Design method of convection amplification primer
By designing interfaces and folding sequences at the ends of convective PCR primers to form bent hairpin structures, the problems of non-specific amplification and insufficient detection sensitivity in convective PCR technology are solved, realizing high-sensitivity and high-specificity multiplex pathogen detection, which is suitable for rapid detection scenarios such as outpatient and emergency departments.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 广州领上源生物科技有限公司
- Filing Date
- 2026-04-17
- Publication Date
- 2026-05-15
AI Technical Summary
Existing convection PCR technology suffers from non-specific amplification and insufficient detection sensitivity in high-sensitivity and high-specificity applications. Furthermore, it lacks universal primer design methods and cannot adapt to the amplification needs of different CCPCR platforms and different targets.
A convection amplification primer is designed to form a curved hairpin structure by adding interface and folding sequences to the primer ends. The primer sequence is adjusted to increase the annealing temperature. The hairpin structure is maintained in the upper temperature region to avoid non-specific amplification, and the hairpin structure is opened in the lower temperature region to achieve effective binding with the template strand.
It improves the detection sensitivity and specificity of convective PCR, shortens the amplification time, is suitable for the simultaneous detection of multiple pathogens, and achieves rapid qualitative detection at low cost and high efficiency.
Smart Images

Figure CN122050504A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a method for designing convective amplification primers. Background Technology
[0002] PCR (Polymerase Chain Reaction) is an extremely important tool in molecular biology research. It is a core technology for the specific amplification of target DNA fragments. With its high sensitivity and specificity, it has become a fundamental support for many fields such as gene detection, clinical diagnosis, and biological research. Its role is comparable to that of a transistor in electronics, amplifying signals and driving the rapid development of molecular biology. Traditional PCR relies on periodic temperature cycles. By repeatedly heating to 95°C to denature double-stranded DNA, cooling to 50-65°C to anneal primers, and heating to 72°C to catalyze polymerase extension, exponential amplification of the target fragment is achieved. However, this process requires a complex temperature control system and has limitations such as high energy consumption, long amplification cycle, and poor instrument portability, making it difficult to meet the needs of scenarios such as rapid on-site detection.
[0003] Convective PCR (CPCR) utilizes natural thermal convection to continuously circulate the reaction solution between different temperature zones, thus replacing the programmed heating / cooling of traditional thermal cyclers to achieve nucleic acid amplification. It eliminates the need for complex periodic temperature control equipment, simultaneously completing the three key steps of DNA denaturation, primer annealing, and strand extension, significantly shortening amplification time from several hours in traditional PCR to 30-40 minutes. It also simplifies instrument structure, reduces energy consumption, and provides a feasible path for portable, low-cost DNA amplification detection. In a convective PCR system, the circulation of the reaction solution is driven by the difference in fluid density caused by the temperature gradient. Capillary convective PCR (CCPCR) is the most widely used implementation. This technique uses a dry thermostat to heat the bottom of the capillary, which is then cooled by the surrounding air. Without the need for additional cooling devices, a stable temperature gradient is formed within the capillary. The sample then undergoes denaturation, annealing, and extension steps sequentially through reagent circulation driven by natural convection, ultimately achieving PCR amplification.
[0004] Numerous studies have reported on this technology, such as Chinese patent document CN109401948A, which discloses a single-stage convection PCR instrument, and Chinese patent document CN108342312A, which discloses a convection PCR amplification and detection system and method. However, these methods generally suffer from non-specific amplification and insufficient detection sensitivity. Therefore, they are currently only used in fields where sensitivity requirements are not high. For applications requiring high sensitivity and specificity, such as those in the respiratory tract, there are no industrialized application cases yet.
[0005] Meanwhile, primers, as the core components of PCR amplification, directly determine the efficiency, specificity, and stability of the amplification reaction through their rational design. This is one of the key prerequisites for the application of convective PCR technology. Primers with poor specificity can lead to non-specific amplification, primer dimers, and other problems, severely affecting the amplification results. This principle applies equally to convective PCR and is even more critical. For example, Chinese patent document CN111926109A provides a fluorescent thermal convection PCR detection kit for African swine fever virus; Chinese patent document CN110894552A discloses primers, probes, kits, and RT-ii PCR methods for detecting dengue virus; and Chinese patent document CN111705163A discloses a rapid detection kit for novel coronavirus based on thermal convection PCR. However, the above-mentioned existing technologies are all designed for single targets of specific viruses, failing to form a universal primer design method, and do not consider the T in capillary convection PCR. m The matching degree between the value and the internal temperature gradient, T d Due to core issues such as limitations on amplicon length, it cannot adapt to the amplification needs of different CCPCR platforms and different targets.
