Method and kit for detecting methylation and expression level of PRSS33 gene

Abstract

The invention provides a method and a kit for detecting methylation and expression level of a PRSS33 gene. The method is realized by detecting methylation level and / or mRNA expression level of a PRSS33 gene promoter region from bone marrow or a peripheral blood sample. In an MDS patient, the PRSS33 shows characteristic promoter hypermethylation and gene expression down-regulation; the methylation level is preferably detected by adopting a bisulfite sequencing method, and the mRNA expression level is determined by reverse transcription real-time fluorescent quantitative PCR (Polymerase Chain Reaction); furthermore, the detection result can be used for risk stratification and prognosis evaluation of MDS and monitoring of demethylation drug treatment response; on the other hand, the invention also provides a kit containing the specific primer pair for implementing the detection, and the kit is used for detecting the methylation and expression level of the PRSS33 gene.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection and molecular diagnostics technology, and more specifically, to a method and kit for detecting PRSS33 gene methylation and expression levels. Background Technology

[0002] Myelodysplastic syndromes (MDS) are a group of clonal myeloid neoplasms originating from hematopoietic stem / progenitor cells, characterized by ineffective hematopoiesis, dysplastic hematopoiesis in the bone marrow, and peripheral blood cytopenia. Patients often experience anemia, infections, and bleeding tendencies. This disease is prevalent in the elderly and severely impacts their quality of life and prognosis.

[0003] Currently, the diagnosis and classification of MDS is a complex process requiring multi-platform integration. Clinical practice typically follows this pathway: initial screening begins with complete peripheral blood counts and smears. When unexplained cytopenia or morphological abnormalities are found, further bone marrow biopsy is necessary to assess the degree of bone marrow hyperplasia, the developmental abnormalities of different cell lines, and the proportion of primitive cells. Furthermore, to obtain clonal evidence and complete risk stratification, cytogenetic analysis and molecular genetic testing are also required. For atypical cases, flow cytometry immunophenotyping is often used to aid in differentiation.

[0004] However, traditional diagnostic systems still face several technical bottlenecks in practical applications: morphological assessment relies heavily on the subjective experience of the reader, especially in early or borderline cases, resulting in low consistency in interpretation; and abnormal hematopoiesis is not unique to MDS, easily leading to misdiagnosis; traditional karyotype analysis in cytogenetic examination has a long cycle and requires high quantity and quality of live cells in the sample, while FISH, although not dependent on live cells, has limited detection targets and cannot cover all abnormalities, requiring combination with other methods; the objectivity of flow cytometry analysis results is easily affected by differences in antibody panel design and gating strategies, making it difficult to achieve complete data standardization and mutual recognition between different laboratories or operators; NGS testing has high costs and time, requires high bioinformatics analysis capabilities, and the clinical significance of some gene mutations still needs to be comprehensively interpreted in conjunction with the patient's clinical manifestations. In summary, existing detection methods have room for improvement in terms of standardization, detection efficiency, and ease of operation. Clinically, there is an urgent need to establish more objective, rapid, reproducible, and easily scalable detection methods and biomarkers to improve the accuracy and efficiency of MDS screening, diagnosis, and risk stratification.

[0005] PRSS33 (serine protease) is located on human chromosome 16p13.3 and belongs to the serine protease family. It is mainly expressed in immune cells such as macrophages and eosinophils, and participates in inflammatory responses and tissue homeostasis regulation. Currently, there are few studies on the role of PRSS33 in tumorigenesis and development, especially regarding its expression characteristics, regulatory mechanisms, and clinicopathological significance in malignant tumors (MDS).

[0006] Therefore, this study aims to demonstrate the potential value of PRSS33 as a novel molecular biomarker for MDS by clarifying its expression pattern and correlation with clinical characteristics. The findings are expected to provide a new auxiliary diagnostic and prognostic indicator for MDS, deepen our understanding of its pathogenesis, and provide a theoretical basis for the development of subsequent targeted therapy strategies. Summary of the Invention

[0007] This invention reveals for the first time the characteristic epigenetic alterations of the PRSS33 gene in myelodysplastic syndrome (MDS)-related ex vivo samples, with promoter region hypermethylation accompanied by gene expression silencing. Systematic detection of ex vivo bone marrow samples from MDS-derived and healthy sources confirmed a significant negative correlation between PRSS33 methylation levels and expression levels. Furthermore, this alteration was significantly correlated with IPSS-R risk stratification indicators and key clinical indicators (hemoglobin, eosinophil count, and bone marrow blast cell ratio). Based on this novel discovery, this invention establishes a molecular detection system for MDS-related samples centered on PRSS33, providing objective and quantifiable new biomarkers for the detection of MDS-related ex vivo samples, molecular marker screening, and data quantitative analysis.

