Oil palm U3 promoter and application thereof

By screening and validating the endogenous U3 promoter EgU3-1 in oil palm, the problem of promoter applicability in oil palm gene editing technology was solved, achieving efficient gene editing and breeding results and improving the efficiency of oil palm breeding.

CN122060741AActive Publication Date: 2026-05-19SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
Filing Date
2026-04-17
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

The lack of a suitable U3 promoter in existing oil palm gene editing technologies has limited the progress of efficient oil palm breeding.

Method used

The oil palm endogenous U3 promoter EgU3-1 with high transcriptional activity was screened out and ligated into a recombinant vector with tracrRNA to construct an oil palm protoplast transient transformation vector. The expression level of tracrRNA was detected by real-time quantitative PCR to verify the promoter driving efficiency.

Benefits of technology

It significantly improved the efficiency of oil palm gene editing, provided important technical support for oil palm molecular breeding, achieved efficient transcriptional regulation, and enhanced the performance of the oil palm gene editing system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060741A_ABST
    Figure CN122060741A_ABST
Patent Text Reader

Abstract

The invention discloses an oil palm U3 promoter and application thereof, and belongs to the technical field of biology. The nucleotide sequence of the promoter is shown as SEQ ID NO.1. According to the invention, an upstream 400bp sequence of a U3 snRNA gene sequence is compared and intercepted in an oil palm genome for the first time, an oil palm RNA polymerase III type promoter-oil palm endogenous U3 snRNA promoter EgU3-1 is synthesized and obtained, and the promoter has efficient transcriptional activity and can drive the expression of downstream tracrRNA. The EgU3-1 promoter disclosed by the invention can be used for efficiently driving transcription of sgRNA in a gene editing carrier to obtain a large number of transcripts of the sgRNA, and an endogenous U3 promoter with high transcriptional activity is provided for efficient gene editing of oil palm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an oil palm U3 promoter and its applications. Background Technology

[0002] Oil palm (scientific name: Elaeis guineensis Oil palm is an important tropical economic palm crop. Currently, the breeding of new oil palm varieties in my country still mainly relies on traditional hybridization breeding, which suffers from low efficiency and long cycles, seriously hindering the progress of high-yield and high-quality oil palm breeding. With the development of biotechnology, the application of molecular breeding technologies, represented by gene editing technology, in various crops has accelerated the breeding of new varieties, but related research on oil palm still needs to be carried out.

[0003] Genome editing technology is an important tool for studying gene function. It can precisely modify genes at specific sites on the chromosomes of recipient cells, efficiently generating functionally inactive mutants of specific genes, and providing high-quality genetic material for functional genomics research. sgRNA and Cas9 are two essential components of this technology system, with sgRNA playing a role in targeting and binding to the target gene site during CRISPR / Cas9 genome editing. Studies have shown that the level of sgRNA in recipient cells is a crucial factor affecting editing efficiency in CRISPR / Cas9 gene editing systems. Therefore, polymerase III promoters that can precisely initiate in vivo transcription of sgRNA have attracted widespread attention. U3 RNA is a non-coding RNA involved in the splicing of precursor mRNA, and its corresponding U3 promoter is a type of RNA polymerase III promoter, which has been widely used in CRISPR / Cas9 systems in many species.

[0004] Theoretically, the U3 promoter drives the transcription of short non-coding RNAs, therefore using short non-coding RNA sequences to test the transcriptional efficiency of the U3 promoter is more accurate. In the CRISPR / Cas9 gene editing system, sgRNA consists of crRNA and tracrRNA. The crRNA is designed according to the target gene, while the tracrRNA is a fixed 76bp short sequence. tracrRNA has no homologous sequences in the oil palm genome, eliminating the background influence of gene expression, making it more accurate to use tracrRNA to test the transcriptional efficiency of the U3 promoter. The transcriptional efficiency of tracrRNA can be detected using qPCR (quantitative real-time PCR). By comparing the relative expression levels of tracrRNA driven by the U3 promoter in rice and oil palm, the transcriptional efficiency of the U3 promoter can be determined.

[0005] Although CRISPR / Cas9 genome editing technology has been widely applied in many species, gene editing techniques for oil palm are rarely reported. This is mainly because, while U3 promoters have been extensively reported in many species, exogenous U3 promoters are often not suitable. Therefore, the lack of suitable U3 promoters has become a limiting factor for current CRISPR / Cas9 gene editing systems in oil palm. Thus, screening for functionally active U3 promoters in oil palm is of positive significance for the development of gene breeding technology in oil palm. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the purpose of this invention is to provide an oil palm U3 promoter and its application, so as to solve the problem of the lack of a suitable U3 promoter in the existing oil palm gene editing system.

[0007] The technical solution of this invention mainly includes the following: To achieve the above objectives, this invention screened an endogenous U3 promoter, EgU3-1, with highly efficient transcriptional activity from the oil palm genome. Its nucleotide sequence is shown in SEQ ID NO.1. This promoter belongs to the type III RNA polymerase promoter of the oil palm U3 snRNA gene. This promoter can specifically drive the efficient expression of tracrRNA in oil palm protoplasts, providing a key component for constructing an efficient gene editing system for oil palm.