[0006] Furthermore, related studies have shown that in the CCPCR platform, the primer melting temperature (T) m The difference between the lowest temperature inside the tube and the amplicon denaturation temperature (T) directly affects the amplification efficiency. d The difference in temperature relative to the highest temperature inside the tube limits the maximum amplicon length. Therefore, how to design convective amplification primers to improve the detection sensitivity and specificity of convective PCR is a key element for the industrial application of this technology. Summary of the Invention
[0007] The purpose of this invention is to provide a method for designing convective amplification primers and an amplification method thereof. The convective amplification primers obtained by this design method can simultaneously adapt to the amplification requirements of different targets and can improve the detection sensitivity and specificity of convective PCR.
[0008] To solve the aforementioned technical problems, the present invention specifically adopts the following technical solution: The first aspect of this invention is to provide a method for designing convective amplification primers, specifically including the following steps: S1: Based on the nucleotide sequence of the target nucleic acid fragment, design upstream and downstream primers for specific amplification of the target nucleic acid fragment; S2: Based on the annealing temperatures of the upstream and downstream primers, add an upstream interface sequence and a downstream interface sequence that are not complementary to the target nucleic acid sequence to the ends of the upstream and downstream primers, respectively. S3: By simultaneously adjusting a segment of the base sequence in the upstream primer and the downstream primer, an upstream fold sequence complementary to the base sequence of the upstream interface sequence and a downstream fold sequence complementary to the base sequence of the downstream interface sequence are obtained, thereby forming a curved hairpin structure in the sequences of the upstream primer and the downstream primer.
[0009] Preferably, in step S2, an upstream interface sequence and a downstream interface sequence are added to the 5' end of the upstream primer and the downstream primer, respectively.
[0010] Preferably, the sequences of the upstream primer and the downstream primer are complementary to the target nucleic acid fragment, the upstream interface sequence and / or the downstream interface sequence are not complementary to the target nucleic acid fragment, and the upstream folding sequence and / or the downstream folding sequence are complementary to the upstream interface sequence and / or the downstream interface sequence, thereby forming a curved hairpin structure.
[0011] The addition of an interface sequence can increase the primer annealing temperature by at least 10°C.
[0012] Using the above technical solution, primer pairs (upstream and downstream primers) with interface and folding sequences were designed. The interface sequence is not complementary to the target nucleic acid, while the folding sequence is part of the complementary sequence of the target nucleic acid. This folding sequence is designed to be within the complementary sequence of the target nucleic acid and complementary to the interface sequence, thus forming a curved hairpin structure within the entire sequence. The hairpin structure is maintained in the high-temperature region to avoid non-specific amplification, while in the low-temperature region, the high temperature opens the hairpin structure, thereby achieving effective binding with the template strand. Compared with conventional primer-probe designs, this structure has been experimentally verified to significantly improve detection sensitivity, and can achieve rapid, specific, accurate, and sensitive qualitative detection of multiple pathogens simultaneously within 20-30 minutes.
[0013] Preferably, in step S3, the upstream primer contains 3-6 upstream fold sequences complementary to the upstream interface sequence; the downstream primer contains 3-6 downstream fold sequences complementary to the downstream interface sequence; and the upstream and / or downstream fold sequences are not complementary to the target nucleic acid sequence. That is, both the upstream and / or downstream interface sequences and the upstream and / or downstream fold sequences contain 3-6 bases.
[0014] Preferably, the cytosine content in the upstream interface sequence and / or downstream interface sequence, as well as the upstream fold sequence and / or downstream fold sequence, is at least 50%. The amplification effect is even better when the total content of guanine (G) and cytosine (C) in the bases exceeds 50%.
[0015] Preferably, the upstream and downstream primers comprise 15-30 bases; the number of bases in the upstream interface sequence and / or downstream interface sequence and the upstream fold sequence and / or downstream fold sequence is at most 50% of the number of bases in the upstream and / or downstream primers.