[0008] This invention provides an in vitro detection method and kit for PRSS33 gene methylation and expression levels. The method detects the methylation level of the PRSS33 gene promoter region and its mRNA expression level in isolated bone marrow or peripheral blood samples. In MDS-derived samples, PRSS33 exhibits promoter hypermethylation accompanied by downregulated gene expression. Specifically, the method includes determining the methylation status using bisulfite sequencing and determining the gene expression level using reverse transcription real-time quantitative PCR, followed by normalization analysis using the 2^-ΔΔCt method with the internal reference gene GAPDH. This method can be used for molecular characterization analysis, data modeling, and index quantification of in vitro samples. Furthermore, this invention also provides a kit containing the specific primer pairs required for the detection. Compared to the complex detection systems of existing technologies that rely on morphology, cytogenetics, and multi-gene sequencing, this invention provides a more standardized, easy-to-operate molecular detection tool with objective quantitative indicators.

[0009] In a first aspect, the present invention provides a method for detecting PRSS33 gene methylation and expression levels, characterized by comprising the following steps: S1: Provide a sample to be tested, and extract genomic DNA and / or total RNA from the sample; S2: Detect the methylation level of the PRSS33 gene promoter region and / or the transcriptional expression level of the PRSS33 gene.

[0010] Preferably, the sample to be tested is derived from mononuclear cells in bone marrow or peripheral blood.

[0011] Preferably, the method for detecting the methylation level of the PRSS33 gene promoter region is selected from one of the following: bisulfite sequencing, methylation-specific PCR, high-resolution melting curve analysis, or pyrosequencing.

[0012] Preferably, the method for detecting the methylation level of the PRSS33 gene promoter region is a bisulfite conversion-binding sequencing method, including: The genomic DNA obtained from S1 was subjected to bisulfite conversion treatment; PCR amplification of transformed DNA was performed using primer pairs targeting the methylation region of the PRSS33 gene promoter. The amplified products were sequenced using sequencing primers to analyze the methylation status of CpG sites.

[0013] As a preferred embodiment, the method for detecting PRSS33 gene methylation and expression levels is characterized in that the primer pair targeting the methylation region of the PRSS33 gene promoter includes an upstream primer PRSS33-F, the sequence of which is shown in SEQ ID NO:1; and a downstream primer PRSS33-R, the sequence of which is shown in SEQ ID NO:2.

[0014] Preferably, the PRSS33-S is a primer used for sequencing, and its sequence is shown in SEQ ID NO:3.

[0015] Preferably, the method for detecting the mRNA expression level of the PRSS33 gene is selected from one of real-time quantitative PCR, digital PCR, Northern blot, or RNA in situ hybridization, wherein the real-time quantitative PCR method includes: Genomic DNA was removed from the total RNA extracted from the sample in S1 to obtain processed RNA; The processed RNA was used as a template for reverse transcription to synthesize cDNA. The synthesized cDNA was used as a template for real-time quantitative PCR amplification to detect the mRNA expression level of the PRSS33 gene.

[0016] Preferably, the primer pair sequences for detecting PRSS33 mRNA expression levels are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0017] Secondly, the present invention provides a kit, characterized in that the kit contains primer pairs for targeting the methylation region of the PRSS33 gene promoter and / or primer pairs for detecting the expression level of PRSS33 mRNA.

[0018] Thirdly, the present invention provides the application of the aforementioned kit in detecting the methylation and expression levels of the PRSS33 gene.

[0019] In summary, the present invention has at least one of the following beneficial technical effects: 1. This invention reveals and verifies for the first time the correlation between hypermethylation of the PRSS33 gene promoter and its downregulation and MDS, providing objective and quantifiable molecular evidence for molecular detection, index quantification and data modeling of MDS-related in vitro samples, reducing the subjectivity and experience-dependent bias of traditional morphological interpretation.

[0020] 2. This invention achieves stable and sensitive detection of PRSS33 methylation and expression levels by using an optimized bisulfite sequencing and real-time quantitative PCR method, combined with a validated specific primer and internal control system. This facilitates standardized operation and result comparison in laboratory and clinical testing scenarios.

