Microneedle detection sensor for detecting cocaine as well as preparation method and application of microneedle detection sensor
By combining MeHA-MN microneedle carriers and DNA hydrogel systems, rapid and accurate detection of cocaine has been achieved, solving the problems of low sensitivity and high invasiveness in existing detection methods, making it suitable for rapid testing in public places.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUAZHONG UNIV OF SCI & TECH
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-15
Smart Images

Figure CN122038540A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biodetection technology, specifically relating to a microneedle detection sensor for detecting cocaine, its preparation method, and its application. Background Technology
[0002] Cocaine, as a highly addictive illicit drug, poses far-reaching harms when abused. On the one hand, it severely damages the nervous and cardiovascular systems of abusers, inducing mental disorders, myocardial infarction, and other diseases. On the other hand, it also breeds theft, robbery, and other illegal and criminal activities, posing a significant threat to social order and public health and safety. Therefore, establishing a rapid, sensitive, convenient, and low-invasive cocaine detection method is crucial for early screening of drug abuse, on-site law enforcement supervision, and maintaining social order.
[0003] Current mainstream methods for cocaine detection have significant limitations. While high-performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry (GC-MS) offer high sensitivity and accurate results, they rely on large, sophisticated instruments, involve complex sample pretreatment, are cumbersome to operate, have long detection cycles, and require highly skilled operators, making them unsuitable for rapid on-site testing. Enzyme-linked immunosorbent assay (ELISA) does not require complex instruments, but it is susceptible to cross-reactions affecting detection specificity and takes several hours, resulting in low efficiency. Colloidal gold immunochromatography (CIGC), while enabling rapid on-site detection and being easy to operate, suffers from low sensitivity due to its underlying principle, making it difficult to accurately detect low concentrations of cocaine samples and prone to false negatives, thus failing to meet the needs for detecting trace residues.
[0004] Meanwhile, the existing samples used for testing, such as blood, urine, and saliva, are insufficient. Blood collection requires professional operation and is an invasive test, which can easily cause discomfort and carries the risk of infection; urine collection, although non-invasive, requires specific conditions, has poor privacy, and the sample is easily contaminated, affecting the results; saliva collection is convenient, but its cocaine content is low, requiring higher detection sensitivity, and current technology struggles to balance convenience and sensitivity.
[0005] Interstitial fluid (ISF) is a novel biological sample with components that correlate well with blood and contains a certain concentration of cocaine and its metabolites, making it an ideal sample for testing. Its minimally invasive collection method also reduces invasiveness and increases acceptability. However, current technologies for detecting cocaine in ISF are lacking. Existing methods are not directly applicable, and there is a lack of integrated sample collection and detection solutions, making it difficult to meet the practical needs for rapid, sensitive, and low-invasive on-site cocaine detection. Summary of the Invention
[0006] The present invention aims to provide a microneedle detection sensor for detecting cocaine, its preparation method and application. The microneedle detection sensor can realize rapid and sensitive detection of cocaine in interstitial fluid of the skin, and is also low-invasive and easy to operate.
[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: A microneedle detection sensor for detecting cocaine includes: a MeHA-MN microneedle carrier and a detection system.
[0008] Preferably, the detection system is loaded in a MeHA-MN microneedle carrier, and the detection system includes a cocaine aptamer-complementary nucleic acid fragment complex formed by hybridization and a DNA hydrogel system.
[0009] Preferably, the nucleotide sequence of the cocaine aptamer is shown in SEQ ID NO.1, and the nucleotide sequence of the complementary nucleic acid fragment is shown in SEQ ID NO.2.
[0010] Preferably, the DNA hydrogel system consists of 6 DNA strands, namely S-1, S-2, S-3, S-4, S-5, and S-6, wherein the nucleotide sequences of S-1 to S-6 are shown in SEQ ID NO.3 to SEQ ID NO.8, respectively.
[0011] Preferably, the detection system further includes a fuel chain FUEL, the nucleotide sequence of which is shown in SEQ ID NO.9.
