Application of nobiletin in preparation of medicine for activating aromatic hydrocarbon receptor pathway
By activating the aryl hydrocarbon receptor pathway with nobiletin, the problem of the scarcity of AhR drugs in the existing technology has been solved, and the intestinal barrier damage and flora disorder have been improved, with significant therapeutic and preventive effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-09
- Publication Date
- 2026-05-19
AI Technical Summary
There is a lack of drugs in the current technology for activating the aryl hydrocarbon receptor (AhR) pathway, and there is a lack of drugs that are both safe and effective in improving intestinal barrier damage and regulating intestinal flora imbalance.
By activating the aryl hydrocarbon receptor pathway with nobiletin, the expression of tight junction proteins and/or the expression of pro-inflammatory factors are upregulated, thereby regulating gut microbiota-mediated tryptophan metabolism and improving intestinal barrier damage and dysbiosis.
Noriheptacorlin effectively activates the AhR pathway, improves intestinal barrier damage and regulates intestinal flora imbalance, and has important application value in the prevention or treatment of related diseases.
Smart Images

Figure CN122056871A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedical technology, and in particular to the application of noriheptacortine in the preparation of drugs that activate the aryl hydrocarbon receptor pathway. Background Technology
[0002] Aromatic hydrocarbon receptors (AhRs) are ligand-activated transcription factors widely distributed in various tissues and cells, participating in a variety of physiological and pathological processes such as cell proliferation, tissue repair, immune regulation, and oxidative stress. AhRs can be activated by a variety of endogenous and exogenous ligands: exogenous ligands include environmental pollutants such as polycyclic aromatic hydrocarbons (PAHs) and dioxins (TCDDs); endogenous ligands include tryptophan metabolites such as kynurenine (KYN), 6-formylindole[3,2-b]carbazole (FICZ), and various indole derivatives produced by gut microbiota metabolism. Studies have shown that AhR dysfunction exacerbates tissue damage and fibrosis, suggesting that AhR is a highly promising drug intervention target.
[0003] Specifically, the AhR signaling pathway is closely related to a variety of diseases. In the liver, AhR participates in chemical defense and the metabolic regulation of endogenous substances; in the kidneys, AhR participates in the regulation of oxidative stress and apoptosis; metabolites derived from gut microbiota can improve intestinal mucosal barrier damage and correct gut microbiota dysbiosis by activating AhR, thereby maintaining intestinal homeostasis. In addition, abnormal AhR signaling is also closely related to renal fibrosis, inflammatory responses, and liver and kidney tissue lesions.
[0004] Although AhR activation plays a crucial role in maintaining homeostasis, improving intestinal mucosal damage, and regulating gut microbiota dysbiosis, there is currently a lack of AhR pathway activators that are both safe and highly effective. Therefore, there is an urgent need to develop a naturally derived, highly safe drug that can effectively activate the AhR pathway to meet the practical needs of gut health maintenance and the development of related functional products. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overcome the deficiency and inadequacy of existing drugs for activating the AhR pathway, and to provide an application of noriheptacortine in the preparation of drugs that activate the aryl hydrocarbon receptor pathway.
[0006] Another object of the present invention is to provide the use of noriheptacorlin in the preparation of products that improve intestinal barrier damage and / or regulate intestinal flora imbalance.
[0007] The above-mentioned objective of this invention is achieved through the following technical solution: This invention protects the use of hesperidin in the preparation of drugs that activate the aryl hydrocarbon receptor pathway, wherein the structure of hesperidin is shown below: .
[0008] This application discloses the use of norepinephrine in the preparation of drugs that activate the aryl hydrocarbon receptor pathway. Specifically, norepinephrine can activate the aryl hydrocarbon receptor pathway by upregulating the expression of its downstream target genes, thereby upregulating the expression of tight junction proteins and / or inhibiting the expression of pro-inflammatory factors, thus achieving the effects of improving intestinal barrier damage and / or regulating intestinal flora imbalance.
[0009] Furthermore, the activation of the aryl hydrocarbon receptor pathway works by upregulating the expression of downstream target genes.
[0010] Furthermore, the target gene includes one or both of cytochrome P450 family 1 subfamily A member 1 (CYP1A1) and cytochrome P450 family 1 subfamily B member 1 (CYP1B1).
[0011] Furthermore, activation of the aryl hydrocarbon receptor pathway can upregulate the expression of tight junction proteins and / or inhibit the expression of pro-inflammatory factors.
[0012] Furthermore, the tight junction proteins include closure protein (Occludin) and / or scaffold protein (ZO-1).
[0013] Furthermore, the pro-inflammatory factors include one or more of IL-6, IL-1β, and TNF-α.
[0014] Furthermore, the mass fraction of norepinephrine in the drug is 0.01% to 0.1%.
[0015] Furthermore, the mass fraction of norepinephrine in the drug is 0.04%-0.06%.
[0016] This invention protects the use of noriheptacorlin in the preparation of products that improve intestinal barrier damage and / or regulate intestinal flora imbalance; The improvement of intestinal barrier damage or regulation of intestinal flora imbalance is achieved by noriheptacorlins through regulating tryptophan metabolism mediated by intestinal flora, thereby activating the aryl hydrocarbon receptor pathway.
[0017] Furthermore, the intestinal barrier damage or intestinal flora imbalance is caused by antibiotics.
[0018] Furthermore, the antibiotics include cephalosporin antibiotics and / or quinolone antibiotics.
[0019] Furthermore, the cephalosporin antibiotics include one or more of cefuroxime, cefaclor, and cefprozil.
[0020] Furthermore, the quinolone antibiotics include one or more of levofloxacin, ciprofloxacin, and norfloxacin.
[0021] Furthermore, the concentration of the cephalosporin antibiotic is 32-34 g / L.
[0022] Furthermore, the concentration of the quinolone antibiotic is 40-42 g / L.
[0023] Furthermore, the regulation of tryptophan metabolism mediated by gut microbiota promotes the proliferation of beneficial bacteria, thereby upregulating tryptophan metabolites in the gut.
[0024] Furthermore, the beneficial bacteria genera include one or more of the genera Bacteroides, Lactobacillus, and Akkermansia.
[0025] Furthermore, the tryptophan metabolites include one or more of indole-3-lactic acid (ILA), indole-3-propionic acid (IPA), indole-3-acetaldehyde (IAId), and indole-3-acetic acid (IAA).
[0026] Furthermore, the product includes one or more of the following: pharmaceuticals, food, health products, and animal feed.
