Recombinant microorganism, preparation method thereof and application of recombinant microorganism in production of L-sorbose

By introducing the global regulatory protein irrE gene into L-sorbose-producing bacteria and using the osmotic pressure-regulated promoter proPB, the microorganism's tolerance to harsh environments was improved, solving the problems of L-sorbose production stability and insufficient yield, and achieving high-yield L-sorbose production.

CN122060764APending Publication Date: 2026-05-19HEILONGJIANG NHU BIOTECH CO LTD +2
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HEILONGJIANG NHU BIOTECH CO LTD
Filing Date
2026-03-13
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

In existing technologies, L-sorbitol-producing bacteria have insufficient tolerance to harsh fermentation environments, making it difficult to improve production stability and yield.

Method used

Recombinant microorganisms were constructed by introducing a gene encoding the global regulatory protein irrE exogenously and regulating its expression using the osmotic pressure-regulated promoter proPB, thereby improving the microorganisms' tolerance to various stresses such as osmotic pressure, oxidation, pH, and heat.

Benefits of technology

It prolongs the logarithmic growth phase of the strain, promotes biomass accumulation, and increases the yield of L-sorbose, with a yield of at least 200 g/L, preferably at least 300 g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention relates to a recombinant microorganism, a preparation method thereof and application of the recombinant microorganism in production of L-sorbose. Specifically, the invention provides a method for constructing a recombinant microorganism by exogenous introduction of a gene encoding global regulatory protein irrE, and the recombinant microorganism is suitable for production of L-sorbose by a fermentation method. The recombinant microorganism provided by the invention has stress resistance, and has better tolerance to severe environments including high osmotic pressure, so that the yield of L-sorbose can be obviously improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant microorganism and its application in the production of L-sorbose. Background Technology

[0002] Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that can participate in various metabolic processes in the human body to enhance the body's immune function. Therefore, vitamin C is not only an essential nutrient for the human body, but also a widely used drug in medicine, and has important applications in both the pharmaceutical and food industries.

[0003] Currently, vitamin C is mainly produced industrially using the Reibrillation process and the two-step fermentation method. Both methods require fermentation to convert D-sorbitol to L-sorbose as an initial step. However, microbial growth and proliferation, especially in industrial fermentation environments, often encounter various harsh environmental pressures. For example, conditions such as osmotic pressure, pH, dissolved oxygen, and nutrients fluctuate in the fermentation environment. Microbial growth is affected by these fluctuations, making it difficult to control, and L-sorbose production is also unstable. Furthermore, the biomass in industrial production is limited by the fermentation environment. Therefore, it is necessary to improve the tolerance of L-sorbose-producing bacteria to harsh environments, thereby further increasing L-sorbose yield.

[0004] Currently, domestic and international research on L-sorbose production via microbial fermentation mainly focuses on improving L-sorbose production levels through genetic engineering, or examining the impact on product synthesis through strain mutagenesis, single-factor optimization, and fermentation process optimization. For example, genetic engineering techniques are used to obtain L-sorbose reductase-deficient mutants; culture medium components are optimized by adding exogenous gelatin, citric acid, and itaconic acid to promote microbial growth and metabolism; production processes are optimized by employing semi-continuous fermentation; culture conditions are optimized to control the dissolved oxygen environment of the microorganisms; and immobilization technology is optimized for continuous fermentation production of L-sorbose.

[0005] Specifically, Patent Document 1 proposes using transposon Tn5 for transposon mutagenesis, followed by screening to obtain genetically engineered *Glucosobacter oxidans* with significantly increased L-sorbose production. Patent Document 2 achieves excessive accumulation of L-sorbose by overexpressing the sorbitol dehydrogenase gene to enhance the metabolic pathway of sorbitol oxidative dehydrogenation. Patent Document 3 enhances the transcription and expression of the sorbitol dehydrogenase gene in engineered bacteria by adding a poly(A / T) tail to the sorbitol dehydrogenase gene to improve its mRNA stability, thereby regulating the rapid redirection of sorbitol to sorbose. While these studies and technologies have played a role, they have not fundamentally improved the tolerance of L-sorbose-producing bacteria to harsh environments, thus failing to achieve the goal of increasing production capacity.

[0006] Existing technical documents

[0007] Patent Document 1: CN102559566B

[0008] Patent Document 2: CN102660599B

[0009] Patent Document 3: CN103388011B Summary of the Invention

[0010] The problem the invention aims to solve

[0011] To address the aforementioned problems in the fermentation process of L-sorbose and improve the tolerance of L-sorbose-producing bacteria to harsh environments, this invention constructs a recombinant microorganism by exogenously introducing a gene encoding the globally regulatory protein irrE, thereby enhancing the tolerance of L-sorbose-producing bacteria to harsh environments and making it suitable for the fermentation production of L-sorbose.

[0012] The recombinant microorganism exhibits stress resistance and good tolerance to harsh environments, including high osmotic pressure. Overexpression of the gene encoding the global regulatory protein irrE, as shown in SEQ ID NO: 1, can significantly improve these properties of the microorganism during L-sorbitol fermentation.

[0013] The global regulatory protein irrE acts as a switch to activate important genes in organisms, playing a central regulatory role in DNA damage repair and protection against radiation stress. Exogenous introduction of the gene encoding irrE can enhance the tolerance of microorganisms to various stresses such as osmotic pressure, oxidation, pH, and heat. On the one hand, it prolongs the logarithmic growth phase of the strain, promoting further biomass accumulation; on the other hand, it allows the strain to maintain vigorous growth and metabolic activity during fermentation, thereby increasing L-sorbose production.