[0012] The present invention also provides a method for preparing the microneedle detection sensor as described above, comprising the following steps: S1, Synthetic methacrylate hyaluronic acid (MeHA); S2. After mixing hyaluronic acid methacrylate (MeHA) with a photoinitiator, the mixture is injected into a mold, centrifuged, dried, and cross-linked under ultraviolet light to obtain MeHA-MN microneedle carrier. S3. Construct a DNA hydrogel system; S4. Hybridization forms a cocaine aptamer-complementary nucleic acid fragment complex; S5. The DNA hydrogel system, cocaine aptamer-complementary nucleic acid fragment complex and fuel chain FUEL are mixed and loaded into the MeHA-MN microneedle carrier to form MeHa-AP-DNA hydrogel microneedles.
[0013] Preferably, in step S1, the synthesis of methacrylic acid hyaluronic acid (MeHA) includes the following steps: Hyaluronic acid was dissolved in deionized water and stirred continuously overnight at 4°C. N,N-dimethylformamide and methacrylic anhydride were added sequentially to adjust the pH to alkaline. The mixture was stirred continuously at low temperature, and sodium chloride and anhydrous ethanol were added. The precipitate was collected, washed with anhydrous ethanol, dissolved in deionized water, dialyzed, and lyophilized to obtain hyaluronic acid methacrylate (MeHA).
[0014] Preferably, in step S3, the method for constructing the DNA hydrogel system includes the following steps: S31. Hybridize S-1 and S-2 to form a double-stranded unit [S-1 / S-2]n; S32, S-3, S-4, S-5, and S-6 hybridize to form the cross-linking agent CL; S33. The double-stranded unit [S-1 / S-2]n is mixed and hybridized with the cross-linking agent CL to form a three-dimensional network structure of DNA hydrogel.
[0015] The present invention also provides the application of the microneedle detection sensor in the preparation of a detection tool for detecting cocaine in in vitro samples.
[0016] The present invention also provides a method for detecting cocaine in an in vitro sample using the microneedle detection sensor, comprising the following steps: T1. Bring the microneedle detection sensor into contact with the sample to be tested; T2. After incubation for a certain period of time, the fluorescence signal generated by the microneedle sensor is detected; T3. Compare the fluorescence signal with the standard curve to determine the concentration of cocaine in the sample.
[0017] Compared with the prior art, the present invention has the following advantages and technical effects: This invention discloses a microneedle detection sensor for cocaine detection, its preparation method, and its application. Cocaine competes for the complementary pairing strand of the aptamer, and the complementary strand can amplify the signal by triggering a Toehold-mediated DNA strand displacement reaction. When cocaine is present, it preferentially binds to the cocaine aptamer, thereby competing for the complementary nucleic acid fragment that is complementary to the cocaine aptamer. The complementary nucleic acid fragment enters the DNA hydrogel system, thereby amplifying the signal and achieving highly sensitive detection of cocaine. Simultaneously, the cocaine aptamer exhibits high specificity and affinity for cocaine molecules, and the reaction in the DNA hydrogel system strictly relies on specific sequence recognition triggering, effectively avoiding interference from common drugs and endogenous substances such as glucose, lactic acid, and ions in interstitial fluid, ensuring accurate and reliable detection results.
[0018] Furthermore, this invention uses hyaluronic acid methacrylate (MeHA) to prepare microneedle patches. This material has good biocompatibility and suitable mechanical strength, and can penetrate the stratum corneum of the skin painlessly and minimally invasively to efficiently enrich the target substances in the interstitial fluid. This solves the problem of the inconvenience of traditional blood and urine tests, and is especially suitable for rapid and discreet screening in public places. Moreover, the entire test does not require complicated sample pretreatment. After the microneedles are inserted into the test environment, a clear fluorescent signal response can be generated within minutes. The results can be read through a portable fluorescence detection device, which greatly shortens the test time and fully meets the needs of rapid testing.
