the volume (2 mL) of YPD liquid medium was added to the transformed mixture, and the mixture was cultured in a shaker at 30°C for 2 h. Centrifuge the cells to precipitate the precipitate, discard the supernatant, wash the precipitate twice with 2 mL of sterile water, and finally resuspend the precipitate in 500 µL or less of sterile water and spread it onto solid culture medium for screening. Incubate the plates at 30°C for 3–6 days to obtain colonies, and use 2 × Rapid Taq Master Mix for colony PCR identification to screen for successfully integrated recombinant yeast strains.
[0143] Following the above method, plasmid p1269-VX-FU-SFSlA was transformed into the engineered *Yersinia lipolytica* strain Ylscu2-00 and cultured on YNB-Ura-Phe solid medium to obtain the recombinant *Yersinia lipolytica* strain Ylscu-01. Plasmid pCRISPR-Cas9URA-pPHA2-50-TAL was transformed into the recombinant *Yersinia lipolytica* strain Ylscu-01 and cultured on SD-Ura solid medium to obtain the recombinant *Yersinia lipolytica* strain Ylscu-02 (lacking the selection marker gene URA3). Strain Ylscu-02 was cultured on 5-FOA solid medium to lose plasmid pCRISPR-Cas9URA-pPHA2-50-TAL. Plasmid p1312-PKPTA was transformed into the recombinant *Yersinia lipolytica* strain Ylscu-02 and cultured on SD-Ura solid medium to obtain the recombinant *Yersinia lipolytica* strain Ylscu-03.
[0144] Example 3 Screening and Identification of Recombinant Yersinia Lipolytica Strains
[0145] The example of obtaining strain Ylscu-02 is obtained by transforming the plasmid pCRISPR-Cas9URA-pPHA2-50-TAL into the recombinant Yersinia lipophila strain Ylscu-01.
[0146] Genomic PCR was performed on single yeast colonies grown on SD-Ura solid medium to screen for successfully integrated recombinant Yersinia lipolytica strain Ylscu-02. A small number of single colonies were picked and placed in 20 μL of 20 mM NaOH solution and vortexed vigorously for 10 min to promote cell lysis. The PCR reaction system consisted of 3 μL of lysed bacterial solution, 1 μL of upstream validation primer gene-F, 1 μL of downstream validation primer gene-R, 10 μL of 2×Rapid Taq Master, and 5 μL of ultrapure water. The PCR reaction program was as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s; annealing at 60℃ for 20 s; extension at 72℃ for 63 s (15 s / Kb); 33 cycles; extension at 72℃ for 5 min; and storage at 10℃ for 5 min. After the PCR program, nucleic acid electrophoresis was performed to verify the correct band size. The presence of the target band (4200 bp) was considered a preliminary confirmation of successful integration.
[0147] gene-F: 5′-caatgggctcgtcctgatatcggacgaac-3′, SEQ ID NO.52;
[0148] gene-R: 5′-gatcaagtgtgcctgtgactaatgaacgcca-3′, SEQ ID NO. 53.
[0149] Preliminarily verified positive clones were inoculated into 1 mL of YPD liquid medium and cultured for 24 h. A small amount of bacterial culture was streaked onto 5-FOA solid medium and incubated at 30°C for 48 h. The above steps were repeated to perform genomic PCR verification on the resulting single colonies. PCR products with the target band were sent to Shanghai Saiheng Biotechnology Co., Ltd. for sequencing, and sequence alignment was used to verify whether positive transformants with successful integration of the target gene were obtained. Successfully integrated strains were inoculated into 1 mL of YPD liquid medium and cultured for 24 h. A small amount of bacterial culture was streaked onto SD-Ura solid medium and incubated at 30°C for 3 days. If no colonies grew, the selection marker gene URA3 was considered to have been successfully lost. If colonies still grew, a small amount of bacterial culture was streaked onto 5-FOA solid medium again, and the above operation was repeated until newly picked colonies could not grow on SD-Ura solid medium. The strain that successfully integrated and lost the selection marker gene was named Ylscu-02.
[0150] Following the above steps for screening, without the need for plasmid loss, the preliminarily verified positive clones were inoculated into 1 mL of YPD liquid medium and cultured for 24 h. A small amount of bacterial culture was streaked onto YPD solid medium and incubated at 30℃ for 48 h. The single colonies that grew were then verified by genomic PCR following the above steps. The PCR products with the target band were sent to Shanghai Saiheng Biotechnology Co., Ltd. for sequencing until the sequence was verified to be correct through sequence alignment, thus obtaining the recombinant Yersinia lipolytica strain Ylscu-01.