[0027] Compared with the prior art, the present invention has the following beneficial effects: This application discloses the use of noriheptacorlinl in the preparation of drugs that activate the aryl hydrocarbon receptor pathway. Specifically, noriheptacorlinl effectively activates the aryl hydrocarbon receptor pathway by upregulating the expression of downstream target genes. The activated aryl hydrocarbon receptor pathway further upregulates the expression of tight junction proteins and / or inhibits the expression of pro-inflammatory factors, thereby achieving the effects of improving intestinal barrier damage and / or regulating intestinal flora imbalance. Therefore, noriheptacorlinl can be used as a drug for the prevention or treatment of diseases, disorders, or symptoms related to aryl hydrocarbon receptor activity, and has significant application value, especially in improving intestinal barrier damage and / or regulating intestinal flora imbalance. Attached Figure Description
[0028] Figure 1 The diagrams illustrate the treatment of intestinal mucosal damage by different treatment groups in Example 1. Figure A shows the weight gain during treatment; Figure B shows the colon length of mice after treatment; Figure C shows the cecal index of mice after treatment; and Figure D shows the spleen index of mice after treatment.
[0029] Figure 2Figure 2 shows the diversity analysis of gut microbiota screened in 16 seconds in Example 2; where Figure A is the Shannon index of α diversity; Figure B is the Simpson index of α diversity; Figure C is the principal coordinate analysis of β diversity in the wild-type mouse treatment group; and Figure D is the principal coordinate analysis of β diversity in the AhR knockout mouse group.
[0030] Figure 3 Figure A shows the relative abundance of bacteria at the phylum level in different treatment groups in Example 3; Figure B shows the relative abundance of bacteria at the genus level in different treatment groups; Figure C shows the relative abundance of Lactobacillus in different treatment groups; and Figure D shows the relative abundance of Akkermansia in different treatment groups.
[0031] Figure 4 The figures show data on targeted tryptophan metabolism in different treatment groups in Example 4. Figures A-B are cluster analysis heatmaps showing the relative concentrations of metabolites among the groups; Figure C is a statistical chart of kyna content in feces; Figure D is a statistical chart of indole-3-acetic acid (IAA) content in feces; Figure E is a statistical chart of indole-3-acetamide (IAM) content in feces; Figure F is a statistical chart of indole-3-propionic acid (IPA) content in feces; Figure G is a statistical chart of indole-3-formaldehyde (IA1d) content in feces; Figure H is a statistical chart of indolesulfonate (3IS) content in feces; Figure I is a statistical chart of indole-3-lactic acid (ILA) content in feces; and Figure J is a statistical chart of tryptophan (IET) content in feces.
[0032] Figure 5 Figure 5 shows the expression levels of AhR and its downstream pathways in different treatment groups in Example 5. Figure A shows the mRNA expression levels of AhR in different treatment groups; Figure B shows the mRNA expression levels of CYP1A1 in different treatment groups; Figure C shows the mRNA expression levels of CYP1B1 in different treatment groups; Figure D shows the electrophoretic characterization of AhR and CYP1A1 proteins in different treatment groups; Figure E shows the relative expression levels of AhR protein in different treatment groups; Figure F shows the relative expression levels of CYP1A1 protein in different treatment groups; and Figure G shows the expression levels of the inflammatory factor IL-22 in the colon in different treatment groups.
[0033] Figure 6 Figure A shows the H&E staining of colon tissue from different treatment groups in Example 6; Figure B shows the electrophoretic characterization of ZO-1 and Occludin proteins from different treatment groups; Figure C shows the statistical graph of Occludin protein expression levels from different treatment groups; Figure D shows the statistical graph of ZO-1 protein expression levels; Figure E shows the statistical graph of the relative mRNA expression levels of Occludin from different treatment groups; Figure F shows the statistical graph of the relative mRNA expression levels of ZO-1 from different treatment groups.
[0034] Figure 7 This is a schematic diagram showing the changes in the levels of inflammatory factors IL-1β (A), IL-6 (B), TNF-α (C), IL-10 (D), and SIgA (E) in the colon of different treatment groups in Example 7. Detailed Implementation
[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0036] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0037] Figure 1 A represents Figure 1 Figure A in the text, Figure 1 B indicates Figure 1 The order of the other figures follows the same pattern, starting with Figure B.
[0038] Figures 1-7 The letters (a, b, ab, bc) indicate that, at the same culture time, there is a significant difference (p<0.05) in the content between treatment groups labeled with different letters (such as a and b); there is no significant difference in the content labeled with the same letters (such as a and a or ab and ab).
[0039] Example 1: Verification of the dependence of noriheptacorlin on the AhR pathway I. Experimental Methods C57BL / 6J mice were housed at the Animal Center of South China Agricultural University. During the first week of the experiment, all mice were fed a standard diet (AIN-93G), and cage rotation was used to allow the initial gut microbiota to reach homeostasis, eliminating potential interference from maternal genetics and cage environment differences. After one week of acclimatization, the mice were randomly divided into 6 groups (n=8 per group): control group (CL), antibiotic-induced group (PCL), nobiletin treatment group (NOB), aryl hydrocarbon receptor gene knockout group (CL-KO), antibiotic-induced aryl hydrocarbon receptor gene knockout group (PCL-KO), and aryl hydrocarbon receptor gene knockout nobiletin treatment group (NOB-KO). The interventions for each group were as follows: The NOB and NOB-KO groups received 0.2 mL of a solution containing 33 g / L cefuroxime (CFX) and 41.25 g / L cefuroxime (CFX) via gavage daily. A distilled water mixture containing 33 g / L cefuroxime (CFX) and 41.25 g / L levofloxacin (LVX) was used as an antibiotic for 7 consecutive days, and the patients were given a diet supplemented with 0.05% (w / w) norepinephrine (NOB) in the AIN-93G standard diet, with free access to feed. The PCL and PCL-KO groups were administered 0.2 mL of a distilled water mixture containing 33 g / L cefuroxime (CFX) and 41.25 g / L levofloxacin (LVX) daily by gavage from day 1 of grouping for 7 consecutive days. The CL and CL-KO groups were administered 0.2 mL of the same solution by gavage. mL of distilled water was used for continuous intervention for 7 days. All mice had free access to water and maintained a consistent feeding environment throughout the experiment. During the experiment, the weight changes, diet, and water intake of each group of mice were recorded daily to dynamically monitor their growth status. After the experiment, the mice were euthanized in accordance with animal experimental ethics and humanitarian principles, and relevant tissue samples were collected. The colon length was measured immediately, the spleen and cecum were dissected and the surface attached tissues were removed, and the wet weight of both was accurately weighed for subsequent calculation of spleen index and cecum index.