[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0020] Figure 1 The 1H NMR spectrum of hyaluronic acid methacrylate (MeHA) from Example 1; Figure 2 This is a morphological image of the MeHa microneedle patch in Example 1, wherein, Figure 2 In the image, A represents the MeHa microneedle patch, captured by a mobile phone. Figure 2 B in the image represents inverted fluorescence imaging; Figure 2 In this context, C stands for scanning electron microscopy (SEM) imaging. Figure 3 The mechanical properties of the MeHa microneedle patch in Example 1 are shown in the figure. Figure 4 The graph shows the fluorescence quenching of S-3 / S-6 over time and the fluorescence changes of S-3 / S-6 binding at different concentrations in Example 1. Figure 4 In the figure, A represents the change in fluorescence intensity of the solution over time after S-3 / S-6 binding. Figure 4 In this context, B represents the change in fluorescence concentration of the solution after S-3 binds to different concentrations of S-6. Figure 5 The fluorescence results of S-3 / S-6 recovery from T1 sequence are shown in the figure. Figure 6 The result of DNA hydrogel construction in Example 1; Figure 7 This is the result of fuel chain verification; Figure 8 Image showing the effect of microneedle patch puncturing agarose gel; Figure 9 This is the result of the penetration test; Figure 10 The results of aptamer complementation verification include, Figure 10 In the image, A represents the PAGE gel image after AP and T1 have combined. Figure 10 In the diagram, B represents the fluorescence intensity of the solution after AP-FAM and T1-BHQ have bound together. Figure 11 The results of the water absorption test for MeHa-AP-DNA hydrogel microneedles. Detailed Implementation
[0021] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0022] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0023] Source of experimental materials: In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.
[0024] Example 1 A method for preparing the microneedle detection sensor as described above includes the following steps: S1. Synthesis of hyaluronic acid methacrylate (MeHA): 4.0 g of hyaluronic acid was dissolved in 200 mL of deionized water and stirred continuously overnight at 4 °C. 133.3 mL of N,N-dimethylformamide and 4.76 mL of methacrylic anhydride were added sequentially, and the pH was adjusted to 8. The reaction was maintained at 4 °C and stirred continuously for 18 h. 9.88 g of sodium chloride was added, and the sodium chloride concentration in the reaction solution was 0.5 M. Anhydrous ethanol was added, the precipitate was collected, washed three times with anhydrous ethanol, dissolved in deionized water, dialyzed against deionized water for 7 days, and freeze-dried at -40 °C for two days to obtain hyaluronic acid methacrylate (MeHA).
[0025] S2, Prepare a concentration of 50 mg / mL -1 Methacrylate hyaluronic acid (MeHA) with 0.5 mg / mL -1 The photoinitiator mixture was prepared by pouring 200 μL of the solution into a PDMS mold until the cavity was filled. After centrifugation (4000 rpm, 5 min), 100 μL of the above mixture was added to create a robust backing. After drying at room temperature in a fume hood (approximately 12 hours), the mold was carefully separated and trimmed, and then exposed to ultraviolet light (wavelength = 360 nm, intensity = 17.0 mW cm⁻¹). -2 The photocrosslinking time was 3 min to obtain MeHA-MN microneedle carrier; S3. Construct a DNA hydrogel system, including the following steps: anneal 10 μL of 100 μM S-1, S-2, S-3, S-4, S-5 and S-6 in TE buffer to 95 °C for 4 min, and then cool to 4 °C for at least 2.5 h. S31. Mix S-1 TE buffer (10 μL 100 μM) and S-2 TE buffer (10 μL 100 μM) and incubate at 37 °C for 6 h to obtain [S-1 / S-2]n; S32. Take 10 μL of TE buffer solution (100 μM) of S-3, S-4, S-5 and S-6 respectively, mix them, and incubate at 37℃ for 6 h to obtain crosslinking solution CL; S33. Mix the double-stranded unit [S-1 / S-2]n with the cross-linking agent CL and incubate at 37°C for 6 hours to form a DNA hydrogel with a three-dimensional network structure.
[0026] S4. Anneal 10 μL of 25 μM cocaine aptamer and 10 μL of 25 μM complementary nucleic acid fragment T1 in TE buffer to 95 °C for 4 min, cool to 4 °C for 2.5 h, and then incubate at 37 °C for 6 h to obtain cocaine aptamer-complementary nucleic acid fragment complex. S5. The 12.5 μM DNA hydrogel system, 12.5 μM cocaine aptamer-complementary nucleic acid fragment complex and 25 μM fuel chain FUEL were mixed and loaded into the MeHA-MN microneedle carrier to form MeHa-AP-DNA hydrogel microneedles.
[0027] The cocaine aptamer is a biotin-modified cocaine aptamer at its 5' end, and its nucleotide sequence is shown in SEQ ID NO.1. The nucleotide sequence of the complementary nucleic acid fragment T1 is shown in SEQ ID NO.2, and the nucleotide sequences of S-1 to S-6 are shown in SEQ ID NO.3-SEQ ID NO.8, respectively. The nucleotide sequence of the fuel chain FUEL is shown in SEQ ID NO.9.