[0021] 3. This invention expands a new path for molecular characterization and sample stratification of MDS. This method can achieve molecular typing and quantitative assessment of PRSS33 expression and methylation status, providing molecular-level indicators for dynamic monitoring and data analysis of in vitro samples, and is conducive to building a standardized molecular detection and risk stratification system.

[0022] 4. This invention provides a research foundation for the screening and molecular evaluation of PRSS33-targeting drugs. Based on the expression silencing characteristics of PRSS33 in MDS-related in vitro samples, a sample population with low PRSS33 expression can be identified as research subjects for the development and efficacy evaluation of PRSS33 activator-related drugs. Simultaneously, the dynamic changes in PRSS33 expression levels in the samples can serve as an early molecular indicator for drug response evaluation, providing data support for optimizing drug screening protocols and adjusting research models. Attached Figure Description

[0023] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0024] Figure 1 The figure shows the comparison calculation results of the relative expression levels of PRSS33 mRNA in the samples provided in the embodiments of this application; Figure 2 This paper illustrates the dynamic changes in PRSS33 mRNA expression levels before and after demethylation treatment in MDS patients, as provided in an embodiment of this application. Figure 3 The figure shows the comparison results of the methylation level of the PRSS33 gene promoter between the control group and the MDS group provided in the embodiments of this application. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit this application or its application or use. Based on the embodiments in this application, any product identical or similar to this application, derived by anyone under the guidance of this application or by combining features of this application with other prior art, falls within the protection scope of this invention. Furthermore, all other embodiments obtained by those skilled in the art without inventive effort are within the protection scope of this invention.

[0026] The “reference value” mentioned in this application refers to the normal reference range established by detecting the methylation level of the PRSS33 gene promoter or the mRNA expression level in in vitro samples from healthy individuals.

[0027] The specific steps for creating this are as follows: Collect ex vivo bone marrow or peripheral blood samples from at least 50 age-matched healthy volunteers; The methylation level of the PRSS33 promoter (expressed as the percentage of methylated CpG sites) and the relative expression level of PRSS33 mRNA (expressed as 2^-ΔΔCt) in each sample were detected using the methods described in Examples 1 and 2 of this invention. Calculate the mean of the test results for all healthy samples ( ) and standard deviation (s), in This is considered as a 95% normal reference range; For a sample to be tested, if its methylation level is higher than the upper limit of the normal reference value, and / or its expression level is lower than the lower limit of the normal reference value, it can be judged as an abnormal molecular indicator, indicating that the sample has MDS-related molecular characteristics.

[0028] In practical applications, the optimal molecular detection cutoff value can also be determined by ROC curve analysis based on the specific detection method and laboratory conditions.

[0029] Specific experimental steps or conditions are not specified in the embodiments; they can be performed according to the conventional experimental steps or conditions described in the prior art. Reagents and other instruments used, unless otherwise specified, are all commercially available conventional reagent products. Furthermore, the accompanying drawings are merely illustrative diagrams of the embodiments of the present invention and are not necessarily drawn to scale. The same reference numerals in the drawings denote the same or similar parts, and therefore, repeated descriptions of them will be omitted. Some block diagrams shown in the drawings are functional entities and do not necessarily correspond to physically or logically independent entities.

[0030] Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of this specification.

[0031] In the description of this invention, it should be understood that the use of terms such as "first" and "second" to define components is merely for the purpose of distinguishing the corresponding components. Unless otherwise stated, the above terms have no special meaning and therefore should not be construed as limiting the scope of protection of this invention.

[0032] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0033] To enable those skilled in the art to more clearly understand the present invention, the following examples will provide a detailed description of the method and kit for detecting PRSS33 gene methylation and expression levels provided by the present invention.

[0034] Example Example 1: Detection of PRSS33 gene promoter methylation level in bone marrow samples Collect 2–3 mL of bone marrow fluid from suspected MDS patients and healthy controls, place it in EDTA anticoagulant tubes, and process it within 24 hours. If the sample is viscous, dilute it 1:1 with pre-cooled phosphate-buffered saline (PBS).

[0035] Bone marrow mononuclear cells (BMMCs) were isolated using Ficoll density gradient centrifugation. The simplified steps are as follows: Diluted bone marrow suspension was slowly added to the supernatant of the lymphocyte separation medium, and centrifuged at 2000 rpm for 20 minutes at room temperature. The white, cloudy cell ring at the interface between the plasma layer and the separation medium was collected and washed twice with PBS (1000 rpm, 5 minutes) to remove any residual separation medium. If red blood cells remained in the cell pellet, an equal volume of red blood cell lysis buffer was added and lysed at 4°C for 5 minutes, followed by washing with PBS to terminate the reaction. The resulting BMMC pellet can be used directly for nucleic acid extraction or cryopreservation.

