Method for constructing alcoholic liver injury animal model and application

By knocking out the Cfhr3 gene in mice using CRISPR-Cas9 technology and administering ethanol via gavage, the problem of rapidly constructing an alcoholic liver injury model has been solved, achieving effective simulation of liver injury and providing an animal model for screening therapeutic drugs.

CN122060801APending Publication Date: 2026-05-19ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2026-03-30
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

There is currently a lack of effective methods for rapidly and efficiently constructing Cfhr3 gene knockout mouse models to study alcoholic liver injury.

Method used

The Cfhr3 gene in mice was knocked out using CRISPR-Cas9 technology, and an alcoholic liver injury model was established by gavage with 50% ethanol aqueous solution. sgRNA1 and sgRNA2 were used to target specific sites in the Cfhr3 gene, forming DNA double-strand breaks, which, combined with ethanol stimulation, induced liver injury.

Benefits of technology

An animal model of alcoholic liver injury was successfully constructed, which showed ballooning degeneration of liver tissue, fat vacuolation, hepatocyte enlargement and liver damage, increased liver index, and elevated levels of alanine aminotransferase and glucose in the blood, simulating the pathological changes of alcoholic liver injury.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for constructing an alcoholic liver injury animal model and application, and belongs to the technical field of gene editing. The technical problem to be solved by the invention is how to construct the alcoholic liver injury animal model. The method for constructing the alcoholic liver injury animal model disclosed by the invention comprises the following steps: knocking out an animal Cfhr3 gene to obtain a Cfhr3 gene knockout animal; and performing intragastric administration on the Cfhr3 gene knockout animal with ethanol or an aqueous solution thereof to obtain the alcoholic liver injury animal model. The animal model constructed by the method shows that after ethanol gavage, liver tissue has balloon-like change, obvious fat vacuoles appear, hepatic cord structures disappear, hepatocytes are swollen, the liver tissue is damaged, the liver index is improved, and the content of glutamic-pyruvic transaminase and glucose in blood is increased. The alcoholic liver injury animal model is successfully obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a method for constructing an animal model of alcoholic liver injury and its application. Background Technology

[0002] Liver cancer is the fifth most common cancer worldwide and the second leading cause of cancer death. Hepatocellular carcinoma (HCC) is the most common type, accounting for 90% of all cases. It is also the fourth leading cause of cancer death globally. HCC occurs in liver damage and involves inflammation that leads to hepatocyte necrosis, regeneration, and chronic liver disease. Chronic liver diseases, including alcoholic liver disease, metabolic-associated fatty liver disease, viral hepatitis, fibrosis, and cirrhosis, are key drivers in the development of liver cancer and significantly contribute to the high global mortality rate related to liver disease.

[0003] The complement system, as part of the innate immune system, plays an anti-tumor role or promotes tumorigenesis and progression in various types of cancer. On one hand, complement activation may serve as an anti-tumor defense mechanism, participating in immune surveillance and complement-dependent cytotoxicity. On the other hand, complement system activation may induce inflammation in the tumor microenvironment to promote tumorigenesis and cancer progression. Complement factor H is a negative regulator of the alternative pathway in the complement system. Its deficiency in mice has been reported to lead to spontaneous liver tumors. Complement factor H-associated 3 (Cfhr3), a member of the complement factor H-associated protein family, encodes complement factor H-associated protein 3, which binds to heparin and participates in complement regulation; it is a key regulator inhibiting complement system activation.

[0004] To address the above issues, constructing experimental animal models of liver injury is crucial for research on liver diseases. How to rapidly and efficiently construct Cfhr3 gene knockout mouse models is an urgent problem to be solved. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to construct an animal model of alcoholic liver injury.

[0006] To address the aforementioned technical problems, this invention first provides a method for constructing an animal model of alcoholic liver injury, the method comprising:

[0007] 1) Knock out the Cfhr3 gene in animals to obtain Cfhr3 gene knockout animals; 2) An animal model of alcoholic liver injury was obtained by gavage of the Cfhr3 gene knockout animals with ethanol or its aqueous solution.

[0008] Furthermore, the Cfhr3 gene knockout in the animal was performed using the CRISPR-Cas9 method.