[0040] II. Experimental Results The mouse body weight was continuously monitored during the experiment, and the results were as follows: Figure 1 As shown in Figure A, compared to the CL group, the PCL group showed a significant decrease in body weight, while NOB treatment alleviated this decline to some extent. In AhR gene knockout mice, the PCL-KO group experienced a significant decrease in body weight during the modeling phase, and no subsequent recovery was observed; while the NOB-KO group continued to experience a decrease in body weight during treatment, indicating that the addition of NOB after AhR gene knockout does not alleviate the antibiotic-induced weight loss. Representative images of the colon and cecum of each group of mice are shown in Figure A. Figure 1 As shown in B. Compared with the CL group, the PCL group showed a significantly shortened colon and a markedly swollen cecum, and NOB intervention could effectively reverse these changes; however, in AhR gene knockout mice, the addition of NOB did not show a similar recovery effect, and the colon remained significantly shortened.
[0041] To further quantify the aforementioned macroscopic morphological changes, this invention measured the cecal index and spleen index of each group of mice. Regarding the cecal index ( Figure 1 (C) Compared to the CL group, antibiotic exposure increased the cecal index of mice in the PCL group by 122.44% and in the PCL-KO group by 88.09%. After NOB treatment, the cecal index in the NOB group decreased by 41.39% compared to the PCL group, and in the NOB-KO group by 13.58% compared to the PCL-KO group, indicating that NOB treatment can normalize the cecal index of antibiotic-exposed wild-type mice, while the recovery effect is weakened in AhR gene knockout mice. Regarding spleen index ( Figure 1 (D) In wild-type mice, the spleen index almost completely recovered to the same level as the CL group after NOB treatment; however, compared with the PCL-KO group, the spleen index in the NOB-KO group did not recover after NOB treatment. Notably, the spleen index of AhR knockout mice (CL-KO, PCL-KO, NOB-KO) was significantly higher than that of wild-type normal mice (CL, PCL, NOB). As an important central immune organ, the spleen's index increase is closely related to immune cell activation and the level of inflammation in the body, suggesting that AhR knockout may lead to persistent immune activation and abnormal lymphocyte proliferation, thereby resulting in a significant increase in the spleen index.
[0042] In summary, the above results preliminarily indicate that the ability of NOB to alleviate intestinal damage and its systemic pathophysiological manifestations depends on the AhR gene.
[0043] Example 2: Noriheptacorlina improves gut microbiota diversity through the AhR pathway I. Experimental Methods Colonic contents were collected from mice in each group, and total fecal microbial DNA was extracted using the PowerFecal DNA Isolation Kit (Mobi BioLabs, USA). DNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA), and DNA integrity was verified by agarose gel electrophoresis to determine DNA quality and concentration. Using qualified DNA as a template, PCR amplification of the V3-V4 hypervariable region of the 16S rRNA gene was performed using specific primers. The amplified products were indexed by Nextera XT labeling kit, purified using AMPure XP magnetic beads (Beckman Coulter, USA), quantified using the Qubitds DNA BR assay kit (Lifetech, Inc.), and product quality was verified using a TapeStation 2200 (Agilent Technologies, California, USA) to construct qualified sequencing libraries. The obtained libraries were subjected to paired-end sequencing on the Illumina MiSeq platform (600-cycle kit). Raw sequencing data were assembled and filtered using Reads, then subjected to OTU clustering for noise reduction, and finally used for species annotation and abundance analysis. One-way ANOVA combined with Tukey post-hoc test was used to compare the differences in gut microbiota composition at the phylum and genus levels among the groups of mice, and multiple comparisons were corrected for. Alpha diversity indices (such as the Shannon index) were calculated using PRISM software, and β diversity was assessed using principal coordinate analysis based on the Bray-Curtis distance matrix. Linear discriminant analysis (LDA) effect size (LEfSe) method (LDA score threshold ≥4) was used to identify groups with significant differences between groups. Statistical analysis and visualization of all experimental data were performed using R software and GraphPad Prism 10.0 software.
[0044] II. Experimental Results Gut microbiota dysbiosis is one of the main causes of intestinal mucosal barrier damage. Given the central role of the gut microbiota in barrier function, this study performed high-throughput 16S rRNA gene sequencing on the colonic contents of mice in each group to analyze gut microbiota diversity and community structure changes. The Shannon index (SDI) was used to measure the gut microbiota composition. Figure 2 A) and Simpson's index ( Figure 2 B) Characterizing gut microbiota α-diversity. The Shannon index reflects species richness, while the Simpson index characterizes the diversity and evenness of species distribution within the community. Sequencing results showed that antibiotic exposure (PCL) caused a significant decrease in both the Shannon and Simpson indices, indicating a decline in gut microbiota diversity and richness. NOB treatment could alleviate these changes, while in AhR gene knockout mice, NOB failed to exert a similar restorative effect.
[0045] Furthermore, this study employed principal coordinate analysis (PCoA) based on Bray-Curtis distance to assess β-diversity, revealing the similarity of gut microbiota composition among the mouse groups. The results are as follows: Figure 2 C~ Figure 2 As shown in Figure D, the gut microbiota composition of the PCL group mice differed significantly from that of the CL group after antibiotic exposure. In wild-type mice, the microbiota composition of the NOB-treated group was closer to that of the CL group, suggesting a recovery of the microbiota structure towards a normal state; however, in AhR knockout mice, the NOB-KO group did not show a species composition more similar to the CL-KO group. Notably, in both wild-type and AhR knockout mice, samples from all NOB-treated groups showed a certain degree of aggregation in the PCoA plot, indicating that NOB has a partial restorative effect on the gut microbiota, but this effect was significantly weakened after AhR knockout. These results are consistent with the pathological changes described above, suggesting that the function of NOB in remodeling the gut microbiota structure may be synergistically regulated by the AhR pathway.
[0046] Example 3: Noriheptacorlina improves the composition and structure of gut microbiota through the AhR pathway. I. Experimental Methods The extraction, purification, and high-throughput sequencing methods for total fecal microbial DNA were the same as in Example 2. One-way ANOVA combined with Tukey post-hoc test was used to compare the differences in the composition and relative abundance of intestinal flora at the phylum and genus levels among the groups of mice. The significance level was set at p<0.05. Statistical analysis and visualization of all experimental data were performed using R software and GraphPadPrism 10.0 software.
[0047] II. Experimental Results To compare the overall structure and composition of the gut microbiota in different groups of mice, this study analyzed the data at both the phylum and genus levels. Overall comparative analysis showed that AhR gene knockout significantly altered the basic gut microbiota structure. Compared with the CL group, the CL-KO group showed significant differences at all taxonomic levels, suggesting that AhR gene deletion independently affects gut microbiota colonization and homeostasis.
[0048] At the level of the door ( Figure 3(A) Compared with the CL group, the relative abundance of Firmicutes in the PCL group decreased from 53.24% to 30.68%, a decrease in relative abundance (P<0.001), while the relative abundance of Bacteroidetes increased from 42.81% to 68.94%, an increase in relative abundance (P<0.001). After NOB treatment, the relative abundance of both phyla tended to recover, with Firmicutes rising to 45.09% (P<0.01) and Bacteroidetes decreasing to 54.91% (P<0.01), and the Firmicutes / Bacteroidetes ratio returning to steady-state levels. However, in AhR gene knockout mice, the recovery effect of NOB was significantly weakened. In the PCL-KO group, Firmicutes decreased from 44.36% to 22.17%, with a relative decrease in abundance (P<0.001). After NOB treatment, the relative abundance of Firmicutes in the NOB-KO group did not recover significantly (P>0.05).