[0016] Preferably, when the upstream interface sequence and / or the downstream interface sequence includes two or more bases, it may include two repeats of cytosine.
[0017] Preferably, when the upstream fold sequence and / or downstream fold sequence comprises two or more bases, it may comprise two repeats of cytosine.
[0018] Preferably, the cytosine content in the upstream interface sequence and / or the downstream interface sequence, as well as the upstream fold sequence and / or the downstream fold sequence, can be 50%, 60%, 70%, 80%, 90%, or 100%.
[0019] Preferably, the guanine content in the upstream interface sequence and / or the downstream interface sequence, as well as the upstream folding sequence and / or the downstream folding sequence, is at most 50%.
[0020] Preferably, the cytosine content in the upstream interface sequence and / or the downstream interface sequence, as well as the upstream fold sequence and / or the downstream fold sequence, can be 0%, 10%, 20%, 30%, 40%, or 50%.
[0021] Preferably, based on the principle of non-complementarity between primers, in the upstream interface sequence and / or the downstream interface sequence, guanine or cytosine is used to completely or partially replace adenine, thymine or uracil in the interface sequence upstream and / or downstream of the 5' end of the corresponding target nucleic acid fragment.
[0022] Preferably, in the upstream interface sequence and / or the downstream interface sequence, guanine partially or completely replaces cytosine in the interface sequence upstream and / or downstream of the 5' end of the corresponding target nucleic acid fragment.
[0023] Preferably, in the upstream interface sequence and / or the downstream interface sequence, guanine in the interface sequence upstream and / or downstream of the 5' end of the corresponding target nucleic acid fragment is partially or completely replaced with cytosine.
[0024] A second aspect of the present invention is to provide a method for amplifying a target nucleic acid fragment in a sample using the convection amplification primers described in the first aspect of the present invention, the amplification method comprising a first amplification stage and a second amplification stage, wherein both the first amplification stage and the second amplification stage comprise an upper temperature region and a lower temperature region; The first amplification stage includes contacting the sample with the upstream primer and the downstream primer and amplifying under first amplification conditions to obtain a first amplification product. The second amplification stage includes using the first amplification product as a template and amplifying under second amplification conditions to obtain a second amplification product; In both the first and second amplification conditions, the upper temperature region is 40-95℃, and the lower temperature region is 90-100℃, with a duration of 50-1500s.
[0025] Preferably, agarose at a concentration of 0.1-0.5% (w / w) is added to the reaction system. Different amplification targets have various optimal concentrations depending on their base composition and length, with a preferred concentration of 0.15-0.3% (w / w).
[0026] Preferably, both the amplification system of the first amplification stage and the amplification system of the second amplification stage contain 5-10 mM MgCl2 and 0.6-1 mg / mL BSA.
[0027] Preferably, the upper and lower temperature regions of the first amplification stage have the same temperature, and the lower temperature region of the second amplification stage has a higher temperature than the upper temperature region, with the temperature difference between the lower and upper temperature regions being 30-40°C.
[0028] Preferably, during the second amplification stage, the upstream and downstream primers maintain or open their hairpin structures according to the amplification temperature during convective PCR amplification to improve amplification sensitivity.
[0029] Preferably, when the target nucleic acid fragment is RNA, the convection PCR amplification includes a reverse transcription amplification stage before the first amplification stage, for reverse transcription of the target nucleic acid fragment.
[0030] Preferably, the convective amplification primers include an upstream primer and a downstream primer, each of which includes a first sequence, a second sequence, and a hairpin structure formed by the primer itself. The first sequence is complementary to the target nucleic acid fragment. The second sequence is placed at the end of the first sequence and is not complementary to the target nucleic acid fragment. The hairpin structure formed by the primer itself is formed by 3-6 bases in the first sequence forming complementary pairings with the second sequence, thereby creating a curved hairpin structure in the primer sequence.
[0031] Preferably, the PCR amplification system further includes a probe.
[0032] Beneficial technical effects: (1) The present invention adds an interface sequence and a folding sequence to the specific primer sequence, and the interface sequence and folding sequence have a specific length (i.e. ≤50% specific primer sequence) and a specific component (i.e. cytosine content ≥50%), so that the overall primer length can be kept short (e.g. less than 30 bases) while the annealing temperature is efficiently increased, without being limited by the specific nucleic acid template (e.g. conserved region of pathogen, GC content).