[0009] Furthermore, the sgRNAs used to knock out the Cfhr3 gene in the animal are sgRNA1 and sgRNA2. The target sequence of sgRNA1 is from position 21 to position 40 of SEQ ID No. 1; the target sequence of sgRNA2 is from position 188 to position 207 of SEQ ID No. 1.

[0010] In one embodiment of the present invention, the sequence of sgRNA1 is SEQ ID No.2, and the sequence of sgRNA2 is SEQ ID No.3.

[0011] In one embodiment of the present invention, the Cfhr3 gene knockout animal deletes positions 25-191 of SEQ ID No. 1 and inserts 93bp between positions 298-299 of SEQ ID No. 1.

[0012] In one embodiment of the present invention, the ethanol aqueous solution is a 50% (volume percentage) ethanol aqueous solution.

[0013] Furthermore, the animal is a mammal. Furthermore, the mammal is a mouse.

[0014] Furthermore, the animal model of alcoholic liver injury is an acute alcoholic liver injury animal model.

[0015] Furthermore, the animal model of alcoholic liver injury is characterized by ballooning changes in liver tissue, the appearance of obvious fat vacuoles, loss of hepatic cord structure, hepatocyte enlargement, and / or liver tissue damage after ethanol gavage.

[0016] Furthermore, the animal model of alcoholic liver injury is also characterized by increased liver index and / or elevated levels of alanine aminotransferase and / or glucose in the blood after ethanol gavage.

[0017] The present invention also provides the application of the animal model obtained by the method for constructing an animal model of alcoholic liver injury in screening drugs for the treatment of alcoholic liver injury.

[0018] The present invention also provides a product for constructing an animal model of alcoholic liver injury, the product containing a substance for knocking out the Cfhr3 gene and ethanol or an aqueous solution thereof.

[0019] Specifically, the product consists of a substance for knocking out the Cfhr3 gene and ethanol or an aqueous solution thereof.

[0020] The animal model constructed by the method of this invention exhibits ballooning changes in liver tissue, significant fat vacuolation, loss of hepatic cord structure, hepatocyte enlargement, and liver tissue damage after ethanol gavage. Furthermore, liver indices are elevated, and blood alanine aminotransferase and glucose levels are increased. This indicates that liver damage is more pronounced after Cfhr3 gene knockout compared to the wild type, and Cfhr3 knockout can promote the occurrence of liver damage. Attached Figure Description

[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1 Cfhr3 gene knockout strategy.

[0023] Figure 2 Genotyping of F0 generation mice.

[0024] Figure 3 Sequencing results of F0 generation mice.

[0025] Figure 4 Cfhr3 homozygous knockout mouse breeding strategy and genotyping identification. A. Flowchart of F2 generation mouse acquisition; B. F2 generation mouse identification results.

[0026] Figure 5 Expression of Cfhr3 mRNA in the liver of Cfhr3 knockout mice.

[0027] Figure 6 Phenotypic analysis of Cfhr3 gene knockout mice. A represents changes in mouse body weight; B represents changes in mouse liver index; C represents changes in biochemical indicators; D represents liver HE staining results. Detailed Implementation

[0028] In this article, unless otherwise defined herein, terms shall be understood according to the ordinary usage of those of ordinary skill in the relevant art. Examples of resources that describe many of the terms related to molecular biology used herein can be found in the following documents: Alberts et al., Molecular Biology of The Cell, 5th Edition, Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th Edition, Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th Edition, Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0029] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the technical field to make further improvements and do not constitute any limitation to the present invention in any way.

[0030] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0031] In this article, Graphpad 8.0 software is used for data analysis. The data are expressed as mean ± standard deviation (x ± s) and analyzed by t-test. P < 0.05 is considered statistically significant.

[0032] Experimental animals: The fertilized eggs of Cfhr3 gene-edited mice are from C57BL / 6J mice, which are products of Beijing SPF Biotechnology Co., Ltd., with the experimental animal production license [SYXK (Beijing) 2019-0010]. The female mice are 3.5 - 4 weeks old, and the male mice are 2 - 5 months old. They are raised in a SPF animal barrier facility with the relative humidity controlled at 40% - 70% and the temperature controlled at 22 - 26 °C.