[0008] Furthermore, the present invention also provides biological materials containing the promoter, such as recombinant vectors, expression cassettes, and recombinant bacteria. The recombinant vector is obtained by ligating the oil palm U3 promoter EgU3-1 with tracrRNA and a plant expression vector. The recombinant bacteria are *Escherichia coli* containing the oil palm U3 promoter EgU3-1.

[0009] This invention also relates to the application of the oil palm U3 promoter EgU3-1 or the biological material described herein in driving the transformation of tracrRNA in oil palm protoplasts. The nucleotide sequence of the tracrRNA is shown in SEQ ID NO.2.

[0010] Furthermore, this invention discloses a method for constructing a transient transformation vector for oil palm protoplasts, comprising the following steps: directly synthesizing the oil palm U3 promoter EgU3-1, and ligating the oil palm U3 promoter EgU3-1 and tracrRNA into a plant expression vector to obtain the oil palm protoplast transient transformation vector.

[0011] Furthermore, this invention discloses a method for detecting the expression of tracrRNA driven by the oil palm U3 promoter EgU3-1, comprising the following steps: The constructed oil palm protoplast transient transformation vector was transformed into Escherichia coli DH5α for propagation to obtain plasmids, followed by oil palm protoplast transformation. Total RNA was extracted from the transformed oil palm protoplasts and reverse transcribed to synthesize the first strand of cDNA. The expression level of tracrRNA was normalized using tracrRNA-1F and tracrRNA-1R primers with Actin as an internal reference gene, and the relative expression level of tracrRNA was calculated.

[0012] Furthermore, the tracrRNA real-time PCR primers are tracrRNA-1F and tracrRNA-1R, the nucleotide sequence of tracrRNA-1F is shown in SEQ ID NO.3, and the nucleotide sequence of tracrRNA-1R is shown in SEQ ID NO.4.

[0013] Furthermore, the total reaction volume for real-time PCR was 25.0 µL: 12.5 µL of SYBR Green real-time PCR premix (low Rox), 1.0 µL each of upstream and downstream primers (10 µmol / L), and 2.0 µL of cDNA template (40 µmol / L), which was brought to 25.0 µL with ddH2O.

[0014] The PCR amplification procedure was as follows: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 10 s, annealing at 48℃ for 25 s, and extension at 72℃ for 30 s. Signals were acquired during the extension phase, and a melting curve was plotted after 30 cycles (95℃~65℃, 0.1℃ / s). Each sample was repeated three times, and the results were analyzed using a 23... - Ct Calculate the relative expression levels of genes.

[0015] Experimental results show that this promoter drives significantly higher levels of tracrRNA expression than commonly used exogenous promoters, effectively improving the efficiency of oil palm gene editing and providing important technical support for oil palm molecular breeding.

[0016] The beneficial effects of this invention are: This invention is the first to clone the oil palm RNA polymerase type III promoter EgU3-1 with high transcriptional activity from oil palm, providing support for the subsequent establishment of an oil palm gene editing technology system.

[0017] This invention is the first to link a cloned oil palm endogenous RNA polymerase type III promoter to drive tracrRNA, verifying the feasibility of this promoter driving tracrRNA and providing a rapid and effective method for subsequent screening and verification of other oil palm endogenous U3 promoters. Attached Figure Description

[0018] Figure 1 : Simplified structural diagram of pOsU3-tracrRNA expression vector.

[0019] Figure 2 : Simplified structural diagram of pEgU3-1-tracrRNA expression vector.

[0020] Figure 3 Comparison of transcription efficiency of tracrRNA driven by promoters OsU3 and EgU3-1 (OsU3: pOsU3-tracrRNA expression vector, EgU3-1: pEgU3-1-tracrRNA expression vector). Detailed Implementation

[0021] To facilitate a clearer understanding of the technical content of this invention by those skilled in the art, the invention will be further described below in conjunction with specific embodiments and accompanying drawings.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] The carriers used in the following examples were purchased from Wemi Biotechnology Co., Ltd. The above-mentioned biological materials are only used to repeat the relevant experiments of the present invention and should not be used for other purposes.

[0024] Example 1: Obtaining and analyzing the transcriptional activity of the oil palm U3 gene promoter EgU3-1 Using the DNA sequence of the rice OsU3 gene (Genebank accession number: X79685.1) as a reference, the TBtools software was used to align the sequence with the African oil palm genome (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000442705.2 / ). Homology alignment analysis identified a candidate EgU3 gene on chromosome 14 of the oil palm. The 400bp upstream sequence of the U3 snRNA sequence of this gene (located at 25599486bp-25599087bp on chromosome 14 of the African oil palm) was obtained as the EgU3-1 sequence of the oil palm U3 promoter (SEQ ID NO.1).

