Bacillus subtilis sequential promoter and application thereof
By constructing a random mutant library of Bacillus subtilis time-sequence promoters and screening out highly efficient promoter mutants, the problem of low expression intensity of existing promoters was solved, protein expression levels were increased, growth and production were synchronized during fermentation, and the synthetic biology toolbox was enriched.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BEIJING LIFE SCIENCE ACADEMY CO LTD
- Filing Date
- 2026-01-23
- Publication Date
- 2026-05-19
AI Technical Summary
Existing Bacillus subtilis sequential promoters have low expression intensity, which cannot meet the needs of industrial biotechnology, and there is a problem that growth and production are difficult to synchronize during fermentation.
A random mutant library of Bacillus subtilis time-type promoters was constructed. Promoter mutants with enhanced transcription strength were obtained through high-throughput screening. Superfolded green fluorescent protein was used as a reporter gene to screen for highly efficient promoter mutants, which were then applied to the fermentation production of swelling hormones.
It improved protein expression levels, enriched the Bacillus subtilis promoter element toolbox, promoted the secretion and expression of swelling hormone, solved the problem of synchronizing growth and production, and provided precise spatiotemporal control of gene expression.
Smart Images

Figure CN122060728A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a Bacillus subtilis time-sequential promoter and its applications. Background Technology
[0002] Bacillus subtilis, as one of the core chassis cells in the field of industrial biotechnology, is widely used in synthetic biology, metabolic engineering, and the production of industrial proteins. Promoters, as core elements controlling the intensity and timing of gene transcription, are fundamental to optimizing metabolic pathways and efficiently expressing heterologous products. This strain possesses temporal promoters tightly coupled to growth stages, enabling temporal control of genes and thus attracting increasing attention. However, existing temporal promoters still suffer from relatively low expression intensity, failing to meet the relevant needs in industrial biotechnology.
[0003] Currently, constructing expression systems with highly efficient promoters exhibiting high activity and controllability has become the most common method in building efficient cell factories. Some highly efficient promoters have been developed in Bacillus subtilis, such as xylose-inducible P... xylA P of the liars-regulated gene expression system (LIKE) liaI Promoters are primarily used to enhance the expression levels of target proteins under specific conditions. Furthermore, obtaining promoters with higher activity or superior regulatory performance through directed evolution strategies has become a research hotspot. This typically involves constructing promoter libraries through random mutations and screening them using reporter genes. This not only greatly enriches the synthetic biology toolbox of this chassis cell but also provides a core driving force for the construction of efficient and stable cell factories. Moreover, engineered bacteria often face the critical problem of synchronizing growth and production during fermentation. For example, premature high-intensity expression of the target gene can easily lead to metabolic burden, protein folding and secretion stress, inhibited cell growth, product degradation, or byproduct accumulation. To address this issue, systematic identification and typing of temporal promoters have been reported, which can better match bacterial growth states and production windows. However, currently, there is no systematic study of "temporal promoters at different growth stages" in Bacillus subtilis to optimize their transcriptional intensity in parallel at each stage. Therefore, developing a toolbox of time-sequential promoter elements that can enhance transcriptional capacity while preserving temporal expression characteristics and adapt to industrial fermentation processes has become an urgent need for achieving precise temporal control of gene expression. It is also of great significance for enriching the Bacillus subtilis synthetic biology toolbox and promoting the construction of the next generation of cell factories. Summary of the Invention
[0004] Therefore, the technical problem to be solved by this invention is to overcome the lack of efficient time-sequential promoters suitable for Bacillus subtilis in the prior art. Superfolded green fluorescent protein (sfGFP) is used as a reporter gene. Promoters with high transcription intensity at four different growth stages in Bacillus subtilis are selected to construct a random mutant library. Promoter mutants with enhanced transcription intensity are obtained through high-throughput screening, providing more basic elements for the construction of genetically engineered strains of Bacillus subtilis.
[0005] The first objective of this invention is to provide a sequential promoter for Bacillus subtilis, wherein the promoter is one of the nucleotide sequences shown in SEQ ID NO. 1-4.
[0006] A second objective of this invention is to provide an expression vector containing the promoter.
[0007] Furthermore, the expression vector is a nucleic acid vector, plasmid, or viral vector.
[0008] Furthermore, the backbone of the expression vector can be any vector suitable for host cells.
[0009] Furthermore, the expression vector is a vector suitable for Bacillus subtilis expression, including but not limited to pHT series vectors.