[0033] Reagents: Pregnant mare serum gonadotropin (PMSG, Veterinary Drug Approval No. 110914564, Ningbo Sansheng Co., Ltd.); Gonadotropin (HCG, Veterinary Drug Approval No. 110911282, Ningbo Sansheng Co., Ltd.); M2 medium (M7167, Sigma); Mineral oil (M8410, Sigma); KSOM (MR-121, Sigma); EnGen Spy Cas9 NLS (M0646T, NEB); 2,2,2-Tribromoethanol (T48402, Sigma); Rat tail direct PCR kit (TP-01333, Fuji Biotechnology); TRIzol RNA extraction reagent (15596-018CN, Invitrogen); ReverTra Ace® qPCR RT Master Mix with gDNA remover (FSQ-301, Toyobo); SYBR® Green Realtime PCR Master Mix (QPK-201, Toyobo); Paraffin (39601095, Leica).

[0034] Instruments: Stereomicroscope (SMZ800N, Nikon); Clean bench (SJ-CJ-IBU, Suzhou Cleanroom); CO2 incubator (3111, Thermo Scientific); Pipettes (Eppendorf); Microsystems (FemtoJet 4i, Eppendorf); Inverted microscope (Axio Observer 3, ZEISS); Low-temperature centrifuge (Z261MK, HERMLE); Cryo-Grind Analyzer (JXFSTPRP-CLN-48, Jingxin); PCR instrument (T100, Bio-RAD); qPCR instrument (C1000, Bio-RAD); Fully automated biochemical analyzer (Au480, BECKMAN COULTER).

[0035] Example 1: Method for constructing a Cfhr3 gene knockout mouse model based on CRISPR / Cas9 This embodiment provides a method for constructing a Cfhr3 gene knockout mouse model based on CRISPR / Cas9, including the following steps: The Cfhr3 gene is located on mouse chromosome 1, with two transcripts encoding 6 and 7 exons respectively, sharing the first 6 exons. The mRNA lengths are 1574 bp and 1751 bp, respectively. The translation start point ATG is located at Exon 2, and the translation termination site TGA is located at Exon 6. This invention uses CRISPR / Cas9 technology to knock out the sequence of Exon 3 of Cfhr3, and constructs a Cfhr3 knockout mouse model by microinjection. CRISPR / Cas9 is a technology that uses sgRNA to guide Cas9 endonucleases to target and edit genes. Its working principle is that the Cas9 endonucleases, guided by sgRNA, cut DNA at a specific site, forming a DNA double-strand break (DSB). Then, homologous recombination (HR) or non-homologous recombination repairs the broken DNA, resulting in the insertion or deletion of one or more base pairs. This causes premature termination of the coding sequence, thereby disrupting gene function and achieving the purpose of gene knockout. In this embodiment, Cfhr3 gene knockout mice were obtained by microinjection, and their genotypes were identified and purified. It was found that the constructed Cfhr3 gene knockout mice can be used as an animal model of liver injury for evaluation in liver disease-related liver injury or in pharmaceuticals.

[0036] 1. Construction of Cfhr3 gene knockout mice Two sgRNAs, sgRNA1 and sgRNA2, were designed to knock out Exon 3 of Cfhr3. sgRNA1 targets and cleaves the 5' end of Exon 3, while sgRNA2 targets and cleaves the 3' end of Exon 3. Figure 1 ).

[0037] Exon 3 and the subsequent sequence are as follows: tgaaaccttgtgattttccacaactcaaatatggacatctgtattacgaagagagagtaagaccctac ttcccagtgtctataggaaaggaatacagctattactgtgacgacgggttttcaacaccttctgggtcatactggg actaccttcgttgcacagcacaagggtgggagcctaaagtcccatgcctcagtaagccaatgcctttgtatttaactatgtttagctcttttaaagagaaagcatatgcataattatagttaagtttctcatgacaagcataagaccaacaaaagtatctgtgagacaaaaggctagtttctgtcctttgggagcagctc ttcatgaaatgtacaaacactgtagggactatggaaatgcctttatctcttgcatattttattcatagaaagtaaagataaatgctactcatttaaatatttatgattaatttttttcctgaatgccatgcatgctcattaaaca (seq ID No.1) (the underlined part is the Exon 3 sequence).

[0038] sgRNA1 target sequence: AGATGTCCATATTTGAGTTG; sgRNA2 target sequence: GCATTGGCTTACTGAGGCAT.