[0014] Preferably, the present invention can also regulate the expression of the gene encoding the global regulatory protein irrE by promoter substitution, by knocking out the promoter that controls the expression of the gene encoding the global regulatory protein irrE on the recombinant vector and inserting other different promoters.

[0015] The inserted promoter is preferably the osmotic pressure-regulating promoter proPB represented by SEQ ID NO: 2. This promoter has a low initial expression intensity, but its expression intensity increases with increasing osmotic pressure. This results in an increase in the expression level of the globally regulatory protein irrE with increasing osmotic pressure, thereby improving the microorganism's tolerance to stress pressures of varying intensities.

[0016] Solution for solving the problem

[0017] This invention provides a method for producing recombinant microorganisms, the method comprising the following steps:

[0018] a. The gene encoding the global regulatory protein irrE was cloned from a parental strain containing the gene encoding the global regulatory protein irrE;

[0019] b. The gene encoding the global regulatory protein irrE is ligated into a vector to construct a recombinant vector containing the gene encoding the global regulatory protein irrE;

[0020] c. The recombinant vector is introduced into L-sorbitol-producing bacteria to obtain the recombinant microorganisms described above.

[0021] In the method of the present invention described above, step b includes replacing the promoter of the gene encoding the global regulatory protein irrE on the recombinant vector by knocking out the promoter and inserting other different promoters to further regulate the expression of the gene encoding the global regulatory protein irrE.

[0022] In the method of the present invention described above, the promoter inserted in step b is an inducible promoter, preferably an osmolarity-regulating promoter proPB. The osmolarity-regulating promoter proPB is obtained from a polynucleotide molecule or polynucleotide sequence comprising a partial nucleotide sequence of at least 70 consecutive nucleotides of SEQ ID NO: 2, preferably comprising at least 100 consecutive nucleotides, more preferably comprising at least 150 consecutive nucleotides, and most preferably comprising the complete nucleotide sequence of SEQ ID NO: 2. The polynucleotide sequence has at least 60% homology with SEQ ID NO: 2, preferably at least 80% homology, more preferably at least 90% homology, and preferably the osmolarity-regulating promoter proPB is the nucleotide sequence represented by SEQ ID NO: 2. The osmolarity-regulating promoter proPB is isolated from bacteria, preferably Escherichia, more preferably Escherichia coli.

[0023] In the above-described method of the present invention, the carrier in step b is selected from pBR322 and its derivatives, pACYC177, pACYC184 and its derivatives, RK2, pBBR1MCS-2, granular carriers and their derivatives, preferably pBBR1MCS-2.

[0024] In the above-described method of the present invention, step a includes designing primers based on the DNA sequence shown in SEQ ID NO: 1, using genomic DNA extracted from the parent strain as a template, and synthesizing the gene encoding the global regulatory protein irrE by PCR.

[0025] In the method of the present invention described above, the gene encoding the global regulatory protein irrE in step a is obtained from a polynucleotide molecule or polynucleotide sequence comprising a partial nucleotide sequence of at least 100 consecutive nucleotides as shown in SEQ ID NO: 1, preferably comprising at least 300 consecutive nucleotides, more preferably comprising at least 600 consecutive nucleotides, and most preferably comprising the complete nucleotide sequence of SEQ ID NO: 1. The polynucleotide sequence has at least 60% homology with SEQ ID NO: 1, preferably at least 80% homology, more preferably at least 90% homology, and preferably the gene encoding the global regulatory protein irrE is the nucleotide sequence represented by SEQ ID NO: 1. The parent strain is a bacterium, preferably Deinococcus, more preferably the group consisting of Deinococcus radiodurans, Deinococcus deserti, Deinococcus gobiensis, and Deinococcus proteolyticus, and most preferably Deinococcus radiodurans.

[0026] In the above-described method of the present invention, the introduction method in step c is selected from transformation, transduction, conjugation transfer, and electroporation. The L-sorbose-producing bacteria are selected from bacteria or fungi, preferably bacteria of the genus *Gluconobacter*, and more preferably *Gluconobacter oxydans*. Preferably, step c includes transforming the recombinant vector obtained in step b into *Escherichia coli* S17-1 competent cells, and then introducing it into L-sorbose-producing bacteria through conjugation transfer to obtain genetically stable recombinant microorganisms.

[0027] The present invention also provides a recombinant microorganism containing at least the gene encoding the global regulatory protein irrE and the osmotic pressure regulating promoter proPB.

[0028] The present invention also provides a method for producing L-sorbose, comprising producing recombinant microorganisms using the above method, and producing L-sorbose using the above recombinant microorganisms.

[0029] The effects of the invention

[0030] In the construction of the above-mentioned recombinant microorganisms, the inventors discovered that recombinant microorganisms constructed by introducing the gene encoding the global regulatory protein irrE and replacing the promoter, especially recombinant Gluconobacter oxydans, can regulate the expression of the global regulatory protein irrE through changes in osmotic pressure. This stage-wise improves the stress resistance of L-sorbose-producing bacteria, meets the needs of bacterial cells to tolerate harsh environments at different stages of the fermentation process, and promotes the accumulation of bacterial biomass and the synthesis of L-sorbose.