[0010] A third objective of this invention is to provide a recombinant nucleic acid construct comprising the promoter and a nucleic acid molecule connected downstream of the promoter.
[0011] Furthermore, nucleic acid molecules can be genes, and genes can encode a protein.
[0012] A fourth objective of this invention is to provide a gene expression unit comprising the above-described recombinant nucleic acid construct and a terminator.
[0013] A fifth objective of this invention is to provide recombinant cells comprising the aforementioned promoter.
[0014] Furthermore, the host cell of the recombinant cell may be derived from an animal, plant, or microorganism.
[0015] Furthermore, the host cell of the recombinant cells is Bacillus subtilis.
[0016] A sixth object of the present invention is to provide an expression system comprising the above-described promoter.
[0017] A seventh objective of this invention is to provide the application of the aforementioned promoter in the genetic modification of cells. This includes applications in genetic engineering or synthetic biology, but is not limited to other areas such as biosensing. It has been verified that this promoter can be used at least for the optimization of biosynthesis in Bacillus subtilis.
[0018] An eighth object of the present invention is to provide a recombinant Bacillus subtilis modified based on a host bacterium, the modification including overexpression of an expansionin-encoding gene expressed by said promoter.
[0019] The ninth objective of this invention is to provide a method for synthesizing expansion agent, which uses the above-mentioned recombinant Bacillus subtilis for fermentation production.
[0020] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:
[0021] This invention first constructs time-series promoter random mutation libraries at four different growth stages, P hag The highest fluorescence level in the mutant was approximately four times that of the wild type, P SpoVG The optimal mutant exhibits approximately twice the fluorescence intensity of the wild type, P LytR The optimal mutant exhibits approximately five times the fluorescence intensity of the wild type, P mmgA The optimal mutant exhibited fluorescence intensity approximately four times that of the wild type. Applying the superior promoter mutants to the fermentation production of expansin (BsEXLX1 and LeEXP2) significantly improved protein expression levels. This invention provides a feasible reference scheme for the design and optimization of expression elements in Bacillus subtilis and offers usable expression elements for the development of its industrial microorganisms. The time-sequential promoter directed evolution and screening method provided by this invention can effectively screen for promoter mutants with enhanced transcriptional intensity. These mutants also effectively promote the secretory expression of expansin, enriching the promoter elements in Bacillus subtilis. The Bacillus subtilis construction and screening method provided by this invention is simple, easy to use, and has excellent application prospects. Attached Figure Description
[0022] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0023] Figure 1 This is a schematic diagram illustrating the promoter screening principle.
[0024] Figure 2 This is a diagram showing the flow cytometry screening process.
[0025] Figure 3 This is a sieve diagram of a 96-well plate for the starter.
[0026] Figure 4 The graph shows the fluorescence intensity of the optimal promoter.
[0027] Figure 5 This is a graph showing the yield of each mutant applied to the recombinant expression of the expansionin BsEXLX1.
[0028] Figure 6 This is a graph showing the yield of each mutant applied to the recombinant expression of LeEXP2. Detailed Implementation
[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0030] The solution involved in this invention is as follows:
[0031] This invention first selected the promoter with the highest transcriptional activity in four growth stages: P, which is active in the early logarithmic growth phase. hag P in the mid-to-late stage of the logarithm SpovG P during the stable period LytR And P, which is upregulated during the death phase mmgA Based on four promoters, a basic plasmid vector was constructed. Using the core regulatory region of each promoter as the target, degenerate primers were designed for random mutation. A promoter mutant library was constructed in *E. coli*, and the resulting promoter mutant library was transformed into *Bacillus subtilis* for screening. Among them, P... hag The highest fluorescence level in the mutant was approximately four times that of the wild type, P SpoVG The optimal mutant exhibits approximately twice the fluorescence intensity of the wild type, P LytR The optimal mutant exhibits approximately five times the fluorescence intensity of the wild type, P mmgA The fluorescence intensity of the optimal mutant is about four times that of the wild type.
[0032] Another technical problem to be solved by the present invention is to provide a method for efficiently screening promoter transcription intensity in Bacillus subtilis. The specific method is as follows: The principle of this method is to fuse superfolder green fluorescent protein (sfGFP) to the back end of the promoter. First, flow cytometry is used for preliminary screening. Based on the results of the first round of screening, a second round of screening is performed using 96-well plates. The relative intensity of the promoter is characterized by measuring the fluorescence intensity in the fermentation broth, thereby screening for promoter mutants with enhanced transcription intensity at a specific time.