[0033] (2) The primers designed in this invention have an interface sequence (not complementary to the target nucleic acid) at the end, and a segment of the primer sequence is adjusted so that the bases in the primer sequence have 3-6 folded sequences complementary to the bases of the interface sequence, thus forming a curved hairpin structure in the entire sequence. This hairpin structure is maintained in the upper temperature region to avoid non-specific amplification, while in the lower temperature region, the hairpin structure opens due to the high temperature conditions, thereby achieving effective binding with the template strand. Compared with conventional primer-probe designs, this structure has been experimentally proven to significantly improve detection sensitivity and specificity. That is, not only is the amplification effect of the target nucleic acid fragment higher, but the actual running time of the convection PCR instrument is also significantly shortened, improving the amplification efficiency of the PCR equipment; moreover, it has high accuracy and sensitivity, and short processing time, with an actual detection time of only about 20-30 minutes, thus enabling rapid detection results in outpatient clinics, emergency rooms, ports, or other scenarios requiring rapid results.
[0034] (3) The primers and PCR amplification method designed in this invention are suitable for detecting target nucleic acid fragments from various sources. Furthermore, the primer sets of multiple pathogens (such as Legionella pneumophila, Mycoplasma pneumoniae and Bordetella pertussis) can be set in the same reaction tube, enabling the simultaneous detection of multiple pathogens in one experiment. Detection kits can be prepared using these primers, thereby achieving low-cost and high-efficiency detection. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In all the drawings, similar parts are generally identified by similar reference numerals. The parts in the drawings are not necessarily drawn to scale. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without creative effort.
[0036] Figure 1 This is the nucleic acid amplification curve of parainfluenza virus type III in the experimental group of Example 1 of the present invention; Figure 2This is the nucleic acid amplification curve of parainfluenza virus type III in control group one of Example 1 of the present invention; Figure 3 This is the nucleic acid amplification curve of parainfluenza virus type III in control group two of Example 1 of the present invention; Figure 4 This is the nucleic acid amplification curve of parainfluenza virus type III in Example 2 of the present invention; Figure 5 The nucleic acid amplification curve of parainfluenza virus type III in Example 3 of the present invention; Figure 6 This is Experimental Group 1 of Example 4 of the present invention, detecting the nucleic acid amplification curves of multiple RNA pathogens; Figure 7 This is experimental group two of Example 4 of the present invention, which detects the nucleic acid amplification curves of different internal target genes; Figure 8 This is Experiment Group 3 of Example 4 of the present invention, detecting the nucleic acid amplification curves of multiple DNA pathogens; Figure 9 This is the fourth experimental group of Example 4 of the present invention, which detects the nucleic acid amplification curves of graded dilutions of influenza A virus; Figure 10 The diagram shows the structure of the primers designed by the inventors of this invention. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0038] In this document, "and / or" includes any and all combinations of one or more of the listed related items.
[0039] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.
[0040] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4%, more typically + / -3%, more typically + / -2%, even more typically + / -1%, even more typically + / -0.5%.
[0041] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.
[0042] Definition of noun: As used herein, “nucleic acid” refers to DNA, RNA, or DNA / RNA hybrid molecules existing in single-stranded or double-stranded form. In some embodiments, nucleic acid samples may be isolated from cells or viruses. In some embodiments, nucleic acid samples may include chromosomal DNA, plasmid DNA, recombinant DNA, messenger RNA, ribosomal RNA, transfer RNA, double-stranded RNA, or other RNA present in cells or viruses. Nucleic acids are derived from artificially prepared viral cultures, as well as from one or more clinically collected oropharyngeal swabs, sputum, bronchoalveolar lavage fluid, nasal or lung aspirates, tissue samples, or cells and blood.
[0043] As used herein, "target nucleic acid" or "template nucleic acid" refers to a single-stranded or double-stranded DNA or RNA fragment or sequence that is intended to be selectively amplified. The target nucleic acid may be a fragment contained within a longer double-stranded or single-stranded nucleic acid or may be the entire double-stranded or single-stranded nucleic acid. This invention does not impose a specific limitation on the length of the target nucleic acid. In some embodiments, the length of the target nucleic acid is less than 1000 bp, for example, less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 bp.