[0039] The mixture of sgRNA and Cas9 was microinjected into fertilized eggs from C57BL / 6J mice, which were then transplanted into pseudopregnant female C57BL / 6J mice to obtain F0 generation mice. The preparation method of the injection solution is shown in Table 1.

[0040] Table 1. Preparation of Microinjection Solution

[0041] In Table 1, the sequence of sgRNA1 is as follows: AGAUGUCCAUAUUUGAGUUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID No. 2); The sequence of sgRNA2 is as follows: GCAUUGGCUUACUGAGGCAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID No. 3).

[0042] Cas9: NEB, M0646T.

[0043] 10X NEB buffer: NEB, M0646T.

[0044] PCR identification and phenotypic analysis of Cfhr3 gene knockout mice: A pair of primer sequences was designed in the target knockout region (Table 2), and genotyping was performed. Figure 2 ) and sequencing ( Figure 3 ).

[0045] Table 2. Primer sequences for genotype identification

[0046] Genotyping and sequencing results are as follows: A total of 17 mice were born after microinjection, with 6 positive mice. Among the 6 positive mice, mouse 4 had a 6bp deletion and partial base substitution; mouse 10 had a 6bp deletion and 6bp insertion with base substitution; mouse 11 had a 46bp deletion and partial base substitution; mouse 13 had a 254bp deletion and 189bp insertion with base substitution; mouse 15 had a 74bp deletion and 35bp insertion with partial base substitution; and mouse 17 had a 167bp deletion and 93bp insertion (deleting positions 25-191 of SEQ ID No. 1 and inserting 93bp between positions 298-299 of SEQ ID No. 1). Figure 3 ).

[0047] The selected F0 generation 17 positive mice were crossed with wild-type C57BL / 6J mice to obtain the F1 generation mice. The F1 generation mice were then self-crossed to obtain the F2 generation mice. Homozygous knockout mice were selected, which constitute the Cfhr3 gene knockout mouse model. Figure 4 (A)

[0048] Genotyping was performed, and Cfhr3 homozygous knockout mice from the F2 generation were selected for propagation and subsequent experiments. Figure 4 In the middle B region, the wild-type band is 512 bp, and the knockout band is 345 bp. In the figure, WT represents wild-type mice, KO represents homozygous knockout mice, and HET represents heterozygous knockout mice. The primers used are located upstream and downstream of the deleted 167 bp fragment. The deleted part is shown in the underlined part of SEQ ID No. 1 above.

[0049] qPCR was used to identify the effect of Cfhr3 gene knockout.

[0050] Cfhr3 KO homozygous knockout mice (denoted as Cfhr3) were used. - / - Mice) and littermate wild-type mice (denoted as Cfhr3) + / +Mouse liver tissue was used for qPCR detection. cDNA was synthesized using TRIzol RNA extraction reagent and a reverse transcription kit, and the expression level of Cfhr3 mRNA was measured using Gapdh as an internal control. All samples were tested in triplicate on the same plate. qPCR primer sequences are shown in Table 3.

[0051] Table 3. qPCR primer sequences

[0052] The expression of Cfhr3 mRNA in the liver was detected, and the results showed that Cfhr3... - / - The expression level of Cfhr3 mRNA was significantly decreased in mice, indicating that Cfhr3 was successfully knocked out. Figure 5 ).

[0053] 2. Establishment and phenotypic analysis of an acute alcoholic liver injury model using Cfhr3 gene knockout mice. Forty male mice were divided into Cfhr3 groups. - / - ethanol group of mice (9 Cfhr3) - / - Mice), Cfhr3 - / - Mouse saline group (9 Cfhr3) - / - Mice), Cfhr3 + / + ethanol group of mice (11 Cfhr3) + / + Mice), Cfhr3 + / + Mouse saline group (11 Cfhr3 mice) + / + Mice were administered 50% (volume percentage) ethanol aqueous solution by gavage at a dose of 15 ml / kg, while mice in the saline group were administered the same volume of saline by gavage. After gavage, mice were fasted for 16 hours. The mice were then anesthetized, and liver and body weights were measured. Liver hematoxylin and eosin (HE) staining was performed (liver fixed with PFA, graded dehydration followed by paraffin embedding, sectioning, dewaxing, HE staining, dehydration, permeabilization, and mounting; pathological changes in liver tissue were observed after HE staining). Serum biochemical indicators were detected (blood was collected from mice via enucleation, allowed to stand at room temperature for 2 hours, centrifuged at 3000 rpm for 10 minutes, and the supernatant was collected; ALT, AST, and other biochemical indicators were measured using a biochemical analyzer).