[0049] Genus-level analysis further confirmed the key role of AhR in mediating NOB regulation of key bacterial genera. Figure 3 B). In wild-type mice, NOB effectively restored the relative abundance of Bacteroides and Lactobacillus. Bacteroides were 3.61%, 36.2%, and 18.29% in the CL, PCL, and NOB groups, respectively (P<0.001), while Lactobacillus were 4.44%, 0.00%, and 3.81%, respectively (P<0.001). Figure 3C). Conversely, antibiotic exposure led to a significant increase in the relative abundance of Clostridium (from 0.00% to 4.30%, P<0.001), and the recovery effect of its relative abundance after NOB treatment was significantly reduced (from 4.30% to 1.81%, P<0.001). Furthermore, NOB treatment also partially restored the relative abundance of beneficial bacteria, including Ligilactobacillus and Lachnoclostridium. In AhR knockout mice, antibiotic exposure resulted in a significant reduction or disappearance of various bacterial flora originally present in the CL-KO group, such as Mucispirillum, Faecalibaculum, Dubosiella, uncultured Coriobacteriaceae-UCG, and Lactobacillus, and NOB treatment failed to reverse these dysbiosis. Compared to the PCL-KO group, the abundance of bacteria such as Robinsoniella and Clostridioides in the NOB-KO group did not show a significant recovery. Notably, Akkermansia, which plays an important protective role in the intestinal mucosal barrier, was significantly reduced in both wild-type and AhR knockout mice due to antibiotic exposure, but its recovery depended on AhR function: NOB abundance recovered only in wild-type mice, while it remained suppressed in AhR knockout mice. Figure 3 D).
[0050] The above results indicate that, compared with the PCL group, NOB can promote the growth of beneficial bacteria such as Bacteroides, Lactobacillus, and Akkermansia, while inhibiting the abnormal proliferation of harmful bacteria such as Clostridium difficile, thereby improving gut microbiota dysbiosis. Knockout of the AhR gene not only disrupted gut microbiota colonization and homeostasis but also weakened the positive regulatory effect of NOB on gut microbiota homeostasis, further confirming that the AhR pathway is an important target for NOB to effectively restore the gut microbial ecosystem. This provides a gut microbiota-level basis for subsequent investigations into the mechanism of action of NOB through the "gut microbiota-mediated-tryptophan metabolism-AhR signaling pathway activation" axis.
[0051] Example 4: Noriheptacorlina regulates the production of tryptophan metabolites through the AhR pathway I. Experimental Methods The analysis of metabolites in mouse feces using precise targeted metabolomics methods includes the following steps: The tryptophan metabolism-related standards used in the experiment included: kynurenic acid (Kyna), 3-indolepropionic acid (IPA), 3-indoleacetic acid (IAA), indole-3-acetamide (IAM), indole-3-lactic acid (ILA), indole-3-ethanol (IET), indole-3-carboxaldehyde (IA1d), and indoxyl sulfate (3IS). The above standards were accurately weighed to prepare a mixed standard stock solution, which was then serially diluted with methanol to obtain a series of working solutions of different concentrations. Simultaneously, an isotope internal standard solution of appropriate concentration was prepared, mixed thoroughly, and used as the internal standard working solution (IS). All stock solutions, working solutions, and internal standard solutions were stored at -20 °C.
[0052] Fecal samples were thoroughly ground in liquid nitrogen. The ground sample was then added to mass-grade pure water and vortexed to mix. 100 μL of the diluted sample was mixed with 300 μL of 80% methanol solution containing the mixed internal standard. After vigorous homogenization, the mixture was incubated on ice for 10 min, followed by centrifugation at 4 ℃ and 15000 rpm for 15 min. The supernatant was filtered through a 0.45 μm organic filter and transferred to a sample vial, stored at 4 ℃ in the dark until analysis. Quantitative analysis of tryptophan and its related metabolites was performed using a liquid chromatography-mass spectrometry system (AB Sciex QTRAP 6500+ mass spectrometer and AB SciexExionLCTMAD liquid chromatograph). Chromatographic conditions: A Waters HSS T3 column (2.1 × 150 mm) was used at a column temperature of 40 ℃. The injection volume was 2 μL, and the flow rate was 0.3 mL / min. Mobile phase A consisted of 0.1% formic acid aqueous solution containing 5 mM ammonium acetate; mobile phase B consisted of 0.1% formic acid acetonitrile solution. Mass spectrometry conditions: An electrospray ionization (ESI) source was used at an ion source temperature of 550 ℃. The positive / negative ion mode voltages were 4500 V / -4500 V, respectively. The sheath gas pressure was 35 psi, the auxiliary gas pressure was 50 psi, and the collision gas pressure was 55 psi. The scanning mode was multiple reaction monitoring (MRM).
[0053] This method was validated according to the U.S. Food and Drug Administration (FDA) guidelines for bioanalysis. Results showed recoveries of 85%–115%, relative standard deviations (RSD) <15%, and accuracy and precision meeting the requirements for quantitative analysis. Statistical analysis of all data was performed using R software and GraphPad Prism 10.0 software.
[0054] II. Experimental Results As the gut microbiota analysis results presented earlier indicate, NOB promotes the growth of beneficial bacteria such as *Bacteroides*, *Lactobacillus*, and *Akkermansia*. Among these, *Lactobacillus*, as a core executor of tryptophan metabolism, directly influences the production of tryptophan metabolites due to changes in their abundance. Given the crucial role of gut microbiota-mediated tryptophan (Trp) metabolism in intestinal barrier regulation, and the fact that many tryptophan metabolites can serve as endogenous ligands for aryl hydrocarbon receptors (AhRs), this study further investigates whether NOB exerts a protective effect in an antibiotic exposure model by modulating this metabolic axis.
[0055] Targeted metabolomics technology was used to analyze fecal metabolites in each group of mice. The results of cluster analysis heatmaps are shown below. Figure 4 A~ Figure 4 As shown in Figure B, antibiotic exposure (PCL group) significantly altered the composition of fecal metabolites compared to the CL group, while NOB intervention partially restored metabolite levels to normal. In AhR gene knockout mice, the degree of metabolite alteration induced by antibiotic exposure (PCL-KO group) was reduced compared to the CL-KO group, and the restorative effect of NOB on metabolites was also significantly reduced due to AhR gene knockout. These results indicate that antibiotic-induced metabolite alterations and their reversal by NOB are evident in wild-type mice, but not in AhR-KO mice, revealing that AhR plays a crucial role in this regulatory process.