[0031] In addition, the inventors also discovered in the construction of the above-mentioned recombinant microorganisms that the recombinant Gluconobacter oxydans constructed by introducing the gene encoding the global regulatory protein irrE and replacing the promoter has enhanced sorbitol conversion ability and further improved L-sorbose yield.

[0032] In another technical solution, the method of the present invention achieves a yield of L-sorbose of at least 200 g / L, preferably at least 300 g / L. Attached Figure Description

[0033] Figure 1 This is a map of the original plasmid pBBR1MCS-2.

[0034] Figure 2 The image shows the spectrum of the recombinant plasmid pBBR1MCS-2-G-proPB-IrrE. Detailed Implementation

[0035] 1. Microorganisms that produce L-sorbose

[0036] This invention constructs recombinant microorganisms by exogenously introducing a gene encoding the global regulatory protein irrE, thereby improving the tolerance of L-sorbose-producing bacteria to harsh environments and making them suitable for the fermentation production of L-sorbose.

[0037] The gene encoding the global regulatory protein irrE of the present invention can be obtained from a polynucleotide molecule encoding the global regulatory protein irrE, and comprises a partial nucleotide sequence of at least 100 consecutive nucleotides of SEQ ID NO: 1. Preferably, it comprises a partial nucleotide sequence of at least 300 or more preferably, at least 600 consecutive nucleotides of SEQ ID NO: 1, and most preferably, it is a polynucleotide containing the nucleotide sequence of SEQ ID NO: 1. SEQ ID NO: 1 represents the complete nucleotide sequence of irrE isolated from *Radiata aberrant cocci*.

[0038] The gene encoding the global regulatory protein irrE can also be obtained from a longer polynucleotide sequence encoding irrE. Such polynucleotides can, for example, be isolated from bacteria. Preferably, they are isolated from bacteria belonging to the genus *Deinococcus*, including but not limited to *Deinococcus radiodurans*, *Deinococcus deserti*, *Deinococcus gobiensis*, and *Deinococcus proteolyticus*.

[0039] When such polynucleotides are obtained from longer polynucleotide sequences, it is possible to determine the homology between such polynucleotide sequences and SEQ ID NO: 1. In this case, preferably, a region having at least 100 consecutive nucleotides is selected, and corresponding fragments from other polynucleotides are compared with it. When a polynucleotide sequence has, for example, 60 identical nucleotides with a corresponding fragment obtainable from SEQ ID NO: 1 (by comparing 100 consecutive nucleotides), then the homology is 60%. Preferably, a portion of the polynucleotide sequence of the present invention has at least 80% homology with SEQ ID NO: 1, more preferably, at least 90% homology. To ensure homology, fragments of, for example, at least 100 consecutive nucleotides are used, preferably, at least 300 consecutive nucleotides, more preferably, at least 500 consecutive nucleotides.

[0040] Those skilled in the art will understand that certain segments of a polypeptide are essential for its biological function. However, there are other regions in which amino acids may be inserted, deleted, or substituted by other amino acids, preferably those similar to the substituted amino acid.

[0041] 2. Preparation method of recombinant microorganisms for L-sorbose production

[0042] The inventors genetically engineered the microorganisms that produce L-sorbose to optimize the production of L-sorbose.

[0043] The preparation of the recombinant microorganism for producing L-sorbose according to the present invention includes the following steps:

[0044] a. The gene encoding the global regulatory protein irrE was cloned from a parental strain containing the gene encoding the global regulatory protein irrE;

[0045] b. The gene encoding the global regulatory protein irrE is ligated into a vector to construct a recombinant vector containing the gene encoding the global regulatory protein irrE;

[0046] c. By means of methods suitable for introducing a vector into L-sorbose-producing bacteria, such as transformation, transduction, conjugation transfer and / or electroporation, a recombinant microorganism containing a gene encoding the globally regulatory protein irrE is constructed, wherein the L-sorbose-producing bacteria thereby become the recombinant microorganism of the present invention.

[0047] In step a, when isolating the gene encoding the global regulatory protein irrE from a strain containing the gene encoding irrE, the following exemplary method can be used:

[0048] (i) Obtain the target gene by PCR using primers designed based on the DNA sequence disclosed herein, using methods known in the art.

[0049] (ii) After the genome is cut into several segments using restriction endonucleases, the target gene is selected from them using labeled nucleic acid probes.

[0050] (iii) Synthesizing the target gene using methods known in the art, such as a DNA synthesizer.

[0051] Once a clone carrying the desired gene is obtained, the nucleotide sequence of the target gene can be determined using methods known in the art.

[0052] In step b, a combination of host / cloning vectors can be used in the cloning of double-stranded DNA. Preferred vectors for expressing the gene of the invention (i.e., the irrE gene) in *E. coli* can be selected from any vector commonly used in *E. coli*, such as pBR322 or its derivatives (e.g., pUC18 and pBluescriptII (Stratagene Cloining Systems, Calif., USA)), pACYC177 and pACYC184 and their derivatives, and vectors from broad-host-range plasmids, such as RK2 and pBBR1MCS-2. Preferred vectors for expressing the nucleotide sequence of the invention in *Gluconobacterium oxysporum* are selected from any vector that can replicate in *Gluconobacterium oxysporum* and preferred cloning organisms (e.g., *E. coli*). Preferred vectors are broad-host-range vectors, such as granular vectors (e.g., pVK100) and their derivatives, and pBBR1MCS-2. Such vectors can be transferred into L-sorbitol-producing bacteria using any method known in the art, such as transformation, transduction, conjugation transfer, or electroporation.