[0044] As used herein, “denaturation” refers to the dissociation of all or part of the two complementary strands of a double-stranded nucleic acid using high temperature. As used herein, “annealing” refers to the sequence-specific binding of a primer to a single-stranded nucleic acid template. A primer may bind to the complementary sequence of only one template strand without binding to other regions of the template.
[0045] As used herein, a "primer" refers to a single-stranded nucleic acid or oligonucleotide capable of binding in a sequence-specific manner to a single-stranded region on a target nucleic acid, allowing polymerase-dependent replication of the target nucleic acid. In some embodiments, the target nucleic acid may be a double-stranded nucleic acid such as double-stranded DNA, or a single-stranded nucleic acid such as single-stranded RNA or DNA. If the target nucleic acid is double-stranded, it may be denatured by heating or using an enzyme to form the single-stranded template or template region required for DNA polymerase activity and amplification. This invention does not impose a specific limitation on the length of the target nucleic acid. In some embodiments, the length of the target nucleic acid is less than 1000 bp, for example, less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 bp.
[0046] As used in this article, convective PCR is an isothermal amplification technique that does not require temperature control equipment. Its core principle is to use the temperature gradient within the reaction system to drive solution convection, thereby achieving nucleic acid denaturation, annealing, and extension cycles, and completing the isothermal amplification method for nucleic acid amplification.
[0047] As used in this article, "amplification reaction mixture" refers to the material conditions required for PCR amplification, such as buffer, Mg... 2+ In some embodiments, the amplification reaction mixture may also include enzymes, dNTPs, etc.
[0048] It should be noted that, in this invention, when describing the annealing temperature of a "primer," the specific annealing temperature of a particular primer refers to the theoretical T value corresponding to the specific sequence of that primer. m Value, the theoretical T m Values can be obtained using primer design software known in the art, such as Primer-BLAST, Primer3, Primer Premier5, OLIGO, etc. When describing the "denaturation temperature" and "annealing temperature" of the "amplification conditions" in a PCR amplification step, the specific denaturation temperature and / or annealing temperature of the specific amplification conditions refer to the settings on the PCR instrument. In some embodiments, the "annealing temperature" of the "amplification conditions" is approximately the annealing temperature of the "primers".
[0049] ACTB internal standard: full name Beta-Actin, β-actin, used to correct relative quantification of mRNA.
[0050] GAPDH internal standard: full name is Glyceraldehyde-3-phosphate dehydrogenase.
[0051] RHOG internal standard: full name is Rho GTPase-related gene (Rho GTPase).
[0052] Example: The design method of this convection amplification primer specifically includes the following steps: S1: Based on the nucleotide sequence of the target nucleic acid fragment, design upstream and downstream primers for specific amplification of the target nucleic acid fragment; S2: Based on the annealing temperatures of the upstream and downstream primers, add upstream interface sequences and downstream interface sequences to the 5' ends of the upstream and downstream primers, respectively; The sequences of the upstream primer and the downstream primer are complementary to the sequence of the target nucleic acid fragment, and the upstream interface sequence and / or the downstream interface sequence are not complementary to the sequence of the target nucleic acid fragment; S3: By simultaneously adjusting a segment of the base sequence in both the upstream and downstream primers, 3-6 upstream fold sequences (complementary to the upstream interface sequence) and 3-6 downstream fold sequences (complementary to the downstream interface sequence) are obtained, thereby forming a curved hairpin structure in the sequences of the upstream and downstream primers. The sequence structure is as follows: Figure 10 As shown.
[0053] A method for amplifying target nucleic acid fragments in a sample using designed convection amplification primers, the amplification method comprising a first amplification stage and a second amplification stage, both the first amplification stage and the second amplification stage comprising an upper temperature region and a lower temperature region; The first amplification stage includes contacting the sample with the upstream primer and the downstream primer and amplifying under first amplification conditions to obtain a first amplification product. The second amplification stage includes using the first amplification product as a template and amplifying under second amplification conditions to obtain a second amplification product; In both the first and second amplification conditions, the upper temperature region is 40-95℃, and the lower temperature region is 90-100℃, with a duration of 50-1500s.
[0054] Both the first and second amplification stages contain 0.1-0.7% (w / w) agarose, 5-10 mM MgCl2, and 0.6-1 mg / mL BSA in their amplification systems.