[0056] Next, the tryptophan metabolites in the feces of mice in each group were further quantitatively analyzed, and the results are as follows: Figure 4 C- Figure 4 As shown in Figure J, antibiotic exposure caused significant changes in the levels of various amino acid metabolites: the levels of AhR ligand activators such as Kyna, IAA, IAM, IPA, and Iald were significantly decreased, while the levels of 3IS, ILA, and IET were significantly increased. NOB intervention could reverse these changes, indicating that NOB can alleviate antibiotic-induced tryptophan metabolism disorders. In the context of AhR gene knockout, compared with the CL-KO group, the levels of metabolites such as IAA, IAM, IPA, 3IS, and IET in the PCL-KO group did not change significantly due to antibiotic exposure; at the same time, the regulatory effect of NOB intervention on metabolites was also significantly reduced. In addition, compared with the CL group, the levels of Kyna, IAM, IAA, and ILA in the CL-KO group were significantly decreased, while the levels of IPA and IAld were significantly increased, indicating that AhR knockout itself has greatly altered the tryptophan metabolome, making it essentially unresponsive to antibiotic perturbation and NOB intervention.
[0057] In summary, AhR knockout has a far greater impact on tryptophan metabolism than antibiotic exposure or NOB intervention, and the restorative effect of NOB on AhR knockout mice is significantly weakened or even completely absent. This result further confirms that AhR is a core regulator in the gut microbiota-tryptophan metabolic axis, and that NOB exerts a protective effect against antibiotic-induced intestinal barrier damage by regulating this metabolic axis.
[0058] Example 5: Verification of the activating effect of noriheptacorlin on the AhR pathway This study targeted AhR, CYP1A1, and CYP1B1 as genes to analyze the effects of norihesperidin on the mRNA expression of key genes in the AhR pathway at the transcriptional level.
[0059] I. Experimental Methods 1. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) (1) Primer design and synthesis. Primers were designed according to the NCBI database, following the primer design principles (GC content 40%~60%, primer length 15~25 bp, Tm value 60~63 ℃, Tm difference between upstream and downstream primers <2 ℃, amplicon length 60~350 bp), and validated by the PrimerBank and Primer-Blast databases. Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and their specificity and amplification efficiency were evaluated by PCR amplification and melting curves. The primer sequences for each gene are as follows: AhR: front primer (5′–3′) GAGCTTCTTTGATGGCGCTG, back primer (5′–3′) GTCCACTCCTTGTGCAGAGT; CYP1A1: front primer (5′–3′) AGGTGGTAGTTCTTGGAGCTT, back primer (5′–3′) CATGATCTAGGTGGCTGCTTG; CYP1B1: front primer (5′–3′) GCCTGCCACTATTACGGACA, back primer (5′–3′) CTGAACATCCGGGTATCTGGTA; GAPDH: front primer (5′–3′) TGGAGAAACCTGCCAAGTATGA, back primer (5′–3′) TGGAAGAATGGGAGTTGCTGT.
[0060] (2) RNA extraction and concentration determination. First, take about 1.50 cm of small intestine tissue and place it in a 2 mL enzyme-free centrifuge tube. Add 3 magnetic beads, and add reagents at a ratio of 1 mL Trans Zol Up and 0.2 mL RNA Extraction Agent per 100 mg of tissue. Grind thoroughly in a pre-cooled bead mill for 6 min, let stand for 5 min, then shake at room temperature for 5 min. Centrifuge at 4 ℃ and 10000×g for 15 min. After centrifugation, the sample is divided into three layers: a colorless aqueous phase (upper layer, containing RNA), a middle layer, and a pink organic phase (lower layer). The volume of the aqueous phase is about 50% of the volume of the Trans Zol Up reagent used. Carefully transfer the aqueous phase to a new centrifuge tube. Add isopropanol at a ratio of 0.5 mL isopropanol per 1 mL Trans Zol Up, mix by inversion, incubate at room temperature for 10 min, and centrifuge at 4 ℃ and 10000×g for 10 min. Discard the supernatant. A gelatinous precipitate will be visible on the sides and bottom of the tube. Add 1 mL of 75% ethanol (prepared with DEPC-treated water), vortex vigorously, and centrifuge at 7500×g for 5 minutes at 4 °C. Discard the supernatant, removing as much ethanol as possible, and air-dry the precipitate at room temperature for about 5 minutes. Dissolve the precipitate in 80 µL of RNA lysis buffer and incubate at 60 °C for 10 minutes to promote dissolution. Determine the RNA concentration using a NanoDrop ND-1000 spectrophotometer. Store the sample at -80 °C for later use.
[0061] (3) Reverse transcription to synthesize cDNA. Calculate the sample volume based on the RNA concentration (1 μg RNA required, sample volume V=2000 / C), add the RNA sample to the 8-well tubes in the predetermined order, and add enzyme-free water to make the total volume of each well 10 μL. Prepare the reaction system according to the cDNA reverse transcription kit instructions: 4 μL of 5×RT MasterMix and 1 μL of 20×Oligo dT & Random Primer. After mixing, centrifuge to remove air bubbles, and perform the reaction on a PCR instrument according to the recommended procedure of the reverse transcription kit. After the reaction, add 80 µL of enzyme-free water to each well to dilute the cDNA, mix, centrifuge, and store at -80 ℃ for later use.
[0062] (4) Real-time quantitative PCR amplification: Amplification was performed using the Universal SYBR Qpcr Master Mix kit (Biosharp, Beijing, China). The reaction mixture (prepared in an 8-tube PCR apparatus) consisted of 2×UniversalSYBR qPCR Mix, ROX Reference Dye, cDNA template, primers, and RNase-free ddH2O. After mixing and brief centrifugation, Real-Time PCR was performed according to the kit's recommended procedure. The Ct value method (2...) was used to compare the results.-ΔΔCt Calculate the relative expression level of the target gene relative to GAPDH mRNA.
[0063] 2. Western blot analysis of proteins Western blotting (WB) is used to detect the expression levels of the aryl hydrocarbon receptor (AhR protein) and its downstream protein cytochrome P450 1A1 (CYP1A1 protein).
[0064] (1) Extraction of total protein from colon tissue Colon tissue was collected and washed with pre-cooled PBS to remove residual blood and remove as much lipid as possible. The tissue was placed in a centrifuge tube and operated on ice. Western lysis buffer, IP cell lysis buffer (without inhibitors), EDTA, protease inhibitor, and phosphatase inhibitor were mixed in the specified ratio, vortexed, and centrifuged to obtain a mixed lysis buffer. Lysis buffer and magnetic beads were added at a ratio of 10 mg tissue to 100 μL of mixed lysis buffer, and the mixture was ground in a bead mill (grinding conditions: 60 Hz, 20 sec, incubation on ice for 5 min, cycle 3 times). After grinding, the mixture was centrifuged at 4 ℃ and 13000 rpm for 15 min, and the supernatant was collected as the total protein sample.