[0053] Using methods known in the art, the irrE gene / nucleotide sequence provided by the present invention can be ligated into a suitable vector containing regulatory sequences operable in L-sorbose-producing bacteria, such as promoters, ribosome binding sites, and transcription terminators, to produce a recombinant vector.

[0054] In step b, promoter substitution can be used to further regulate the expression of the gene encoding the global regulatory protein irrE by knocking out the promoter controlling the expression of the gene on the recombinant vector and inserting a different promoter. The inserted promoter can be a constitutive promoter or an inducible promoter: for example, the original promoter of the gene, the promoter of an antibiotic resistance gene, an osmotic pressure regulating promoter, a temperature-inducible promoter, the beta-galactosidase (lac), trp, tac, and trc promoters of E. coli, and any promoter that functions in L-sorbitol-producing bacteria. Preferably, the promoter is an inducible promoter, particularly an osmotic pressure regulating promoter, and more preferably, the osmotic pressure regulating promoter proPB.

[0055] The osmolarity-regulated promoter proPB can be obtained from a polynucleotide molecule of the osmolarity-regulated promoter proPB and contains a partial nucleotide sequence of at least 70 consecutive nucleotides of SEQ ID NO: 2. Preferably, it contains a partial nucleotide sequence of at least 100 consecutive nucleotides of SEQ ID NO: 2, more preferably, it contains a partial nucleotide sequence of at least 150 consecutive nucleotides. Most preferably, it contains a polynucleotide sequence of SEQ ID NO: 2. SEQ ID NO: 2 represents the complete nucleotide sequence of the proPB promoter isolated from Escherichia coli.

[0056] The osmolarity-regulating promoter proPB can also be obtained from a longer polynucleotide sequence containing the osmolarity-regulating promoter proPB. Such polynucleotides can be isolated from bacteria, for example, preferably *Escherichia*, and more preferably *Escherichia coli*. When such polynucleotides are obtained from longer polynucleotide sequences, it is possible to determine the homology between such polynucleotide sequences and SEQ ID NO: 2. The definition of homology here is the same as the definition of homology for SEQ ID NO: 1 described above. Preferably, a portion of the polynucleotide sequence of the present invention has at least 80% homology with SEQ ID NO: 2, more preferably, at least 90% homology. To determine homology, a fragment of at least 100 consecutive nucleotides is used, preferably, a fragment of at least 200 consecutive nucleotides.

[0057] For expression, other regulatory elements, such as Shine-Dalgarno (SD) sequences (e.g., AGGAGG, etc., including natural and synthetic sequences operable in L-sorbitol-producing bacteria) and transcription terminators (inverted repeat structures, including any natural and synthetic sequences), can be used in conjunction with the promoter described above.

[0058] In step c, various gene transfer methods can be used to construct recombinant microorganisms carrying recombinant vectors, such as transformation, transduction, conjugation transfer, or electroporation. The methods used to construct recombinant cells can be selected from those known in the field of molecular biology; for example, conventional transformation systems can be used for *E. coli*. Transduction systems can also be used for *E. coli*, and conjugation transfer systems are widely used for Gram-positive and Gram-negative bacteria, such as *E. coli* and *Glucobacterium oxysporum*. CN103509816B discloses a conjugation transfer method, where conjugation can occur, for example, in liquid culture media or on the surface of solid culture media. A selective marker can be added to the recipient used for conjugation transfer; for example, kanamycin resistance is typically selected.

[0059] The present invention also relates to recombinant vectors containing the polynucleotides, preferably recombinant vectors that can function in suitable L-sorbitol-producing bacteria.

[0060] This invention utilizes microorganisms conventionally used in L-sorbose production, including any one of bacteria, yeast, and mold, and employs genetic engineering techniques known in the art to obtain the recombinant microorganisms of this invention. Specifically, these microorganisms include, for example, *Gluconobacter* and *Acetobacter*, with *Gluconobacter oxydans* being preferred.

[0061] Therefore, the present invention also relates to L-sorbate-producing bacteria as described above, wherein a recombinant vector containing the polynucleotide is provided. Such genetically engineered L-sorbate-producing bacteria are referred to as recombinant L-sorbate-producing bacteria or recombinant microorganisms.

[0062] 3. Microbial fermentation for the production of L-sorbose

[0063] The fermentation method for producing L-sorbose using microorganisms of the present invention is characterized by the use of the aforementioned recombinant L-sorbose-producing strain for fermentation. Because the recombinant L-sorbose-producing strain of the present invention can improve the microbial tolerance to various stresses such as osmotic pressure, oxidation, pH, and heat, compared with existing L-sorbose fermentation methods, it extends the logarithmic growth phase of the strain, promoting further biomass accumulation; and the strain exhibits vigorous growth and metabolism, significantly improving the yield of L-sorbose. The specific fermentation process conditions for producing L-sorbose using the recombinant L-sorbose-producing strain of the present invention are as follows:

[0064] Strain: Recombinant L-sorbose producing strain

[0065] Culture medium formulation:

[0066] Inoculum culture medium (g / L): D-sorbitol 160, yeast extract 6, peptone 7, light calcium carbonate 1.5; pH adjusted to 5.5, autoclaved at 121℃ for 20 min;

[0067] Fermentation medium (g / L): D-sorbitol 450, yeast extract 2, peptone 2, light calcium carbonate 1.5; pH adjusted to 5.5, autoclaved at 121℃ for 20 min;

[0068] Preparation of inoculum in shake flasks: Use an inoculation loop to pick up an appropriate amount of L-sorbitol recombinant slant bacteria and inoculate it into the inoculum culture medium. The shake flask volume is 500 mL, the liquid volume is 60 mL, the culture temperature is 30℃, the rotation speed is 220 r / min, and the culture is carried out for 24 h to prepare the inoculum for later use.