[0151] Following the above steps for screening, without the need for plasmid loss, the preliminarily verified positive clones were inoculated into 1 mL of YPD liquid medium and cultured for 24 h. A small amount of bacterial culture was streaked onto YPD solid medium and incubated at 30℃ for 48 h. The single colonies that grew were then verified by genomic PCR following the above steps. The PCR products with the target band were sent to Shanghai Saiheng Biotechnology Co., Ltd. for sequencing until the sequence was verified to be correct through sequence alignment, thus obtaining the recombinant Yersinia lipolytica strain Ylscu-03.
[0152] Example 4: Shake-flask fermentation culture of recombinant Yersinia lipolyticis strain and HPLC detection of products
[0153] Initial screening of recombinant Yersinia lipolyticis strains was performed using 24-well deep-well plates: successfully integrated yeast single colonies (Ylscu-01, Ylscu-02, and Ylscu-03) were inoculated into 24-well deep-well plates containing 1.8 mL of nitrogen-based mixed medium per well, and cultured in a deep-well plate shaker at 220 rpm and 30°C for 72 h to complete fermentation. Samples were then taken for HPLC analysis.
[0154] Method for detecting the yield of scutellarin: Take 200 µL of fermentation broth, add 4 times the volume of methanol, mix well and shake for 5 min, centrifuge at 12000 rpm for 5 min, collect the supernatant, filter it through a 0.22 μm organic filter membrane into a liquid chromatography vial for HPLC detection.
[0155] The bacterial culture of the recombinant *Yarrowia lipolytica* strain with the highest *Lactobacillus* yield in the initial screening was streaked onto YPD solid medium and incubated at 30°C for 2 days. Single colonies were picked and cultured in 5 mL of YPD liquid medium at 220 rpm and 30°C for 24 h as seed culture. The cell density (OD) of the seed culture was measured using a microplate reader. 600 and with the initial OD 600The seed culture was inoculated into a 250 mL shake flask containing 30 mL of nitrogen-based mixed culture medium at an inoculation rate of 0.1. The flask was then incubated in a shaker at 220 rpm and 30°C for 72 h to terminate fermentation. Samples were then taken for HPLC analysis. Figure 2 As shown, when using shake-flask fermentation, strain Ylscu-01 produced 530.75 mg / L of ligustrazine B and 52.03 mg / L of ligustrazine A. Strain Ylscu-02, which further enhanced the supply of the precursor to coumaric acid, produced 991.97 mg / L of ligustrazine B and 89.97 mg / L of ligustrazine A. Strain Ylscu-03, which introduced PK-PTA genes (BbXFPK and BsPTA genes) to enhance the supply of the precursor erythrosine 4-phosphate, increased the ligustrazine B production to 1184.07 mg / L, which is currently the highest shake-flask production through microbial fermentation, while the byproduct ligustrazine A production was only 84.39 mg / L. This demonstrates that the recombinant Yersinia lipolytica strain constructed in this invention is the dominant strain for producing ligustrazine B.
[0156] Example 5: Fed-batch fermentation of recombinant Yersinia lipolyticis strain Ylscu-03 in a 5 L bioreactor
[0157] A small amount of recombinant Yersinia lipolytica strain Ylscu-03 was streaked onto YPD solid medium and incubated at 30℃ for approximately 36 h for activation. Single colonies from the solid medium were picked and transferred to a 25 mL shake flask containing 5 mL of YPD liquid medium and incubated at 30℃ and 220 rpm for 24 h as the primary seed culture. 4 mL of this seed culture was then transferred to a 1 L shake flask containing 200 mL of YPD liquid medium and incubated for 18 h as the secondary seed culture. All secondary seed cultures were inoculated into a 5 L bioreactor for fermentation, with an inoculum size of 10% and an initial fermentation volume of 2 L. The initial medium was fermentation medium, the fermentation temperature was set at 30℃, and the aeration rate was 2 L / min. The pH of the fermentation broth was maintained at 7.0 using 20% phosphoric acid and 8 M NaOH. Dissolved oxygen was linked to the aeration rate to maintain approximately 30%, and the aeration rate was set within the range of 250–800 rpm. When the aeration rate reached 800 rpm, the aeration rate was adjusted to 4 L / min. Xylose was added to a final concentration of 4 g / L at 12 h of fermentation for induction. When the residual sugar concentration in the fermentation broth fell below 2 g / L, fed culture medium was introduced, and the residual sugar concentration was controlled at 1.0–1.5 g / L to prevent degradation of scutellarin. When foam was generated, an appropriate amount of defoamer 204 was manually added to defoam. Samples were taken every 12 h for HPLC analysis of scutellarin and scutellarin A yields and cell growth assays.