[0055] Example 1: Convection PCR amplification of parainfluenza virus type III was performed using an experimental group and several control groups.
[0056] Target nucleic acid: The nucleotide sequence of parainfluenza virus type III (P3) is SEQ ID NO:8 (TGGAAAGGAAAGGAAGGATACAGAAGAGAGCAATCGATTTACAGAAAGGGCAATTACTCTATTGCAGAATCTTGGTGTAATTCAATCCACATCAAAA).
[0057] Target nucleic acid type: Virus; Target nucleic acid length: approximately 97 bp.
[0058] The experimental group added an upstream interface sequence to the upstream primer and a downstream interface sequence to the downstream primer (using existing techniques). Control group 1 consisted of upstream and downstream primers, meaning no interface sequence or folding sequence was added. Control group 2 used the above design method to design upstream and downstream primers, that is, the upstream primer added an upstream interface sequence and contained a fold sequence, and the downstream primer added a downstream interface sequence and contained a fold sequence; The sequence information used in this embodiment is shown in Table 1.
[0059] Table 1. Sequence information of the experimental group and three control groups in Example 1 In this context, a single underscore indicates an interface sequence; a double underscore indicates a fold sequence, which is the position that forms a curved hairpin structure.
[0060] The amplification system is shown in Table 2.
[0061] Table 2. Amplification systems of the experimental group and three control groups in Example 1. Note: The virus sample was obtained from RNA extracted from parainfluenza virus culture medium; culture medium concentration: 10. 4 copies / mL.
[0062] PCR instrument: Convection PCR instrument; Amplification program: Reverse transcription stage: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. First amplification stage: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Second amplification stage: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.
[0063] Experimental results are as follows Figures 1-3 As shown in the results, the experimental group primers only added the interface sequence and did not form a folded sequence, resulting in amplification failure. Figure 1The control group contained only folded sequences and had no added interface sequences, resulting in amplification failure. Figure 2 Control group two, by adding an interface sequence (tailing) and forming a folded sequence, achieved convection PCR amplification, but the amplification efficiency was poor. Figure 3 The results of this embodiment demonstrate that amplification can be achieved by adding an interface sequence and forming a folded sequence, but the amplification efficiency is poor.
[0064] Example 2: Agarose was applied to countercurrent PCR, using the primers of control group 2 in Example 1, namely primers and probes P3-P1 with added interface and folding sequences. The difference from the amplification system in Example 1 is that 0.1%-2% (w / v) of agarose was added to the countercurrent PCR reaction system in this example.
[0065] Multiple control groups with different concentrations were set up, as shown in Table 3. The amplification conditions were the same as in Example 1.
[0066] Table 3. Comparison of agarose concentrations in the amplification systems of each experimental group in Example 2. Note: - before () indicates no addition, while + before () indicates the addition of the corresponding component, the concentration of which can be found in the () information; Amplification effect - indicates no amplification, + indicates an amplification curve.
[0067] PCR instrument: Convection PCR instrument; Amplification program: Reverse transcription stage: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. First amplification stage: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Second amplification stage: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.
[0068] Adding 1% low-melting-point agarose directly to the system did not optimize the amplification results; in fact, amplification failed. When the concentration of low-melting-point agarose was reduced to 0.5%, amplification occurred, but the effect was still unsatisfactory. Figure 4 This indicates that adding agarose alone does not improve the sensitivity of convective PCR and also has a negative impact. The main reason is that agarose adsorbs Mg. 2+ The concentration is insufficient due to the presence of the active site of Taq enzyme.
[0069] Example 3: To improve amplification efficiency and further optimize the amplification system, 0.5-1% (w / w) agarose, 3-5 mM MgCl2, and 0.6-1 mg / mL BSA were added to the convection PCR reaction system of Example 1. Using the primers from control group 2 in Example 1 (i.e., primers and probes P3-P1 with added interface and folding sequences), multiple control group experiments with different concentrations were set up, as shown in Table 4. The amplification conditions were the same as in Example 1.
[0070] Table 4 Comparison results of amplification systems in each experimental group in Example 3 Note: The "-" before parentheses indicates no addition, while the "+" before parentheses indicates the addition of the corresponding component; the concentration is shown in the parentheses. Amplification effect is ranked from worst to best as -, +, ++. "-" indicates no amplification curve.