[0033] The present invention also applies the dominant promoter mutant of Bacillus subtilis to the fermentation production of expansion hormones (BsEXLX1 and LeEXP2), and improves the protein expression level to a certain extent.
[0034] The strains involved in this invention are as follows:
[0035] Bacillus subtilis G800 is described in the literature “A genetic toolkit for efficient production of secretory protein in Bacillus subtilis”.
[0036] The sequence involved in this invention is shown below:
[0037] promoter P hag P is an early logarithmic growth phase promoter. hag The nucleotide sequence is shown below:
[0038] TGAAGTAAAAGTGATTGCGGTTGAAGGGGATCAAGTGAAGCTTGGAATTGACGCCCCAAAGCATATTGATATTCACAGGAAAGAAATTTACTTGACCATTCAGGAAGAAAATAACCGTGCAGCAGCGTTATCCAGCGATGTGATCTCCGC ATTATCCTCACAAAAAAAGTGAGGATTTTTTATTTTTGTATTAACAAAATCAGAGACAATCCGATATTAATGATGTAGCCGGGAGGAGGCGCAAAAGACTCAGCCAGTTACAAAATAAGGGCACAAGGACGTGCCTTAACAACATATTC
[0039] promoter P SpovG For the logarithmic late-stage promoter, P SpovG The nucleotide sequence is shown below:
[0040] TGCGGAAGTAAACGAAGTGTACGGACAATATTTTGACACTCACAAACCGGCGAGATCTTGTGTTGAAGTCGCGAGACTCCCGAAGGATGCGTTAGTCGAGATCGAAGTTATTGCACTGGTGAAATAATAAGAAAAGTGATTCTGGGAGA GCCGGGATCACTTTTTTATTTACCTTATGCCCGAAATGAAAGCTTTATGACCTAATTGTGTAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATACACTAATGCTTTTATATA
[0041] promoter P LytRAs a stable promoter, P LytR The nucleotide sequence is shown below:
[0042] CTAACCCTACATAAGTACCTTTCTTTTGTTTCAATGTTACTGTCTGGCGATACATCTTCACCTTGACTCTTTTGACTATTAACCCCGCAACCCGAAAGAAGCAATATAAAGAACAGTAAAGCAATAAATTTTTTCATTTTTTTCACCTCAT TATATTTTTATCGTCAACCTATTTTATATTTTAAAGAAAAATTAAGAAACAATGAAACTTTTTTTTATAAAAAAACGACTATTTTAGGATTTCATTCTTGTATTAAATAGAGTTGTATTTATTGGAAATTTAACTCATAATGAAAGTAATTT
[0043] promoter P mmgA P is a death-phase promoter. mmgA The nucleotide sequence is shown below:
[0044] TCGATATATCGCGTCTATTCCGGCTTCCGGCTATCACCCGAAGATAAACAGCCCAGGGGTCACAGATGAAGTACTGAAGAAAATGAGGAACGGTTTGATTAAGGTAAGGCCGTATACAGTCAATCGTCCGGAAGATATGAAGCGTCTCAT TGAAGCGGGAGCAGACGGCATGTTTACCGACTTTCCAGAAAAGGCTTCGGCATTGCTGAAAAATGAATAGTTGTTAGAAGGAGGCTGTTTGACGCAGCCTTCTTTTTTCATTCATTCATGCCCGTTTCAAAGCATACATTCATAGAAGAC
[0045] P hag-TB-1 The nucleotide sequence (SEQ ID NO.1)
[0046] GAAGTAAAAGTGATTGCGGTTGAAGGGGATCAAGTGAAGCTTGGAATTGACGCCCCAAAGCATATTGATATTCACAGGAAAGAAATTTACTTGACCATTCAGGAAGAAAATAACCGTGCAGCAGCGTTATCCAGCGATGTGATCTCCGCATTATCCTCACAAAAAAAGTGAGGATTTTTTTATTTTTGTATTAACAAAATCAGAGACAATCCGATATTAATGATGTAGCCGGGAGGAGGCGCAAAAGACTCTCTTAAACACCTCAGTTCCACATAAAAGCAACTATTGCCTGAGCAGAA
[0047] P SpoVG-TB-1 Nucleotide sequence of (SEQ ID NO.2)
[0048] TGCGGAAGTAACGAAGTGTACGGACAATATTTTGACACTCACAAACCGGCGAGATCTTGTGTTGAAGTCGCGAGACTCCCGAAGGATGCGTTAGTCGAGATCGAAGTTATTGCACTGGTGAAATAATAAGAAAAGTGATTCTGGGAGAGCCGGGATCACTTTTTTATTTACCTTATGCCCGAAATGAAAGCTTTATGACCTAATTGTGTAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTTACTGATAAGTAGCGAATTGATACACTAATGCTTTTATATAG
[0049] P LytR-TB-1 Nucleotide sequence of (SEQ ID NO.3)
[0050] CTAACCCTACATAAGTACCTTTCTTTTGTTTCAATGTTACTGTCTGGCGATACATCTTCACCTTGACTCTTTTGACTATTAACCCCGCAACCCGAAAGAAGCAATATAAAGAACAGTAAAGCAATAAATTTTTTCATTTTTTTCACCTCAT TATATTTTTATCGTCAACCTATTTTATATTTTAAAGAAAAATTAAGAAACAATGAAACTTTTTTTTATAAAAAAACGACTATATTTAACTAACTCTATATGCCCATTCACTTGTATTTATTGGAAATTTAACTCATAATGAAAGTAATTT
[0051] P mmgA-TB-1 The nucleotide sequence (SEQ ID NO.4)
[0052] TCGATATATCGCGTCTATTCCGGCTTCCGGCTATCACCCGAAGATAAACAGCCCAGGGGTCACAGATGAAGTACTGAAGAAAATGAGGAACGGTTTGATTAAGGTAAGGCCGTATACAGTCAATCGTCCGGAAGATATGAAGCGTCTCAT TGAAGCGGGAGCAGACGGCATGTTTACCGACTTTCCAGAAAAGGCTTCGGCATTGCTGAAAAATGAATAGTTGTTAGAAGGAGGCTGTTTGACGCAGGCGGTATAGTTCATTCATACCCAGGGAGCGAGCTGCATACATTAATATCGGAC
[0053] Example 1: Plasmid pHT-P hag , P LytR , P spoVG , P mmgA Construction of -sfGFP