[0028] SEQ ID NO.1: 5'-ACGACGACCGTTGTTCAATGGGGGTTGGCCGTGAACAGTACGGGGGTAGTTATAGTTGGGTGAGTCGT-3'.
[0029] SEQ ID NO.2: 5'-TACTGTTCACGGCCAAGAATAGGGG-3'.
[0030] SEQ ID NO.3: 5'-AGTCGTTAACTATGACGTCTAAACTTATGATCAGA-3'.
[0031] SEQ ID NO.4: 5'-AGACCGTCATAGTTAACGACTTCTGATCATAAGTTTATAGTACGAGATAACATG-3'.
[0032] SEQ ID NO.5: 5'-CTCTAAAACCCCGTCGACACCCCTAT / i6FAMdT / CTTGGCCGTGAACAGTAGTTCCGGTGAAGGATGCCTGGCACCATGTTATCTCGTACTAT-3'.
[0033] SEQ ID NO.6: 5'-GTCGACGGGGTTTTAGAGCATGTTATCTCGTACTAAT-3'.
[0034] SEQ ID NO.7: 5'-GTGCCAGGCATCCTTCAC-3'.
[0035] SEQ ID NO.8: 5'-CGGAACTACTGTTCACGGCC / iBHQ1dT / AA-3'.
[0036] SEQ ID NO.9: 5'-ATCCTTCACCGGAACTACTGTTCACGGCCAA-3'.
[0037] Examples 2-4 The preparation method is the same as in Example 1, except that in S2, the photocrosslinking time is 5, 10, and 15 min, respectively.
[0038] The effectiveness of Example 1 was verified through the following experiments.
[0039] 1. The synthesized methacrylate hyaluronic acid (MeHA) was characterized using the following experimental procedure: MEHA lyophilized solid was dissolved in deuterated D₂O. 0.6 mL of the solution was transferred to a 5 mm NMR tube, and the resonance signal of hydrogen atoms in the solution within a magnetic field was detected using a 1H NMR spectrometer (Bruker Avance II 400 MHz NMR). The results are as follows: Figure 1 As shown.
[0040] Depend on Figure 1 It can be seen that 1.9-2 represents the proton signal of olefin hydrogen and 5.7-6.2 represents the proton signal of methyl. Calculating the peak area, the methylation degree of the material is about 40%.
[0041] 2. Morphology: The specific experimental procedure is as follows: Take photos and observe using a mobile phone camera. Figure 2 Bright-field observation with an inverted microscope (Center A) Figure 2 In the middle B, the result is as follows Figure 2 As shown.
[0042] Depend on Figure 2 It can be seen that the microneedle morphology is as expected, and no obvious shrinkage phenomenon is observed.
[0043] 3. Mechanical Properties: The specific test procedure is as follows: The mechanical properties of the cross-linked MeHA-MN patch were tested using a DAGE-4000PlusBond tensile tester. A vertical orientation force was applied perpendicularly to the tip of the MN patch, using a 5mm diameter flat-headed stainless steel cylindrical probe at a constant speed of 0.5mm / min. -1 Measure the displacement until the preset maximum force of 5N is reached. The results are as follows: Figure 3 As shown.
[0044] Depend on Figure 3 It is known that the maximum force that the entire needle can withstand can reach 3N, which is enough to pierce the dermis of the human body.
[0045] 4. Verification of the time-dependent fluorescence quenching of S-3 / S-6 and the changes in fluorescence binding at different concentrations of S-3 / S-6: The specific experimental protocol is as follows: 100 μM S-3 and S-6 were prepared into a 100 nM S-3-S-6 solution using TE buffer. The solution was heated at 95°C for 5 min using a qPCR instrument, and the fluorescence intensity was immediately measured every 5 min using a time-resolved fluorometer. For the next 6 h, the fluorescence intensity was measured hourly. 100 μM S-3 and S-6 were also prepared into 80 / 20, 80 / 40, 80 / 80, and 80 / 120 nM S-3-S-6 solutions using TE buffer. These solutions were heated at 95°C for 5 min using a qPCR instrument, and then incubated at room temperature for 4 h. The fluorescence intensity was measured using a time-resolved fluorometer. The results are as follows: Figure 4 As shown.