[0069] Fermentation in a 30L fermenter: inoculum size 5%, initial fermentation volume 20L, pH controlled at 5.0-5.5 throughout, temperature 36-37℃, aeration ratio 1.0vvm, tank pressure 0.05Mpa, stirring speed 500rpm, fermentation cycle 26-28 hours, and sorbitol molar conversion rate 94-97% after fermentation.

[0070] In the fermentation production method of L-sorbose of the present invention, not only can Gluconobacter oxydans Gy-220 be used, but strains of it selected by physical or chemical mutagenesis methods or strains modified by genetic engineering methods can also be used.

[0071] The method of the present invention achieves a yield of at least 200 g / L for L-sorbose, preferably at least 300 g / L.

[0072] As can be seen from the above, even when using conventional L-sorbose fermentation methods in the art, the recombinant microorganisms of the present invention have significant advantages in improving L-sorbose yield. Therefore, the recombinant microorganisms of the present invention are suitable for conventional L-sorbose fermentation processes in the art.

[0073] Example

[0074] Other objects, features, and advantages of this application will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of this application) are given for illustrative purposes only, as various changes and modifications that can be made within the spirit and scope of this application will become apparent to those skilled in the art upon reading this detailed description.

[0075] All reagents used in the examples, unless otherwise emphasized, are commercially available.

[0076] The construction of recombinant microorganisms in the embodiments of this application includes the following basic operations.

[0077] The yield was determined as follows:

[0078] Sample preparation: Under a nitrogen atmosphere, transfer 1 mL of fermentation broth to a 10 mL centrifuge tube, add 180 μL of 1 mol / L HCl, mix thoroughly, let stand for 3–5 min, then heat in a 92℃ water bath for 30 min; centrifuge to remove the supernatant, add 8 mL of extraction buffer (ethyl acetate: ethanol = 5:3), extract for 2 h, and perform HPLC reverse-phase analysis. HPLC conditions: C18 column: 150 mm × 4.6 mm, mobile phase: methanol: isopropanol = 75:25 (by volume), flow rate: 1.00 mL / min, detection wavelength: 275 nm, injection volume: 40 μL, retention time: 12 min.

[0079] The biomass was determined as follows: 10 mL of fermentation broth was taken, weighed, and 2 mol / L hydrochloric acid solution was added to adjust the pH to about 4.0. The mixture was kept at 80℃ for 20 min, centrifuged and the supernatant was discarded. The mixture was washed with water, centrifuged and the supernatant was discarded again, and dried at 60℃ for 20 hours. The mixture was then weighed and the cell content per kg of fermentation broth was calculated.

[0080] Example 1: Amplification of the gene encoding the global regulatory protein irrE and construction of the recombinant vector

[0081] The genome of radiation-resistant abnormal cocci was extracted (the reagent was from the Ezup column-type bacterial genomic DNA extraction kit from Shanghai Bioengineering Co., Ltd.), and the extraction process was carried out in accordance with the instructions attached to the kit.

[0082] Based on the DNA sequence shown in SEQ ID NO: 1, the upstream primer irrE-F: 5'-ccg was designed using Primer5 primer design software. GAATT CGTGCCCAGTGCCAACGTCAGCCCCCCTTG -3' (underlined area is the EcoRI restriction site) SEQ ID No: 3, downstream primer irrE-R: 5' -cgc GGATCC TCACTGTGCAGCGTCCTGCGGCTCGTC-3' (underlined part is the BamHI restriction site) SEQ ID No: 4.

[0083] Using genomic DNA extracted from *Radiatae abnormalis* as a template, the global regulatory protein *irrE* gene was synthesized by PCR using the high-fidelity enzyme PrimeSTAR (purchased from Dalian Takara Bio Inc.) and primers SEQ ID No: 3 and 4. The following standard reaction system was used:

[0084]

[0085] The amplification program consisted of 30 cycles, each cycle including denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute.

[0086] The PCR product was removed and purified by PCR (the reagent was from the Axygen PrepPCR Clean Kit). The purification process was carried out according to the instructions attached to the kit, and the purified PCR product was obtained.

[0087] Enzyme digestion was performed according to the Takara endonuclease standard system. The standard system is as follows:

[0088]

[0089]

[0090] The enzyme digestion products were removed and gel recovered (the reagents were from the Axygen PrepDNA Gel Recovery Kit). The recovery process was carried out according to the instructions attached to the kit, and the recovered gene fragments were obtained.

[0091] Following the instructions for Takara's T4 ligase, and using the standard system, 5.5 μL of the irrE gene obtained from gel extraction, 3 μL of the plasmid pBBR1MCS-2 obtained from gel extraction, 0.5 μL of T4 ligase, and 1 μL of T4 ligase buffer were mixed and ligated in a water bath at 22°C for 60 minutes to obtain the recombinant plasmid pBBR1MCS-2-irrE.