[0158] Product yield and OD during fermentation of strain Ylscu-03 600 like Figure 3 As shown, cells entered the logarithmic growth phase after 12 hours, and the growth rate decreased significantly after 48 hours. Between 12 and 60 hours, scutellarin B was synthesized at a relatively stable rate, decreasing after 60 hours and reaching its highest yield of 6407.63 mg / L at 84 hours. Scutellarin A yielded 501.45 mg / L, accounting for 7.26% of the total yield. OD 600 The value was 171.2. The mass spectrometry results of the fermentation broth sample are as follows: Figure 4 As shown, the synthesized target product is indeed scutellarin. This result indicates that the recombinant lipophilic yeast strain Ylscu-03, which produces scutellarin according to the present invention, has certain potential for industrial production of scutellarin.
[0159] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A recombinant lipophilic yeast strain Ylscu-03 that produces ligustrazine, characterized in that, The recombinant Yersinia lipolytica strain Ylscu-03 was constructed by introducing SlA-Tsynth7, SUMO-FNS I-Tsynth27, VPRHX, Pleu-Pxo-Ptef, F7GAT-Tsynth2, UDPGDH-Tsynth8, and TAL-Tsynth7 into the recombinant Yersinia lipolytica engineered strain Ylscu2-00, replacing the original promoter of the yeast endogenous prebenzoic acid dehydratase gene PHA2 with the core promoter pPHA2-50, and introducing BbXFPK-Tsynth22 and BsPTA-Tsynth7. The nucleotide sequence of SlA-Tsynth7 is shown in SEQ ID NO.1, the nucleotide sequence of SUMO-FNS I-Tsynth27 is shown in SEQ ID NO.2, the nucleotide sequence of VPRHX is shown in SEQ ID NO.3, the nucleotide sequence of Pleu-Pxo-Ptef is shown in SEQ ID NO.4, the nucleotide sequence of F7GAT-Tsynth2 is shown in SEQ ID NO.5, the nucleotide sequence of UDPGDH-Tsynth8 is shown in SEQ ID NO.6, the nucleotide sequence of pPHA2-50 is shown in SEQ ID NO.7, the nucleotide sequence of TAL-Tsynth7 is shown in SEQ ID NO.8, the nucleotide sequence of BbXFPK-Tsynth22 is shown in SEQ ID NO.9, and the nucleotide sequence of BsPTA-Tsynth7 is shown in SEQ ID NO.
10. The recombinant Yersinia lipolytica engineered strain Ylscu2-00 was constructed by integrating the TEFin-ZWF1-CYCt gene expression cassette and the FBAin-GND1-Tsynth7 gene expression cassette into the D17 site of the genome of the recombinant Yersinia lipolytica engineered strain Yl-nar13, and further integrating the TEFin-VHb-Tsynth7 gene expression cassette and the aGPD-PGM2-IGG6-UGP1-Tsynth7 gene expression cassette into the EXG2 site of the genome of the recombinant Yersinia lipolytica engineered strain Yl-nar13. The nucleotide sequence of TEFin-ZWF1-CYCt is shown in SEQ ID NO.11, the nucleotide sequence of FBAin-GND1-Tsynth7 is shown in SEQ ID NO.12, the nucleotide sequence of TEFin-VHb-Tsynth7 is shown in SEQ ID NO.13, and the nucleotide sequence of aGPD-PGM2-IGG6-UGP1-Tsynth7 is shown in SEQ ID NO.
14. The recombinant Yersinia lipolytica engineered strain Yl-nar13 was constructed by integrating the TEFin-CHS-IGG6-CHI-Tsynth7 gene expression cassette into the ACE site and D19140 site of the genome of the Yersinia lipolytica engineered strain Yl-nar11. The nucleotide sequence of TEFin-CHS-IGG6-CHI-Tsynth7 is shown in SEQ ID NO.
15.