[0065] (2) Preliminary quantitative analysis of protein samples A standard curve was prepared using bovine serum albumin (BSA) standards. The protein sample was diluted 30-fold. 20 μL of the standard and the diluted sample were added to each well of a 96-well plate, with 200 μL of BCA working solution (solution A:solution B = 50:1, freshly prepared) added. The plate was incubated at 37 ℃ for 30 min. The absorbance (OD value) at 562 nm was measured using a microplate reader. The standard curve was calculated as y = 1.069x + 0.1499, R0. 2 =0.9992, calculate the protein concentration based on the sample OD value. Adjust the protein concentration of each sample to 3 μg / μL, add 1 / 4 volume of SDS-PAGE protein loading buffer, mix well, and heat in a 95 ℃ metal bath for 10 min to denature the protein. Store the samples at -20 ℃ for later use.
[0066] (3) Electrophoresis Prepare the electrophoresis buffer (prepared with distilled water at -4 ℃), assemble the electrophoresis apparatus, and install the SDS-PAGE gel. Add the electrophoresis buffer to the inner tank, ensuring the liquid level exceeds the top of the sample wells, and remove any air bubbles. Load equal amounts of protein samples and molecular weight markers sequentially. Electrophoresis conditions: run at 80 V for 5 min, then increase to 160 V and run for 30 min.
[0067] (4) Transfer membrane The PVDF membrane was picked up with tweezers, activated by immersion in activation solution, and rinsed with Western spectroscopy rapid transfer buffer. A "sandwich" structure was prepared in the following order: transfer liner – three layers of filter paper – gel – PVDF membrane – three layers of filter paper – transfer liner, ensuring no air bubbles between layers. Transfer was performed at a constant current of 400 mA for 30 min.
[0068] (5) Antibody staining Remove the PVDF membrane and wash it with TBSTw solution (TBS with Tween-20, washing buffer) on a shaker at low speed for 5 min, repeating 3 times. Discard the washing buffer and add rapid blocking buffer, blocking on a shaker at room temperature for 15 min. Discard the blocking buffer and wash the membrane 3 times with washing buffer, 5 min each time. Add primary antibody dilution buffer (GAPDH, 1:1000; AhR, 1:1000; CYP1A1, 1:2000) and incubate overnight at 4°C. The next day, wash the membrane 3 times with washing buffer, 5 min each time. Add the corresponding secondary antibody dilution buffer (Anti-mouse IgG, HRP-linked Antibody, 1:3000; goatanti-rabbit IgG-HRP 1:2000) and incubate at room temperature for 1 h. Wash the membrane 3 times with washing buffer, 5 min each time. Next, BeyoECL Moon A solution and BeyoECL Moon B solution were mixed in a 1:1 ratio, and the PVDF membrane was immersed in the mixture for 1 min under light-protected conditions. Automatic exposure was performed using a chemiluminescence imager, and the relative protein content was analyzed using ImageJ software.
[0069] 3. ELISA The expression level of interleukin-22 (IL-22) in the colon tissue of mice in each group was detected by enzyme-linked immunosorbent assay (ELISA), and its correlation with AhR signaling pathway activation was analyzed. The specific procedures are as follows: (1) Sample processing: After weighing the tissue sample, add magnetic beads, add the sample and PBS to pre-cooled PBS at a weight-to-volume ratio of 1:9, and grind thoroughly on a grinder. Centrifuge the homogenate at 5000×g for 8 min, and take the supernatant for later use.
[0070] (2) Reagent preparation: The kit should be equilibrated at room temperature for 60 min before use. Dilute 30× concentrated wash buffer with distilled water at a ratio of 1:30 (1 part 30× wash buffer to 29 parts distilled water), mix well and set aside.
[0071] (3) Operating steps: Remove the required strips from the aluminum foil bag, seal the remaining strips and store them at 4 ℃. Set up standard wells and sample wells. Add 50 μL of different concentrations of standard to the standard wells (concentrations of 480, 320, 160, 80, and 40 pg / mL, respectively). Add 10 μL of the sample to be tested to the sample wells, followed by 40 μL of sample diluent (the final sample dilution is 5 times). Do not add any sample to the blank wells. Except for the blank wells, add 50 μL of enzyme-labeled reagent to each of the standard and sample wells. Seal the reaction wells with sealing film and incubate at 37 ℃ for 30 min. Carefully tear off the sealing film, discard the liquid in the wells, pat dry on absorbent paper, fill each well with washing buffer (about 350 μL), let stand for 30 sec, discard the washing buffer, pat dry, and repeat the washing 5 times. Add 50 μL each of chromogenic reagent A and B to each well, gently shake to mix, and incubate at 37 ℃ in the dark for 10 min. Add 50 μL of stop solution to each well to stop the reaction (the blue color turns yellow). Within 15 min after termination, zero the instrument with blank wells and measure the absorbance (OD value) of each well at 450 nm using a grating microplate reader.
[0072] (4) Calculation of experimental results: Plot a standard curve with the concentration of the standard on the ordinate and the corresponding OD value on the abscissa to obtain a linear regression equation. Substitute the OD value of the sample into the equation to calculate the concentration of the analyte in the sample.
[0073] II. Experimental Results Studies have shown that various metabolites produced by gut microbiota-mediated Trp metabolism are considered ligands of AhR, which can directly activate key signaling pathways of AhR and its downstream pathways, thereby improving intestinal mucosal damage and maintaining gut health. Based on the discovery that NOB can regulate gut microbiota and promote tryptophan metabolism to produce AhR ligand precursors, this study further directly verified whether NOB activates the AhR signaling pathway in vivo, and verified the regulatory role of nobiletin on the AhR pathway and its downstream effector molecules at the protein and transcriptional levels. The results are as follows: like Figure 5 A~ Figure 5As shown in Figure C, in wild-type mice, antibiotic-induced dysbiosis significantly suppressed the mRNA levels of AhR, CYP1A1, and CYP1B1, leading to a significant decrease in the expression levels of all three in the PCL group. After NOB treatment, the expression levels of the three genes recovered to near-normal levels. Compared with the PCL group, the expression of AhR, CYP1A1, and CYP1B1 in the NOB group increased by approximately 3.9-fold, 4.5-fold, and 2.5-fold, respectively. In AhR gene knockout mice, compared with the CL group, the AhR gene expression level in the CL-KO group was extremely low, indicating that the AhR gene was successfully knocked out with a knockout efficiency close to 100%. In this context, neither antibiotic exposure nor NOB intervention caused any changes in AhR expression. Furthermore, although CYP1A1 and CYP1B1 were downregulated to some extent in the PCL-KO group, the downregulation was less than that in the wild-type mouse group; although NOB intervention (NOB-KO group) slightly upregulated the expression of both genes, the recovery effect was significantly weaker than that in the wild-type group. The above results indicate that NOB's regulation of downstream AhR pathways depends on the presence of functional AhR, and AhR is a key mediator for NOB's regulatory role. Protein-level results further validated the gene-level findings, such as... Figure 5 D~ Figure 5 As shown in Figure F, antibiotic exposure led to decreased expression of AhR and CYP1A1 proteins in wild-type mice, while NOB administration significantly increased their expression levels, whereas this effect was not observed in AhR knockout mice. These results further confirm the crucial role of AhR signaling in NOB's amelioration of intestinal mucosal damage.