[0092] The recombinant vector pBBR1MCS-2-irrE was transformed into Escherichia coli BL21 competent cells by heat shock. Colonies that could grow on LB agar containing 50 µg / mL kanamycin were continuously cultured on the same LB agar to obtain genetically stable recombinant Escherichia coli.

[0093] Plasmids were extracted from genetically stable recombinant E. coli (reagents were from the AxyPrep Plasmid DNA Mini Kit), and the extraction process was performed according to the instructions provided with the kit.

[0094] PCR verification using primers irrE-F and irrE-R yielded a fragment of approximately 1.0 kb, indicating that the gene encoding the global regulatory protein irrE has been successfully introduced into recombinant E. coli.

[0095] Example 2 Removal of the Lac promoter

[0096] Design the upstream primer lac-F:

[0097] 5'- GCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCG-3' (underlined part is a homologous sequence) SEQ ID No: 5

[0098] Downstream primer lac-R:

[0099] 5'- CTCATTAGGCACCCCAGGC TGTGGAATTGTGAGCGGATAACAATTTC-3' (underlined part is homologous sequence) SEQ ID No: 6.

[0100] Using recombinant E. coli plasmid DNA validated by PCR as a template, amplification was performed using the high-fidelity enzyme primeSTAR from Takara (Dalian Baosheng) and the recommended system, employing primers SEQ ID No: 5 and 6, via circular PCR. A standard reaction system was used.

[0101]

[0102] The amplification program consisted of 20 cycles, each cycle including denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 6 minutes.

[0103] The PCR product was removed and purified by PCR (the reagent was from the Axygen PrepPCR Clean Kit). The purification process was carried out according to the instructions attached to the kit, and the purified PCR product was obtained.

[0104] The purified PCR product was transformed into Escherichia coli BL21 competent cells by heat shock. Colonies that could grow on LB agar containing 50 μg / mL kanamycin were continuously cultured on the same LB agar to obtain genetically stable recombinant Escherichia coli.

[0105] The recombinant plasmid of genetically stable E. coli was extracted (the reagent was from the AxyPrep Plasmid DNA Mini Kit). The extraction process was carried out according to the instructions of the kit, and the recombinant plasmid pBBR1MCS-2-G-irrE with the lac promoter knocked out was obtained.

[0106] Sequencing verification of the plasmid by Shanghai Bioengineering Co., Ltd. confirmed that the lac promoter had been knocked out and the irrE gene sequence was accurate. E. coli genome was extracted (using the Ezup column-based bacterial genomic DNA extraction kit from Shanghai Bioengineering Co., Ltd.), following the instructions provided with the kit.

[0107] Design the upstream primer proPB-F:

[0108] 5'-ccg CTCGAG AACGAAATCCATGTGTGAAGTTGATCAC-3' (underlined area is the XhoI restriction site) SEQ ID No: 7.

[0109] Downstream primer proPB-R:

[0110] 5'-ccc AAGCTT TTGGCCCATTTCCGCAAACGCCAG-3' (underlined area is the HindIII restriction site) SEQ ID No: 8.

[0111] Using genomic DNA extracted from *E. coli* as a template, the global regulatory protein *irrE* gene was synthesized by PCR using the high-fidelity enzyme PrimeSTAR (purchased from Dalian Takara Bio Inc.) and primers SEQ ID No: 7 and 8. The following standard reaction system was used:

[0112]

[0113] The amplification program consisted of 30 cycles, each cycle including denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 1 minute.

[0114] The PCR product was removed and purified by PCR (the reagent was from the Axygen PrepPCR Clean Kit). The purification process was carried out according to the instructions attached to the kit, and the purified PCR product was obtained.

[0115] Enzyme digestion was performed according to the Takara endonuclease standard system. The standard system is as follows:

[0116]

[0117]

[0118] The enzyme digestion products were removed and gel recovered (the reagents were from the Axygen PrepDNA Gel Recovery Kit). The recovery process was carried out according to the instructions attached to the kit, and the recovered gene fragments were obtained.

[0119] Following the Takara T4 ligase instructions, and using the standard regimen, 5.5 μL of the proPB sequence obtained from the gel electrophoresis, 3 μL of the plasmid pBBR1MCS-2-G-irrE obtained from the gel electrophoresis, 0.5 μL of T4 ligase, and 1 μL of T4 ligase buffer were mixed and ligated in a water bath at 22°C for 60 minutes to obtain the recombinant plasmid pBBR1MCS-2-G-proPB-irrE. Figure 2 As shown.

[0120] Example 3: Recombination of a gene encoding the global regulatory protein irrE and the osmotic pressure-regulating promoter proPB. Construction of microorganisms

[0121] The recombinant vector pBBR1MCS-2-G-proPB-irrE was transformed into *E. coli* S17-1 competent cells using a heat shock method. Colonies capable of growing on LB agar plates containing 50 μg / mL kanamycin were then collected to obtain recombinant *E. coli*. Genomic DNA was extracted from the recombinant *E. coli* and verified by PCR using primers proPB-F and irrE-R. A fragment of approximately 1.2 kb was obtained, indicating that the proPB promoter and the gene encoding the globally regulatory protein irrE had been successfully introduced into the recombinant *E. coli*. Sequencing verification by Shanghai Bioengineering Co., Ltd. confirmed that the sequence was identical to the sequence on NCBI.