[0054] The plasmids were constructed in E. coli DH5α, and the four promoter-starting plasmids were constructed from promoter P. hag ,P LytR , P spoVG , P mmgA Composed of sfGFP, the expression vector used is the commercially available pHT plasmid, as shown in the schematic diagram of plasmid construction. Figure 1 As shown in Table 1, information related to sequential promoters is presented in this table.
[0055] Table 1. Information related to sequential promoters
[0056]
[0057] Table 2 Primer sequence list for promoter plasmid construction
[0058]
[0059] Example 2: Construction of a random mutant library
[0060] Using the plasmid obtained in Example 1 as a PCR template, random saturation mutations were performed on the conserved regions of each promoter using degenerate primers. The resulting plasmids were then transformed into *E. coli* for cloning to obtain mixed plasmids, which were used to construct a random mutant library. The mutant library was then transformed into *Bacillus subtilis* for further screening. The primer list is shown in Table 3.
[0061] Table 3. Primer sequence listing for promoter random mutations
[0062]
[0063]
[0064] Example 3: High-throughput screening of promoter random mutation libraries
[0065] The bacterial colonies obtained in Example 2 were scraped and cultured at 220 rpm and 37°C for 6 h. After culture, the bacterial cells were centrifuged at 4000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the bacterial pellet was washed three times with PBS. The bacterial suspension was diluted to an OD600 of approximately 0.3. Sorting was performed using a flow cytometer (BD FACSAria III) with the following parameters: 488 nm excitation laser and 530 ± 30 nm emission light, 70 μm nozzle, sheath pressure of 70 psi, and a data acquisition rate of 3000 events / s. Data were analyzed using BD FACSDiva software (v8.0). The sorted cells were collected in LB medium, activated at 220 rpm and 37°C for 1 hour, and then plated onto LB agar plates. The fluorescence intensity during initial screening using flow cytometry is shown below. Figure 2As shown. The obtained plate strains were inoculated individually into 96-well plates, each containing 200 μL of seed culture medium (containing 5 mg / L chloramphenicol), and cultured at 37°C with shaking at 700 rpm for 48 h. Cell concentration and total fluorescence intensity were measured every 12 h. The relative fluorescence intensity of sfGFP was measured using a Cytation 3 microplate reader (Berten Instruments, Inc., USA) following the method described in the literature Yang S, Liu Q, Zhang Y, et al. Construction and characterization of broad-spectrum promoters for synthetic biology [J]. ACS Synthetic Biology, 2018, 7(1): 287–291. Among approximately 630 hag promoter mutants, four strains exhibited significantly enhanced fluorescence intensity, with the highest fluorescence level being approximately four times that of the wild type. Among approximately 3000 SpoVG promoter mutants, about 200 showed enhanced fluorescence, with the optimal mutant reaching approximately twice the fluorescence intensity of the wild type. Among approximately 400 LytR promoter mutants, four strains showed significantly enhanced fluorescence expression, with the strongest mutant increasing its fluorescence intensity to approximately five times that of the wild type. Furthermore, among approximately 900 mmgA promoter mutants, about 70 strains showed upregulated fluorescence expression, with the highest fluorescence intensity being approximately four times that of the wild type. A dot plot of the time-series promoter screening process is shown below. Figure 3 As shown, the fluorescence intensity of the optimal timing promoter mutants obtained through screening is as follows: Figure 4 As shown.