2. A method for constructing the recombinant Yersinia lipophila strain Ylscu-03 according to claim 1, characterized in that, Includes the following steps: Using plasmid pINA1269 as a vector, VPRHX was introduced to obtain plasmid p1269-VPRHX; pEXP1 and F7GAT-Tsynth2 were fused by PCR to obtain gene expression cassette pEXP1-F7GAT-Tsynth2, and pGPD and UDPGDH-Tsynth8 were fused by PCR to obtain gene expression cassette pGPD-UDPGDH-Tsynth8. Using plasmid p1269-VPRHX as a vector, pEXP1-F7GAT-Tsynth2 and pGPD-UDPGDH-Tsynth8 were introduced to obtain plasmid p1269-VX-FU; using plasmid p1269-VX-FU as a vector, SUMO-FNS I-Tsynth27, SlA-Tsynth7 and Pleu-Pxo-Ptef were introduced to obtain plasmid p1269-VX-FU-SFSlA. Using plasmid pCRISPR-Cas9URA as a vector, sgRNA, the upper homologous arm fragment upPHA2, and the lower homologous arm fragment dnPHA2 were introduced to obtain plasmid pCRISPR-Cas9URA-pPHA2-50; using the plasmid pCRISPR-Cas9URA-pPHA2-50 as a vector, pGPD and TAL-Tsynth7 were introduced to obtain plasmid pCRISPR-Cas9URA-pPHA2-50-TAL; The gene expression cassette pFBAin-BbXFPK-Tsynth22 was obtained by fusion PCR of pFBAin and BbXFPK-Tsynth22, and the gene expression cassette pEXP1-BsPTA-Tsynth7 was obtained by fusion PCR of pEXP1 and BsPTA-Tsynth7. The plasmid pINA1312 was used as a vector to introduce the pFBAin-BbXFPK-Tsynth22 and the pEXP1-BsPTA-Tsynth7 to obtain the plasmid p1312-PKPTA. Using the recombinant Yersinia lipolytica strain Ylscu2-00 as the starting strain, the plasmid p1269-VX-FU-SFSlA was transformed into the strain Ylscu2-00, and the recombinant Yersinia lipolytica strain Ylscu-01 was obtained by culturing it in YNB-Ura-Phe solid medium. The plasmid pCRISPR-Cas9URA-pPHA2-50-TAL was transformed into the recombinant Yersinia lipolytica strain Ylscu-01, and the recombinant Yersinia lipolytica strain Ylscu-02 was obtained by culturing it in SD-Ura solid medium. The plasmid p1312-PKPTA was transformed into the recombinant Yersinia lipolytica strain Ylscu-02, and the recombinant Yersinia lipolytica strain Ylscu-03 was obtained by culturing it in SD-Ura solid medium. The nucleotide sequence of pEXP1 is shown in SEQ ID NO.16, the nucleotide sequence of pGPD is shown in SEQ ID NO.17, the nucleotide sequence of sgRNA is shown in SEQ ID NO.18, the nucleotide sequence of the upper homologous arm fragment upPHA2 is shown in SEQ ID NO.19, the nucleotide sequence of the lower homologous arm fragment dnPHA2 is shown in SEQ ID NO.20, and the nucleotide sequence of pFBAin is shown in SEQ ID NO.
21.
3. The construction method as described in claim 2, characterized in that, The YNB-Ura-Phe solid culture medium consists of 6.7 g / L YNB, 10 g / L glucose, 20 g / L agar, 0.5 g / L uracil, and 0.5 g / L phenylalanine. The SD-Ura solid medium consists of 6.7 g / L YNB, 20 g / L glucose, 20 g / L agar, and 1.29 g / L DOSupplement-Ura.
4. The construction method as described in claim 2, characterized in that, Before transforming the plasmid p1312-PKPTA into the recombinant Yersinia lipolytica strain Ylscu-02, the method further includes culturing the recombinant Yersinia lipolytica strain Ylscu-02 in 5-FOA solid medium to lose the plasmid pCRISPR-Cas9URA-pPHA2-50-TAL. The 5-FOA solid medium consists of 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 1 g / L 5-fluoroorotic acid and 20 g / L agar.
5. The application of the recombinant Yersinia lipophila strain Ylscu-03 as described in claim 1 in the production of scutellarin.
6. A method for producing lamp ash ethylene, characterized in that, The process includes the step of fermentation using the recombinant Yersinia lipophila strain Ylscu-03 as described in claim 1.
7. The method as described in claim 6, characterized in that, A single colony of activated recombinant Yersinia lipolytica strain Ylscu-03 was inoculated into YPD liquid medium and cultured as a primary seed culture. The primary seed culture was then transferred to YPD liquid medium and cultured as a secondary seed culture. The secondary seed culture was then inoculated into a 5 L bioreactor for fermentation to produce scutellarin.
8. The method as described in claim 7, characterized in that, The inoculum size of the secondary seed culture was 10%, and the fermentation medium was a fermentation medium with a temperature of 30°C, an aeration rate of 2 L / min, and a pH of 7.
0. The fermentation medium consists of 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 10 g / L corn steep liquor powder.
9. The method as described in claim 7, characterized in that, Xylose with a final concentration of 4 g / L was added after 12 h of fermentation for induction. When the residual sugar concentration in the fermentation broth was lower than 2 g / L, fed medium was added to control the residual sugar concentration at 1.0~1.5 g / L.
10. The method of claim 9, wherein the feed culture medium comprises 600 g / L glucose, 25 g / L peptone, 55 g / L yeast extract, 9 g / L diammonium hydrogen phosphate, 10 g / L corn steep liquor powder, 2 g / L phenylalanine and 1 g / L vitamin C.