[0122] The recombinant vector pBBR1MCS-2-G-proPB-irrE from recombinant Escherichia coli was introduced into Gluconobacterium oxysporum via conjugation transfer. Gluconobacterium oxysporum, which can grow on plates containing 50 μg / mL of cefoxitin sodium and kanamycin, was continuously transferred for three generations on the same plate to obtain genetically stable recombinant Gluconobacterium oxysporum Gy-220.

[0123] The genome of recombinant glucosamine oxidase was extracted and verified by PCR using primers proPB-F and irrE-R. A fragment of approximately 1.2 kb was obtained, indicating that the proPB promoter and the gene encoding the global regulatory protein irrE have been successfully introduced into recombinant glucosamine oxidase Gy-220.

[0124] In the construction of the above-mentioned recombinant microorganisms, the specific steps for transforming the recombinant vector into Escherichia coli S17-1 are as follows:

[0125] Remove the *E. coli* S17-1 competent cells, incubate on ice for 10 minutes, add the recombinant plasmid pBBR1MCS-2-G-proPB-irrE, incubate on ice for 20 minutes, heat shock for 90 seconds, incubate on ice for 5 minutes, and add 600 μL of LB liquid medium. Incubate at 37°C for 45 minutes, centrifuge at 5000 rpm for 5 minutes, discard 500 μL of supernatant, and spread the remaining liquid onto agar plates containing kanamycin.

[0126] The specific steps for the bonding transfer are as follows:

[0127] Inoculate *Glucosamine oxidans* into test tubes containing 10 mL of liquid culture medium and incubate at 30 °C and 200 rpm for 50 h.

[0128] Thirty-two hours later, positive clones transformed with *E. coli* S17-1 were inoculated into LB medium and cultured overnight at 37°C and 200 rpm. Fifteen hours later, *E. coli* S17-1 was transferred to each 5 mL LB medium tube, with 100 μL of bacterial culture and 5 μL of kanamycin added. The tubes were then incubated at 37°C in a shaker. After 3–4 hours of incubation, 4 mL of *Glucobacterium oxysporum* culture and 2 mL of *E. coli* culture were aliquoted into 2 mL centrifuge tubes (1 mL per tube) and centrifuged at 5000 rpm for 5 minutes. The supernatant was discarded, and 1 mL of fresh LB medium was added to gently resuspend the bacteria. The tubes were centrifuged at 5000 rpm for 5 minutes. The bacterial culture was mixed with *Glucobacterium oxysporum* at a ratio of 100:50 and 100:100. A 0.22 μm filter membrane was placed in the center of an LB plate, and the mixed bacterial culture was poured into the central area of ​​the membrane. The LB plate was then carefully transferred to a 32°C incubator and incubated overnight.

[0129] Use tweezers to transfer the filter membrane into a 2 mL EP tube, then use 500 μL LB liquid medium to wash off the bacteria on the filter membrane and disperse them. Dispense the solution onto agar plates, 350 μL per plate, and incubate at 32°C for 72 hours.

[0130] Post-conjugation transfer testing to determine if a clone is positive:

[0131] Select 2–5 well-grown colonies and culture them for 48–60 hours. Transplant the colonies and culture for another 2–4 hours. Extract the plasmid according to the Axygen plasmid extraction kit instructions. In a centrifuge tube, add 34 μL of the plasmid obtained in step 2, 1 μL each of XhoI and BamHI, and 4 μL of buffer. Incubate at 37°C for 1.5 hours for enzyme digestion. Electrophoresis after digestion showed a clear band at approximately 1.2 kb, consistent with expectations. After gel extraction and recovery, the obtained DNA fragment was sequenced for verification, confirming a positive clone.

[0132] The strain obtained by this method was preserved as a strain of *Gluconobacter oxydans*, named Gy-220. It was deposited on January 22, 2019, at the China General Microbiological Culture Collection Center (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China) with accession number CGMCC No. 17222.

[0133] Example 4: Production of L-sorbose by fermentation using recombinant microorganisms

[0134] Bacterial strain: Recombinant Gluconobacterium oxygenase Gy-220

[0135] Culture medium formulation:

[0136] Inoculum culture medium (g / L): D-sorbitol 160, yeast extract 6, peptone 7, light calcium carbonate 1.5; pH adjusted to 5.5, autoclaved at 121℃ for 20 min;

[0137] Fermentation medium (g / L): D-sorbitol 450, yeast extract 2, peptone 2, light calcium carbonate 1.5; pH adjusted to 5.5, autoclaved at 121℃ for 20 min;

[0138] Preparation of inoculum in shake flasks: Use an inoculation loop to pick up an appropriate amount of L-sorbitol recombinant slant bacteria and inoculate it into the inoculum culture medium. The shake flask volume is 500 mL, the liquid volume is 60 mL, the culture temperature is 30℃, the rotation speed is 220 r / min, and the culture is carried out for 24 h to prepare the inoculum for later use.

[0139] Fermentation in a 30L fermenter: inoculum size 5%, initial fermentation volume 20L, pH controlled at 5.0-5.5 throughout, temperature 36-37℃, aeration ratio 1.0vvm, tank pressure 0.05Mpa, stirring speed 500rpm, fermentation cycle 26-28 hours, and sorbitol molar conversion rate 94-97% after fermentation.