[0025] A 76 bp tracrRNA sequence (its nucleotide sequence is shown in SEQ ID NO.2) was used as a short RNA sequence to test the transcription efficiency of the rice and oil palm U3 promoters, as shown below (SEQ ID NO.2): gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc The 400bp oil palm U3 promoter sequence was directly synthesized, and expression vectors for rice pOsU3-tracrRNA and oil palm pEgU3-1-tracrRNA were constructed by Weimi Biotechnology Co., Ltd. The vector expression structures are shown below. Figure 1 and Figure 2 .

[0026] The above vector was transformed into Escherichia coli DH5α and propagated to obtain a high concentration of plasmids for oil palm protoplast transformation.

[0027] After transformation of oil palm protoplasts, total RNA was extracted from the protoplasts using a plant total RNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd., B51863-0050). cDNA first-strand was synthesized via reverse transcription according to the instructions of the Prime Script RT kit (Sangon Biotech (Shanghai) Co., Ltd., B639251-0100). The expression level of tracrRNA was normalized using primers for tracrRNA quantitative PCR (tracrRNA-1F (SEQ ID NO.3): GCAGTTAAAATAAGGCTAGTCCG, tracrRNA-1R (SEQ ID NO.4): CGGTGCCACTTTTTCAAGTT), with Actin as an internal reference gene (CnActin-F (SEQ ID NO.5): ATAAAGTATGGCTGATGCTGAGG, CnActin-R (SEQ ID NO.6): CAACAATGCTTGGGAACACA). Primers were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.

[0028] The total reaction volume for real-time PCR was 25.0 µL: 12.5 µL of SYBR Green real-time PCR premix (low Rox), 1.0 µL each of forward and reverse primers (10 µmol / L), and 2.0 µL of cDNA template (40 µmol / L). The volume was brought to 25.0 µL with ddH2O. The PCR amplification procedure was as follows: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 10 s, annealing at 48℃ for 25 s, and extension at 72℃ for 30 s. Signals were acquired during the extension phase. After 30 cycles, a melting curve was plotted (95℃~65℃, 0.1 ℃ / s). Each sample was repeated three times, and the results were analyzed using a 23... - CtCalculate the relative expression levels of genes.

[0029] The results of quantitative real-time PCR are shown in the figure. Figure 3 The tracrRNA expression level of the oil palm pEgU3-1-tracrRNA expression vector was higher than that of the rice pOsU3-tracrRNA expression vector (approximately 2.3 times higher), indicating that the oil palm EgU3-1 promoter is more efficient at driving tracrRNA than the rice OsU3 promoter.

[0030] Therefore, the oil palm endogenous U3 promoter described in this invention exhibits higher transcriptional activity in driving tracrRNA expression, and can provide a more efficient transcriptional regulatory element for gene editing research based on the CRISPR / Cas system in oil palm, providing technical support for the subsequent establishment of an oil palm gene editing technology system.

[0031] The above description is only a part of the embodiments of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A palm oil U3 promoter EgU3-1, characterized in that, The nucleotide sequence of the oil palm U3 promoter EgU3-1 is shown in SEQ ID NO.

1.

2. A biomaterial containing the oil palm U3 promoter EgU3-1 as described in claim 1, characterized in that, The biomaterials include recombinant vectors, expression cassettes, or recombinant bacteria.

3. The biomaterial according to claim 2, characterized in that, The recombinant vector is obtained by linking the oil palm U3 promoter EgU3-1 of claim 1 with tracrRNA and a plant expression vector, wherein the plant is rice or oil palm.

4. The biomaterial according to claim 2, characterized in that, The recombinant bacteria is Escherichia coli containing the oil palm U3 promoter EgU3-1.

5. The application of the oil palm U3 promoter EgU3-1 as described in claim 1 or the biomaterial as described in claim 2, characterized in that, The application is to drive the transformation of tracrRNA in oil palm protoplasts.

6. The application according to claim 5, characterized in that, The nucleotide sequence of the tracrRNA is shown in SEQ ID NO.

2.

7. A method for constructing a transient transformation vector for oil palm protoplasts, characterized in that, Includes the following steps: The oil palm U3 promoter EgU3-1 of claim 1 is directly synthesized, and the oil palm U3 promoter EgU3-1 and tracrRNA are ligated into a plant expression vector to obtain an oil palm protoplast transient transformation vector.

8. A method for detecting tracrRNA expression driven by the oil palm U3 promoter EgU3-1 as described in claim 1, characterized in that, Includes the following steps: The transient transformation vector of oil palm protoplasts constructed according to claim 7 was transformed into Escherichia coli DH5α and amplified to obtain plasmids, followed by transformation of oil palm protoplasts; total RNA was extracted from the transformed oil palm protoplasts, and cDNA first strand was synthesized by reverse transcription; the expression level of tracrRNA was normalized using tracrRNA-1F and tracrRNA-1R primers with Actin as an internal reference gene, and the relative expression level of tracrRNA was calculated.

9. The method according to claim 8, characterized in that, The tracrRNA real-time PCR primers are tracrRNA-1F and tracrRNA-1R. The nucleotide sequence of tracrRNA-1F is shown in SEQ ID NO.3, and the nucleotide sequence of tracrRNA-1R is shown in SEQ ID NO.4.