[0046] Depend on Figure 4 It is known that S-3-S-6 will bind well to achieve fluorescence quenching after heating at 95℃ for at least 4 hours. Therefore, a 1:1 ratio of S-3 and S-6 can achieve sufficiently sensitive fluorescence quenching.
[0047] 5. Prepare 250nM S-3, 250nM S-3-S-6, and 500nM S-3-S-6 solutions using 100μM S-3 and S-6 buffer with TE buffer. Perform qPCR at 95℃ for 5 min, then cool to room temperature and detect fluorescence intensity using a time-resolved fluorometer to obtain (A), (B), and (D'). (B) was detected after 8 h at room temperature to obtain (C). Adding 500nM T1 to (D') yielded a 250nM S-3-S-6 / T1 solution, which was then incubated at 37℃ for 4 h to obtain (D). The results are as follows. Figure 5 As shown.
[0048] Depend on Figure 5 It can be seen that T1 can replace S6 to restore the fluorescence of the solution.
[0049] 6. DNA hydrogel construction results are as follows Figure 6 As shown.
[0050] Depend on Figure 6 As can be seen from lane 1 on the left, the DNA hydrogel was successfully constructed.
[0051] 7. Fuel chain validation: The specific experimental protocol is as follows: Analysis of T1-triggered toe-point mediated DNA translocation. An 8% PAGE was prepared by adjusting the concentration of 30% acrylamide / bisacrylamide gel solution (29:1) using electrophoresis. 10 μL of DNA sample was mixed with 2 μL of 10× DNA adsorption buffer. PAGE was performed in an ice bath at 100V for approximately 60 minutes, followed by staining in 3×GelRed (NaCl, 100 mM) for 30 minutes. From left to right, the results are: T1 (2 μM), S-3 (2 μM), S-5 (2 μM), S-6 (2 μM), CL (2 μM), S-3+Fuel (2 μM, 2 μM), CL2+T1 (2 μM, 2 μM), and CL+Fuel+T1 (2 μM, 2 μM, 2 μM). The results are as follows: Figure 7 As shown.
[0052] Depend on Figure 7 As can be seen, channel 5 shows the successful formation of CL, while channel 6 shows the hybridization between S3 and fuel. Channel 7 confirms that T1 can easily replace S6, and the substitution of target T1 by fuel can also be confirmed (channel 8).
[0053] 8. The specific experimental protocol is as follows: A 2% agarose gel was prepared to simulate the dermis layer of the skin. Prepared, dried microneedles were inserted into the gel and fixed for at least 5 minutes. The results are as follows: Figure 8 As shown.
[0054] Depend on Figure 8 It is known that the microneedles are strong enough to pierce the gel.
[0055] 9. Penetration test, the specific procedure is as follows: A prepared, dried microneedle is inserted into the surface layer of the shaved mouse skin and a certain pressure is applied for fixation for at least 5 minutes. The results are as follows: Figure 9 As shown.
[0056] Depend on Figure 9 It is known that microneedles are sufficient to penetrate the surface of mouse skin and achieve a minimally invasive effect.
[0057] 10. Aptamer Complementation Validation: The experimental protocol was as follows: 100 μM AP and T1 were prepared into 100 nM AP solution, 100 nM T1 solution, and 100 nM AP-T1 solution using TE buffer. qPCR was performed at 95°C for 5 min, followed by cooling to room temperature before electrophoresis analysis. An 8% PAGE gel was prepared by adjusting the concentration of 30% acrylamide / bisacrylamide gel (29:1). 10 μL of DNA sample was mixed with 2 μL of 10× DNA adsorption buffer. PAGE was performed at 100V on ice for approximately 60 minutes, followed by staining in 3×GelRed (NaCl, 100 mM) for 30 minutes. From left to right, the solutions are 1 μM AP, 1 μM T1, and 1 μM AP / T1.
[0058] Link the 5' end of AP to FAM and the 3' end of T1 to BHQ1. Prepare 250 nM AP / T1 solutions, 250 nM T1 solutions, and 250 nM AP / T1 solutions using TE buffer with 100 μM AP and T1. Perform qPCR at 95 °C for 5 min, then cool to room temperature and detect fluorescence intensity using a time-resolved fluorometer. Figure 10 B and Figure 10 C in the middle.
[0059] Depend on Figure 10 As can be seen from A, AP and T1 can bind. The 10-2 / 10-3 indicates that the aptamer can capture small cocaine molecules while causing the complementary sequence T1 to drop.