[0036] Genomic DNA was extracted from BMMC precipitates using the DNeasy Blood & Tissue Kit. The simplified procedure included: lysing cells with proteinase K and Buffer AL, followed by incubation at 56°C for 10 minutes; transferring the mixture to a purification column after adding anhydrous ethanol, and washing sequentially with Buffer AW1 and Buffer AW2; finally, eluting the DNA with Buffer AE. The obtained DNA was stored at -20°C or -80°C.

[0037] Using EZ DNA Methylation-Gold TM The kit treats approximately 500 ng of genomic DNA with bisulfite. The reaction system contains CT Conversion Reagent, and the PCR program is as follows: 98°C for 10 minutes, 64°C for 2.5 hours, and incubation at 4°C. The transformed product is purified by Zymo-Spin IC column purification and eluted with M-Elution Buffer to obtain transformed DNA, which is then stored at -20°C.

[0038] BSP primers were designed targeting the promoter region of the PRSS33 gene. The primer sequences are as follows: PRSS33-F: 5'-TTGTTTTTGGTTAAGTAAGGAGTGTT-3' (SEQ ID NO: 1) PRSS33-R:5'-ACCCAAAAACCCCAACAT-3'(SEQ ID NO:2) The amplified fragment is approximately 112 bp in length.

[0039] PCR amplification was performed using the transformed DNA as a template. The reaction mixture (50 μL) contained: 10 μL of 5× GC Buffer, 1 μL of dNTPs (10 mM each), 1 μL each of upstream and downstream primers (50 pM / μL), 2 μL of template DNA, 0.2 μL of Taq DNA polymerase (5 U / μL), and water to a final volume of 50 μL. The PCR cycling conditions were optimized based on the primer annealing temperature.

[0040] PRSS33-S primers were used for sequencing, directly sequencing the PCR products. The sequencing results were compared with the reference sequence of the untransformed PRSS33 gene promoter, and the base status of each CpG site was analyzed: if it was C, it was determined that the site was methylated; if it was T, it was determined that it was unmethylated. The methylation level of the PRSS33 promoter in this sample was calculated by statistically analyzing the percentage of methylated CpG sites in the target region relative to the total number of CpG sites.

[0041] PRSS33-S is the primer used for sequencing. The primer sequences are as follows: PRSS33-S:5'-ATTAGTTTTTTTTTTATTTTTAGTTG-3'(SEQ ID NO:3) Example 2: Detection of relative expression level of PRSS33 gene mRNA in bone marrow samples The BMMCs precipitate obtained in Example 1 was used to extract total RNA under RNase-free conditions. The extracted RNA was quantified and its purity analyzed using a spectrophotometer. RNA samples with an A260 / A280 ratio between 1.8 and 2.1 were selected for subsequent experiments. RNA samples can be stored short-term at 4°C or long-term at -80°C.

[0042] Subsequent operations were performed using the MCE reverse transcription kit. First, 500 ng of total RNA was taken and 3 μL of 5× DNAdigester Buffer was added, with the volume brought to 15 μL with RNase-free water to create a genomic DNA removal reaction system. The reaction system was placed in a PCR instrument and incubated at 42°C for 2 minutes to digest residual genomic DNA. Subsequently, 5 μL of 4× Super RT Mix was added directly to the above reaction system to bring the total volume to 20 μL, and reverse transcription was performed. The reaction program was set as follows: incubation at 25°C for 5 minutes, 55°C for 15 minutes, 85°C for 2 minutes, and finally stored at 4°C. The reaction product is cDNA, which can be used directly for subsequent quantitative PCR or stored at -20°C.

[0043] Real-time quantitative PCR was performed using MCE SYBR Green qPCR Master Mix to detect the mRNA expression level of the PRSS33 gene. The reaction mixture was prepared as follows (total volume 10 μL): SYBR Green Master Mix:5 μL; PRSS33 gene-specific upstream primer (10 μM): 0.5 μL; PRSS33 gene-specific downstream primer (10 μM): 0.5 μL; Synthesized cDNA template: 1 μL; Nuclease-free water: 3 μL; The primer sequences used for amplifying the PRSS33 gene are: upstream primer (SEQ ID NO:4, AGAGTGGCGACCGGTACAAG) and downstream primer (SEQ ID NO:5, CTGTTGCTGTAGCCAAATTCGT). Simultaneously, the GAPDH gene is used as an internal control, and its amplification primer sequences are: upstream primer CACTCCTCCACCTTTGACGC and downstream primer GACTCCCAGGCAGCACAATG.