[0071] like Figure 5 As shown in the results, the amplification was successful and the amplification effect was very good. The best amplification effect was achieved when 0.5% (w / w) agarose was added, along with 5 mM MgCl2 and 1 mg / mL BSA.
[0072] Example 4: Using the above design method, upstream and downstream primers for multiple pathogens were designed, namely, upstream primers were supplemented with upstream interface sequences and upstream folding sequences, and downstream primers were supplemented with downstream interface sequences and downstream folding sequences; and these primer pairs and probes (sequences are shown in Table 5) were combined for multiple system validation.
[0073] Table 5. Sequences of the designed primer pairs, probes, and internal standards. In this context, a single underscore indicates an interface sequence; a double underscore indicates a fold sequence, which is the position that forms a curved hairpin structure.
[0074] The sequences of the target nucleic acids of the aforementioned pathogens are shown in Table 6.
[0075] Table 6 Target nucleic acid sequences of pathogens Multiple experimental groups were set up for investigation. The difference between DNA and RNA is that DNA does not undergo reverse transcription, while RNA does. The specific amplification conditions are as follows: DNA: Phase 1: Lower temperature region is 95°C, upper temperature region is 95°C, duration is 300s. Phase 2: Lower temperature region is 95°C, upper temperature region is 60°C, duration is 1500s.
[0076] RNA: Reverse transcription stage: Lower temperature region is 60℃, upper temperature region is 40℃, duration is 300s. First stage: Lower temperature region is 95℃, upper temperature region is 95℃, duration is 300s. Second stage: Lower temperature region is 95℃, upper temperature region is 60℃, duration is 1300s.
[0077] The amplification system was the optimal amplification system in Example 3 (0.5% agarose, 5mM MgCl2 and 1.0mg / mL BSA), and the specific amplification system is shown in Table 7.
[0078] Table 7 Amplification system of Example 4 Experimental Group 1: Influenza A virus culture medium, influenza B virus culture medium, and adenovirus culture medium were diluted to 1×10⁻⁶ with bronchoalveolar lavage fluid. 3 Copies / mL were prepared for use. The primer pairs, probes, and internal standard combinations designed in Table 5 were used to directly perform convection PCR amplification and detection on the above samples. Results are as follows: Figure 6 As shown, the above amplification system was applied to influenza A, influenza B, adenovirus, and ACTB internal standards, and it was found to be effective for amplification, confirming that this reaction system can be used for RNA multiplex amplification.
[0079] Experimental Group 2: Nucleic acid was extracted from bronchoalveolar lavage fluid and amplified by counter-current PCR. Three sets of internal standard (GAPDH, ACTB, RHOG) primer-probe combinations were used, and detection was performed simultaneously for both DNA and RNA internal standards. Results are as follows: Figure 7 As shown, all three internal standards can be effectively amplified, confirming that this reaction system can detect different internal standards normally.
[0080] Experimental Group 3: Mycoplasma pneumoniae culture medium, adenovirus culture medium, and Chlamydia psittaci culture medium were diluted to 1×10⁻⁶ with bronchoalveolar lavage fluid. 3 Copies / mL were prepared for use. Nucleic acid was extracted from the above samples and then subjected to counter-current PCR amplification and detection. Results are as follows: Figure 8 As shown, the above amplification system was applied to Mycoplasma pneumoniae, adenovirus, Chlamydia psittaci, and GAPDH internal standards, and it was found to be effective for amplification, confirming that this reaction system can be used for DNA multiplex amplification.
[0081] Experimental Group 4: Sensitivity analysis of the detection. The influenza A virus culture medium was diluted to 1×10⁻⁶. 3 Samples at concentrations of 750 copies / mL, 500 copies / mL, and 250 copies / mL were prepared for use. Nucleic acid was extracted from these samples at different concentrations and then subjected to convection PCR amplification and detection. Results are as follows... Figure 9 As shown, specifically in Figure 9Four curves were obtained, and only the sample with a concentration of 250 copies / mL failed to amplify effectively. This confirms that the detection sensitivity can reach 500 copies / mL under this system.