[0140] Comparative Example 1: Comparison of recombinant microorganisms in L-sorbitol fermentation

[0141] The original strain of *Glucobacterium oxygenase* and the recombinant *Glucobacterium oxygenase* Gy-220 were fermented according to the fermentation method in Example 4. The fermentation results are as follows:

[0142]

[0143] Comparative Example 1 showed that the recombinant *Gluconobacter oxydans* constructed by introducing the gene encoding the global regulatory protein *irrE* and replacing the promoter could regulate the expression of the global regulatory protein *irrE* through changes in osmotic pressure. This stagedly improved the stress resistance of the L-sorbitol-producing bacteria, meeting the needs of the cells to tolerate harsh environments at different stages of fermentation, and promoting the accumulation of cell biomass and the synthesis of L-sorbitol. Simultaneously, its sorbitol conversion capacity was enhanced, and the L-sorbitol yield was further improved.

[0144] Industrial availability

[0145] The recombinant microorganisms for L-sorbose production via fermentation provided by this invention contain a gene encoding the globally regulatory protein irrE. This enhances the microorganisms' tolerance to various stresses such as osmotic pressure, oxidation, pH, and heat, prolonging the logarithmic growth phase and promoting further biomass accumulation. Furthermore, the microorganisms maintain vigorous growth and metabolic activity during fermentation, thereby increasing L-sorbose yield. Therefore, recombinant microorganisms constructed using this gene can advantageously improve L-sorbose production rates. Consequently, the recombinant microorganisms constructed using the method of this invention have broad application prospects in the industrial production of L-sorbose.

Claims

1. A method for preparing recombinant microorganisms, characterized in that, The method includes the following steps: a. The gene encoding the global regulatory protein irrE was cloned from a parental strain containing the gene encoding the global regulatory protein irrE; b. The gene encoding the global regulatory protein irrE is ligated into a vector to construct a recombinant vector containing the gene encoding the global regulatory protein irrE; c. The recombinant vector is introduced into L-sorbitol-producing bacteria to obtain the recombinant microorganism; Step b includes, by promoter replacement, knocking out the promoter controlling the expression of the gene encoding the global regulatory protein irrE on the recombinant vector and inserting other different promoters to further regulate the expression of the gene encoding the global regulatory protein irrE; The promoter inserted in step b is the osmotic pressure regulating promoter proPB; The osmolarity-regulating promoter proPB is obtained from a polynucleotide molecule or polynucleotide sequence containing a partial nucleotide sequence of at least 70 consecutive nucleotides of SEQ ID NO: 2, preferably containing at least 100 consecutive nucleotides, more preferably containing at least 150 consecutive nucleotides, and most preferably containing the complete nucleotide sequence of SEQ ID NO:

2. Optionally, the polynucleotide sequence has at least 80% homology with SEQ ID NO: 2, preferably at least 90% homology; Preferably, the osmotic pressure-regulated promoter proPB is the nucleotide sequence represented by SEQ ID NO:

2.

2. The method for preparing recombinant microorganisms according to claim 1, characterized in that, The osmolarity-regulated promoter proPB is isolated from bacteria, preferably Escherichia, and more preferably Escherichia coli.

3. The method for preparing recombinant microorganisms according to any one of claims 1 to 2, characterized in that, The carrier in step b is selected from pBR322 and its derivatives, pACYC177, pACYC184 and its derivatives, RK2, pBBR1MCS-2, clay carriers and their derivatives, with pBBR1MCS-2 being preferred.

4. The method for preparing recombinant microorganisms according to any one of claims 1 to 3, characterized in that, Step a includes designing primers based on the DNA sequence shown in SEQ ID NO: 1, using genomic DNA extracted from the parent strain as a template, to synthesize the gene encoding the global regulatory protein irrE.

5. The method for preparing recombinant microorganisms according to any one of claims 1 to 4, characterized in that, The gene encoding the global regulatory protein irrE in step a is obtained from a polynucleotide molecule or polynucleotide sequence containing a partial nucleotide sequence of at least 100 consecutive nucleotides of SEQ ID NO: 1, preferably containing at least 300 consecutive nucleotides, more preferably containing at least 600 consecutive nucleotides, and most preferably containing the complete nucleotide sequence of SEQ ID NO: 1, wherein the polynucleotide sequence has at least 80% homology with SEQ ID NO: 1, preferably at least 90% homology; Preferably, the gene encoding the global regulatory protein irrE has the nucleotide sequence represented by SEQ ID NO:

1.

6. The method for preparing recombinant microorganisms according to any one of claims 1 to 5, characterized in that, The introduction method in step c is selected from transformation, transduction, conjugation transfer, and electroporation. The L-sorbose-producing bacteria are selected from bacteria or fungi, preferably bacteria of the genus *Gluconobacter*, and more preferably *Gluconobacter oxydans*. Preferably, step c includes transforming the recombinant vector obtained in step b into Escherichia coli S17-1 competent cells, and then introducing it into L-sorbose-producing bacteria via conjugation transfer to obtain genetically stable recombinant microorganisms.

7. A recombinant vector, characterized in that, The recombinant vector contains the gene encoding the global regulatory protein irrE as described in claim 5, and the osmotic pressure-regulating promoter proPB as described in claim 1.

8. A recombinant microorganism, characterized in that, It contains the recombinant vector of claim 7.

9. A glucosidobacterium oxidans, with accession number CGMCC No. 17222.

10. A method for producing L-sorbose, characterized in that, The method includes using recombinant microorganisms prepared by the method of any one of claims 1 to 6 or glucosamine oxidase as described in claim 9 to produce L-sorbose.