[0074] Because AhR activation can enhance intestinal epithelial barrier function and improve intestinal mucosal damage by inducing IL-22 expression, this study further examined the level of IL-22 in colonic tissue, and the results are as follows: Figure 5 As shown in G. Antibiotic exposure reduced IL-22 concentration by approximately 40% compared to the CL group, while NOB treatment effectively restored it to near baseline levels in wild-type mice. Notably, this recovery effect was almost completely absent in AhR knockout mice.
[0075] In summary, the restorative effect of NOB on the intestinal barrier depends on AhR. By regulating gut microbiota-mediated Trp metabolism, AhR signaling and its downstream pathways are activated, thereby improving intestinal barrier function. These results directly demonstrate that AhR is an indispensable mediator of the NOB-triggered cellular protective signaling cascade, organically linking NOB-induced upstream microbial and metabolic changes with downstream enhancement of intestinal barrier function, thus establishing the "gut microbiota-tryptophan metabolism-AhR" axis as the core mechanism pathway.
[0076] Example 6: Detection of intestinal permeability of noriheptacorlins in repairing intestinal barrier function via the AhR pathway. I. Experimental Methods 1. Histological analysis (1) Embedding and sectioning: The prepared colon tissue was embedded in liquid paraffin and rapidly cooled to solidify the paraffin and fix the colon tissue. The embedded paraffin block was cut into 5μm thick sections using a paraffin microtome. The sections with complete colon tissue sections were fully spread in warm water, then picked up with a glass slide and placed in the center of the slide. The slides with tissue sections were transferred to a 60 ℃ oven to dry for 2 hours to ensure tight adhesion between the tissue and the slide.
[0077] (2) Dewaxing and hydration: To remove paraffin from the tissue sections, the sections were washed three times with xylene (20 min each time) to dewax them, facilitating subsequent tissue staining and section observation. Then, the sections soaked in xylene were sequentially immersed in 100%, 100%, 95%, 85%, and 75% ethanol for 5 min each to ensure complete hydration. Finally, they were washed with distilled water for 5 min, thus completing the dewaxing and hydration process.
[0078] (3) Staining: The hydrated colon sections were stained with hematoxylin for 5 min, rinsed with distilled water, and then differentiated using a 1% (v / v) hydrochloric acid-ethanol solution to remove excess hematoxylin from the nucleus and cytoplasm. The differentiated sections were washed with distilled water, and the tissue was observed to be red under a microscope. Subsequently, the sections were soaked in PBS until the tissue turned blue, and then stained with eosin for 3 min. After the tissue was fully stained, it was rinsed with distilled water.
[0079] (4) Dehydration, mounting and observation of sections: The sections were dehydrated in a gradient manner with 95%~100% alcohol solution for 5 min at each stage. The sections were then removed and soaked in xylene twice for 10 min each time. The sections were dried and mounted with neutral resin. After mounting, images were acquired using a regular optical microscope at a magnification of 40×10.
[0080] 2. Western blot analysis of proteins The protein immunoblotting method is the same as in Example 5, except that the primary antibody is replaced with Occludin (1:1000) and ZO-1 (1:1000).
[0081] 3. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Method The qRT-PCR method was the same as in Example 5, except that the primer sequences were replaced as follows: Occludin, front primer (5′–3′) ATGTCCGGCCGATGCTCTC, back primer (5′–3′) TTTGGCTGCTCTTGGGTCTGTAT; ZO-1, front primer (5′–3′) TTTTTGACAGGGGGAGTGG, back primer (5′–3′) TGCTGCAGAGGTCAAAGTTCAAG. Intestinal permeability was assessed at the gene level by measuring the mRNA expression levels of Occludin and ZO-1.
[0082] II. Experimental Results The physical barrier formed by the intestinal mucosal epithelium is a complete defense system composed of intestinal epithelial cells and various connection structures between them. Its core lies in the complex connection system formed between epithelial cells through specific junctional proteins, mainly including tight junctions, adhesion junctions, and desmosomes. Figure 6 As shown in Figure A, the pathological characteristics of colon tissue sections from mice in each group were observed using hematoxylin and eosin (H&E) staining. In the CL and CL-KO groups, the distal colonic mucosa structure was intact, the crypt morphology was normal, and goblet cells were abundant. Compared with the CL and CL-KO groups, the PCL and PCL-KO groups, after antibiotic exposure, showed damaged crypt structure, a significantly reduced number of goblet cells, and markedly disrupted colonic tissue morphology. After NOB intervention, the abnormal colonic crypt structure and decreased goblet cell count in the NOB group were restored, while the colonic crypt structure and goblet cell count in the NOB-KO group showed no significant improvement compared to the PCL-KO group.
[0083] Tight junctions are crucial in the physical barrier structure of the intestinal mucosa, serving as a core factor determining mucosal permeability and widely regarded as a marker of intestinal mucosal barrier integrity. Tight junctions effectively prevent the passage of pathogens, toxins, and undigested macromolecules by regulating the permeability of paracellular pathways, thereby maintaining the stability of the intestinal internal environment and ensuring the continuity and selective barrier function of the epithelial layer. Therefore, to further evaluate the impact of NOB on the intestinal mucosal physical barrier, this study used RT-qPCR and Western blot experiments to detect the relative expression levels of Occludin and ZO-1 at the gene and protein levels in the colon of mice in each group. The Western blot results are as follows: Figure 6 B~ Figure 6As shown in Figure D, after antibiotic exposure, the relative protein expression levels of Occludin and ZO-1 were significantly reduced in both the PCL and PCL-KO groups. After NOB treatment, the expression levels of both proteins significantly recovered in the NOB group; however, in the AhR gene knockout background, the expression levels of both proteins did not significantly recover in the NOB-KO group. RT-qPCR analysis further confirmed this trend. Figure 6 E~ Figure 6 (F) Following antibiotic exposure, the mRNA levels of Occludin and ZO-1 were significantly reduced in the PCL and PCL-KO groups. NOB intervention effectively restored the transcriptional levels of the two proteins in wild-type mice, but this restoration effect was almost completely lost in AhR knockout mice.