[0082] Experimental Group 5: Specificity detection, using the amplification system and procedure of Experimental Group 1, detecting 1×10 6 Respiratory syncytial virus copies / mL, 1×10 6 copies / mL of SARS-CoV-2, 1×10 6 copies / mL metapneumovirus, 1×10 6 copies / mL parainfluenza virus, 1×10 6 copies / mL of Bocavirus, 1×10 6 copies / mL of Mycoplasma pneumoniae, 1×10 6 copies / mL Staphylococcus aureus, 1×10 6 Copies / mL of Streptococcus pneumoniae. As shown in Table 8, the detection results for all the above viruses were negative. This result indicates that the primer-probe combination of the present invention has excellent specificity and does not cross-react with other common respiratory pathogens and bacteria.
[0083] Table 8 Specific detection results It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.
[0084] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.
Claims
1. A method for designing convective amplification primers, characterized in that, Specifically, the following steps are included: S1: Based on the nucleotide sequence of the target nucleic acid fragment, design upstream and downstream primers for specific amplification of the target nucleic acid fragment; S2: Based on the annealing temperatures of the upstream and downstream primers, add an upstream interface sequence and a downstream interface sequence that are not complementary to the target nucleic acid sequence to the ends of the upstream and downstream primers, respectively. S3: By simultaneously adjusting a segment of the base sequence in the upstream primer and the downstream primer, an upstream fold sequence complementary to the base sequence of the upstream interface sequence and a downstream fold sequence complementary to the base sequence of the downstream interface sequence are obtained, thereby forming a curved hairpin structure in the sequences of the upstream primer and the downstream primer.
2. The method according to claim 1, characterized in that, In step S3, the upstream primer has 3-6 upstream fold sequences complementary to the upstream interface sequence; the downstream primer has 3-6 downstream fold sequences complementary to the downstream interface sequence; the upstream and / or downstream fold sequences are not complementary to the target nucleic acid sequence.
3. The method according to claim 1, characterized in that, The cytosine content in the upstream interface sequence and / or downstream interface sequence, as well as the upstream fold sequence and / or downstream fold sequence, is at least 50%.
4. The method according to claim 1, characterized in that, Both the upstream and downstream primers comprise 15-30 bases; the number of bases in the upstream interface sequence and / or downstream interface sequence, as well as the upstream fold sequence and / or downstream fold sequence, is at most 50% of the number of bases in the upstream and / or downstream primers.
5. The method according to any one of claims 1-4, characterized in that, The method for amplifying the target nucleic acid fragment in the sample using the aforementioned convection amplification primers includes a first amplification stage and a second amplification stage, both of which include an upper temperature region and a lower temperature region. The first amplification stage includes contacting the sample with the upstream primer and the downstream primer and amplifying under first amplification conditions to obtain a first amplification product. The second amplification stage includes using the first amplification product as a template and amplifying under second amplification conditions to obtain a second amplification product; In both the first and second amplification conditions, the upper temperature region is 40-95℃, and the lower temperature region is 90-100℃, with a duration of 50-1500s.
6. The method according to claim 5, characterized in that, Agarose at a concentration of 0.1-0.7% (w / w) was added to all convective amplification reaction systems.
7. The method according to claim 6, characterized in that, The reaction systems also contain 5-10 mM MgCl2 and 0.6-1 mg / mL BSA.
8. The method according to claim 7, characterized in that, The upper and lower temperature regions of the first amplification stage have the same temperature, while the lower temperature region of the second amplification stage has a higher temperature than the upper temperature region. The temperature difference between the lower and upper temperature regions is 30-40℃. During the second amplification stage, the upstream and downstream primers maintain or open their hairpin structures according to the amplification temperature during convective PCR amplification to improve amplification sensitivity.
9. The method according to claim 8, characterized in that, When the target nucleic acid fragment is RNA, the convective PCR amplification process includes a reverse transcription amplification stage before the first amplification stage, which is used to reverse transcribe the target nucleic acid fragment.
10. The method according to claim 5, characterized in that, The convective amplification primers include an upstream primer and a downstream primer. Both the upstream primer and the downstream primer include a first sequence, a second sequence, and a hairpin structure formed by the primer itself. The first sequence is complementary to the target nucleic acid fragment. The second sequence is placed at the end of the first sequence and is not complementary to the target nucleic acid fragment. The hairpin structure formed by the primer itself is formed by 3-6 bases in the first sequence forming complementary pairings with the second sequence, thereby creating a curved hairpin structure in the primer sequence.