[0066] Example 4: Applying promoter mutants to recombinant expression of swelling hormone
[0067] The superior promoter mutants obtained in Example 3 were applied for validation, using intumin (BsEXLX1, Genbank accession number: CAB13755.1 and LeEXP2, Genbank accession number: AAC64201.1) as reporter proteins. Each promoter mutant was applied to the recombinant expression of BsEXLX1. All selected promoter mutants increased the secretory expression level of BsEXLX1 to varying degrees. Among them, P... SpoVG-TB-1 The mutant exhibited the highest recombinant expression level, reaching a protein concentration of approximately 145 mg / L. Applying the optimal mutant to recombinant expression of LeEXP2, Western blotting results showed P... SpoVG-TB-1 The mutant showed the highest level of recombinant expression. The yield of each mutant applied to BsEXLX1 for recombinant expression is shown in the graph below. Figure 5As shown, the protein expression of LeEXP2 when the optimal mutant is applied is as follows: Figure 6 As shown.
[0068] in:
[0069] The recombinant expansionin BsEXLX1 was constructed in *Bacillus subtilis* by replacing the promoter preceding the BsEXLX1 coding sequence with various mutant promoters, ligating it to the pHT plasmid, and introducing it into *Bacillus subtilis* G800 cells. The recombinant expansionin LeEXP2 was constructed in *Bacillus subtilis* by replacing the promoter preceding the LeEXP2 coding sequence with the optimal mutant promoters (hag-TB-1, LytR-TB-1, mmgA-TB-1, SpovG-TB-1), ligating it to the pHT plasmid, and introducing it into *Bacillus subtilis* G800 cells. Protein expression was as follows: Figure 6 As shown.
[0070] The fermentation conditions were as follows: Recombinant Bacillus subtilis seed culture was inoculated into the fermentation medium at a volume percentage of 5%, and cultured at 37℃ and 220 rpm for 36 h. The fermentation medium consisted of: 12 g / L peptone, 24 g / L yeast extract, 4 mL / L glycerol, 2.2 g / L KH₂PO₄, and 12.3 g / L K₂HPO₄.
[0071] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A promoter, characterized in that, The promoter is one of the nucleotide sequences shown in SEQ ID NO.1-4.
2. An expression vector comprising the promoter of claim 1.
3. A recombinant nucleic acid construct, characterized in that, It includes the promoter of claim 1 and a nucleic acid molecule connected downstream of the promoter.
4. A gene expression unit, characterized in that, It includes the recombinant nucleic acid construct and terminator as described in claim 3.
5. A recombinant strain comprising the promoter of claim 1, the expression vector of claim 2, the recombinant nucleic acid construct of claim 3, or the gene expression unit of claim 4.
6. An expression system comprising the promoter of claim 1.
7. The application of the promoter of claim 1, the expression vector of claim 2, the recombinant plasmid construct of claim 3, the gene expression unit of claim 4, the recombinant strain of claim 5, or the expression system of claim 6 in genetic modification.
8. The application according to claim 7, characterized in that, For genetic modification of Bacillus subtilis; and / or for biosynthesis of Bacillus subtilis.
9. A recombinant Bacillus subtilis, characterized in that, The modification is based on Bacillus subtilis host bacteria, and the modification includes overexpression of the expansionin-encoding gene expressed by the promoter.
10. A method for synthesizing an expansion agent, characterized in that, The recombinant Bacillus subtilis as described in claim 9 is used for fermentation production.