[0054] Under normal physiological conditions (administered via gavage with saline), Cfhr3 occurs between the 2nd and 6th week after birth. - / - The mice showed no abnormalities in weight change compared to wild-type mice, and were not affected by sex. Figure 6(A) indicates that Cfhr3 gene knockout has no effect on the growth and development of mice. Serum biochemical indicators such as liver index (liver index = liver weight / body weight × 100%), alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), and glucose (GLU) showed no difference compared to wild-type mice. Figure 6 (Middle BC). Furthermore, liver HE staining showed Cfhr3. - / - The liver tissue structure of the mice was intact, with no significant changes compared to wild-type mice. Figure 6 (D). The above results indicate that Cfhr3 under normal physiological conditions - / - The mice showed no liver damage phenotype.

[0055] Establish an acute alcoholic model to further verify the effect of Cfhr3 under alcohol stimulation. - / - Liver damage in mice. First, compared to wild-type mice, Cfhr3... - / - HE staining of mouse livers revealed fat vacuoles of varying sizes. Figure 6 The presence of Cfhr3 (D) indicates the successful establishment of an animal model of acute alcoholic liver injury. Further analysis of Cfhr3 under alcohol stimulation is needed. - / - Liver index in mice, Cfhr3 - / - The liver index of mice was significantly higher than that of wild-type mice. Figure 6 (B). Biochemical tests revealed that, compared to wild-type mice, Cfhr3... - / - There were no significant differences in serum aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), and albumin (ALB) levels in mice, but alanine aminotransferase (ALT) and glucose (GLU) levels were significantly elevated. Figure 6 (C). The specific results of HE staining of liver tissue sections show that Cfhr3... - / - The liver tissue of mice showed ballooning degeneration with obvious fat vacuoles, disappearance of hepatic cord structure, and significant hepatocyte enlargement, and the overall damage was more severe than that of wild-type mice. Figure 6 (D). The above results indicate that Cfhr3 - / - A mouse model of acute alcoholic liver injury was successfully established, and Cfhr3 knockout promoted the occurrence of liver injury.

[0056] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Methods for constructing animal models of alcoholic liver injury, including: 1) Knock out the Cfhr3 gene in animals to obtain Cfhr3 gene knockout animals; 2) An animal model of alcoholic liver injury was obtained by gavage of the Cfhr3 gene knockout animals with ethanol or its aqueous solution.

2. The method according to claim 1, characterized in that: The Cfhr3 gene knockout in the animals was performed using the CRISPR-Cas9 method.

3. The method according to claim 2, characterized in that: The sgRNAs used to knock out the Cfhr3 gene in the animals are sgRNA1 and sgRNA2. The target sequence of sgRNA1 is from position 21 to position 40 of SEQ ID No. 1; the target sequence of sgRNA2 is from position 188 to position 207 of SEQ ID No.

1.

4. The method according to any one of claims 1-3, characterized in that: The animal in question is a mammal.

5. The method according to claim 4, characterized in that: The mammal in question is the mouse.

6. The method according to any one of claims 1-5, characterized in that: The animal model of alcoholic liver injury is an acute alcoholic liver injury animal model.

7. The method according to any one of claims 1-6, characterized in that: The animal model of alcoholic liver injury is characterized by ballooning changes in liver tissue, obvious fat vacuoles, disappearance of hepatic cord structure, hepatocyte enlargement, and / or liver tissue damage after ethanol gavage.

8. The method according to claim 7, characterized in that: The animal model of alcoholic liver injury was also characterized by increased liver indices and / or elevated levels of alanine aminotransferase and / or glucose in the blood after ethanol gavage.

9. The use of animal models obtained by any of the methods described in claims 1-8 in screening drugs for the treatment of alcoholic liver injury.

10. Products used to construct animal models of alcoholic liver injury contain a substance for knocking out the Cfhr3 gene and ethanol or an aqueous solution thereof.