[0084] In summary, NOB activates the AhR signaling pathway, inducing downstream IL-22 secretion, which in turn upregulates the gene transcription and protein expression of tight junction proteins such as Occludin and ZO-1, effectively improving antibiotic-induced colonic histopathological damage and restoring the structural and functional integrity of the intestinal mucosal barrier. After AhR gene knockout, both the ameliorative effect of NOB on the intestinal mucosal barrier and its regulatory effect on tight junction proteins were significantly weakened, further confirming that NOB's intestinal mucosal barrier repair function depends on the AhR signaling pathway.
[0085] Example 7: Noriheptacorlina regulates the expression of related inflammatory factors in the intestinal barrier through the AhR pathway. I. Experimental Methods The protein expression levels of pro-inflammatory factors interleukin-1β (IL-1β), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), anti-inflammatory factors interleukin-10 (IL-10), and secretory immunoglobulin A (SIgA) in the colon tissue of mice in each group were detected by enzyme-linked immunosorbent assay (ELISA) to analyze the relationship between NOB, AhR, and inflammatory response. The specific operation was the same as in Example 5.
[0086] II. Experimental Results The intestinal mucosal immune barrier, as the command center of adaptive immunity, is responsible for specific recognition, memory, and precise response. It is deeply integrated with and interdependent with the physical barrier, jointly maintaining intestinal homeostasis. Intestinal inflammation imbalance is a significant trigger for barrier damage, while barrier function recovery can conversely regulate the immune inflammatory state. Among these, inflammatory factors are the most typical biomarkers of the immune inflammatory state. This study detected the levels of multiple inflammatory factors (IL-1β, IL-6, IL-10, TNF-α, and SIgA) in the colon of mice. like Figure 7 A~ Figure 7As shown in Figure C, after antibiotic exposure, the levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α in the PCL group increased by 1.64-fold, 1-fold, and 1.15-fold, respectively, compared to the CL group, while the levels of anti-inflammatory factors IL-10 and SigA decreased by 39.44% and 31.97%, respectively. Figure 7 D~ Figure 7 The results (E) suggest that antibiotics can induce intestinal immune imbalance in mice, triggering inflammatory responses and subsequently disrupting the integrity of the intestinal mucosal barrier. Treatment with NOB significantly reversed the abnormal levels of these inflammatory factors. Compared to the PCL group, the NOB group showed a 44.8% decrease in pro-inflammatory factors IL-1β, IL-6, and TNF-α, a 33.11% decrease in IL-6, and a 44.15% decrease in TNF-α, while anti-inflammatory factors IL-10 and SigA recovered by 30.08% and 25.03%, respectively. This indicates that NOB can effectively reverse the abnormal expression of antibiotic-induced intestinal cellular inflammatory factors and exert an anti-inflammatory effect. However, in AhR gene knockout mice, NOB failed to significantly reverse the abnormal changes in inflammatory factors induced by antibiotics, indicating that the regulatory effect of NOB on inflammatory factors is significantly weakened under AhR gene knockout conditions. This result suggests that AhR is an important molecular basis for NOB's protective effect on the intestinal barrier and is crucial for NOB to restore intestinal mucosal barrier function in mice.
[0087] In summary, this study is the first to systematically demonstrate that NOB repairs the intestinal mucosal barrier by regulating gut microbiota-mediated tryptophan metabolism and activating AhR and its downstream signaling pathways, and identifies AhR as a key target for NOB's protective effects. The core mechanism is as follows: NOB can regulate the gut microbiota structure, promoting the growth of beneficial bacteria such as Bacteroides, Lactobacillus, and Akkermansia, while inhibiting the abnormal proliferation of harmful bacteria such as Clostridium difficile, thereby restoring gut microbiota-mediated tryptophan metabolism and upregulating the metabolic levels of AhR ligand activators such as Kyna, IAA, IAM, IPA, and IAld. These endogenous ligands activate AhR signaling pathways. Following the activation of the α1 pathway, the transcription and protein expression of AhR and its downstream target genes CYP1A1 and CYP1B1 are upregulated, inducing the secretion of the downstream effector cytokine IL-22. This, in turn, maintains intestinal homeostasis through a dual effect: on the one hand, it upregulates the expression of tight junction proteins such as Occludin and ZO-1, repairing pathological damage to colonic tissue and restoring the structural and functional integrity of the intestinal mucosal barrier; on the other hand, it corrects the imbalance between the expression of pro-inflammatory factors (IL-6, IL-1β, TNF-α) and anti-inflammatory factors (IL-10, SIgA), inhibiting excessive intestinal inflammatory responses. This forms a regulatory mechanism axis of "NOB → gut microbiota-mediated → tryptophan metabolite regulation → AhR pathway activation → intestinal barrier repair + anti-inflammatory balance → improved overall mouse phenotype." This discovery not only deepens the understanding of the mechanism of action of NOB prebiotics but also provides new theoretical basis for the development of drugs that activate the aryl hydrocarbon receptor pathway.
[0088] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of noriheptacorlin in the preparation of drugs that activate the aryl hydrocarbon receptor pathway, characterized in that, The structure of the nodocitrin is shown below: 。 2. The application according to claim 1, characterized in that, The activation of the aryl hydrocarbon receptor pathway works by upregulating the expression of downstream target genes.
3. The application according to claim 2, characterized in that, The target genes include one or both of the following: member A of cytochrome P450 family 1 subfamily and member B of cytochrome P450 family 1 subfamily.
4. The application according to claim 1, characterized in that, Activation of the aryl hydrocarbon receptor pathway can upregulate the expression of tight junction proteins and / or inhibit the expression of pro-inflammatory factors.
5. The application according to claim 4, characterized in that, The tight junction proteins include closure proteins and / or scaffold proteins.
6. The application according to claim 4, characterized in that, The pro-inflammatory factors include one or more of IL-6, IL-1β, and TNF-α.
7. The application according to claim 1, characterized in that, The mass fraction of norepinephrine in the drug is 0.01% to 0.1%.
8. Application of noriheptacorlina in the preparation of products that improve intestinal barrier damage and / or regulate intestinal flora imbalance; The improvement of intestinal barrier damage or regulation of intestinal flora imbalance is achieved by noriheptacorlins through regulating tryptophan metabolism mediated by intestinal flora, thereby activating the aryl hydrocarbon receptor pathway.
9. The application according to claim 8, characterized in that, The intestinal barrier damage or intestinal flora imbalance was caused by antibiotics; Preferably, the antibiotics include cephalosporin antibiotics and / or quinolone antibiotics.
10. The application according to claim 8, characterized in that, The regulation of tryptophan metabolism mediated by gut microbiota promotes the proliferation of beneficial bacteria, thereby upregulating tryptophan metabolites in the gut.