[0060] Depend on Figure 10 B and Figure 10 From C, we can see that Figure 10 The fluorescence quenching in B further confirms that AP successfully binds to T1, and Figure 10 The 'c' in the figure indicates that under TE buffer conditions, AP can capture cocaine molecules, causing the T1 fragment to detach and resulting in fluorescence recovery.
[0061] 11. Water Absorption of Microneedles: The specific experimental procedure is as follows: A 2% agarose hydrogel was prepared to simulate skin. Microneedle patches were firmly fixed to the surface of the agarose gel. The water absorption performance of the microneedles was verified by recording the weight change of the microneedle patches over time. The results are as follows: Figure 11 As shown.
[0062] Depend on Figure 11 It can be seen that microneedles have strong water absorption capacity, 1×1cm 2 The tip of the microneedle can absorb about 30% of the total weight of the solution.
[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A microneedle detection sensor for detecting cocaine, characterized in that, include: MeHA-MN microneedle carrier and detection system.
2. The microneedle detection sensor according to claim 1, characterized in that, The detection system is loaded into a MeHA-MN microneedle carrier and includes a cocaine aptamer-complementary nucleic acid fragment complex formed by hybridization and a DNA hydrogel system.
3. The microneedle detection sensor according to claim 2, characterized in that, The nucleotide sequence of the cocaine aptamer is shown in SEQ ID NO.1, and the nucleotide sequence of the complementary nucleic acid fragment is shown in SEQ ID NO.
2.
4. The microneedle detection sensor according to claim 2, characterized in that, The DNA hydrogel system consists of 6 DNA strands, namely S-1, S-2, S-3, S-4, S-5, and S-6, wherein the nucleotide sequences of S-1 to S-6 are shown as SEQ ID NO.3-SEQ ID NO.8, respectively.
5. The microneedle detection sensor according to claim 2, characterized in that, The detection system also includes a fuel chain FUEL, the nucleotide sequence of which is shown in SEQ ID NO.
9.
6. A method for preparing a microneedle detection sensor as described in any one of claims 1-5, characterized in that, Includes the following steps: S1, Synthetic methacrylate hyaluronic acid (MeHA); S2. After mixing hyaluronic acid methacrylate (MeHA) with a photoinitiator, the mixture is injected into a mold, centrifuged, dried, and cross-linked under ultraviolet light to obtain MeHA-MN microneedle carrier. S3. Construct a DNA hydrogel system; S4. Hybridization forms a cocaine aptamer-complementary nucleic acid fragment complex; S5. The DNA hydrogel system, cocaine aptamer-complementary nucleic acid fragment complex and fuel chain FUEL are mixed and loaded into the MeHA-MN microneedle carrier to form MeHa-AP-DNA hydrogel microneedles.
7. The method according to claim 6, characterized in that, In S1, the synthesis of methacrylic acid hyaluronic acid (MeHA) includes the following steps: Hyaluronic acid was dissolved in deionized water and stirred continuously overnight at 4°C. N,N-dimethylformamide and methacrylic anhydride were added sequentially to adjust the pH to alkaline. The mixture was stirred continuously at low temperature, and sodium chloride and anhydrous ethanol were added. The precipitate was collected, washed with anhydrous ethanol, dissolved in deionized water, dialyzed, and lyophilized to obtain hyaluronic acid methacrylate (MeHA).
8. The method according to claim 6, characterized in that, In S3, the method for constructing the DNA hydrogel system includes the following steps: S31. Hybridize S-1 and S-2 to form a double-stranded unit [S-1 / S-2]n; S32, S-3, S-4, S-5, and S-6 hybridize to form the cross-linking agent CL; S33. The double-stranded units [S-1 / S-2]n are mixed and hybridized with the cross-linking agent CL to form a three-dimensional network structure of DNA hydrogel.
9. The use of the microneedle detection sensor as described in any one of claims 1-5 in the preparation of a detection tool for detecting cocaine in in vitro samples.
10. A method for detecting cocaine in an in vitro sample using a microneedle detection sensor as described in any one of claims 1-5, characterized in that, Includes the following steps: T1. Bring the microneedle detection sensor into contact with the sample to be tested; T2. After incubation for a certain period of time, the fluorescence signal generated by the microneedle sensor is detected; T3. Compare the fluorescence signal with the standard curve to determine the concentration of cocaine in the sample.