[0044] After gently mixing the reaction mixture and briefly centrifuging, the product was placed in a real-time quantitative PCR instrument for amplification. The reaction program was as follows: 95℃ pre-denaturation for 30 seconds; followed by 40 cycles of 95℃ denaturation for 5 seconds and 60℃ annealing / extension for 30 seconds (this temperature can be optimized according to primer characteristics); after the cycles, melting curve analysis was performed to confirm the specificity of the amplified product.

[0045] The relative expression level of PRSS33 gene mRNA was calculated using the 2^-ΔΔCt method. First, the Ct value of the PRSS33 gene was normalized (ΔCt) to the Ct value of the internal reference gene GAPDH in the same reaction plate. Then, the ΔCt value of the test sample was compared with the average ΔCt value of a specified control group sample (e.g., a healthy donor), and the ΔΔCt value was calculated. Finally, the relative expression level of the PRSS33 gene was expressed as 2^-ΔΔCt. By comparing the relative expression levels of PRSS33 in MDS patients and healthy controls, the expression changes of PRSS33 in MDS were analyzed.

[0046] Example 3: Verification of PRSS33 expression and methylation status in MDS and monitoring of treatment response This embodiment uses the methods described in Embodiments 1 and 2 to test clinical samples to verify the characteristics of PRSS33 as an MDS-related biomarker.

[0047] Bone marrow samples were collected from healthy volunteers (control group), newly diagnosed MDS patients (MDS group), and patients with acute myeloid leukemia (AML). A separate group of paired samples were collected from MDS patients before and after receiving azacitidine or decitabine demethylation therapy.

[0048] The relative expression levels of PRSS33 mRNA in bone marrow monocytes (BMMCs) of each group were detected using the real-time quantitative PCR method described in Example 2 (calculated using the 2^-ΔΔCt method with GAPDH as the internal reference gene). The results showed that, compared with the control group, the expression levels of PRSS33 mRNA in both the MDS group and the AML group were significantly reduced (e.g., ...). Figure 1 (As shown). Furthermore, analysis of paired samples from MDS patients before and after treatment showed that PRSS33 mRNA expression levels were significantly upregulated after demethylation therapy compared to before treatment (e.g., Figure 2 (As shown).

[0049] The methylation level (expressed as the percentage of methylated CpG sites) of the PRSS33 gene promoter core region in BMMCs of the control and MDS groups was detected using the bisulfite sequencing method described in Example 1. The results showed that the methylation level of the PRSS33 promoter in the MDS group was significantly higher than that in the control group (e.g., ...). Figure 3 (As shown).

[0050] This embodiment comprehensively applies the aforementioned detection methods to confirm, from both mRNA expression and DNA methylation levels, that PRSS33 exhibits a characteristic "downregulated expression-promoter hypermethylation" state in MDS patients, and that this expression silencing can be partially reversed by demethylating drugs. These results validate the feasibility of PRSS33 as a molecular marker for the auxiliary diagnosis, prognostic assessment, and efficacy monitoring of MDS.

[0051] Example 4: Association analysis of PRSS33 expression level with clinical characteristics and prognostic stratification of MDS patients This embodiment aims to analyze the association between PRSS33 gene expression level and clinicopathological features of MDS patients and risk stratification of the International Prognostic Scoring System (IPSS-R), and to evaluate its potential for prognostic assessment.

[0052] Bone marrow samples from 129 newly diagnosed MDS patients were included. The relative expression level of PRSS33 mRNA in bone marrow mononuclear cells was detected using the real-time quantitative PCR method described in Example 2. Patients were divided into a low expression group (PRSS33 < 0.715) and a high expression group (PRSS33 ≥ 0.715) using the median PRSS33 expression level of all patients (0.715) as the cutoff value.

[0053] Baseline clinical data of patients were collected, including demographic characteristics (sex, age), peripheral blood cell counts (white blood cells, hemoglobin, platelets, neutrophils, eosinophils), proportion of bone marrow blasts, WHO classification, cytogenetic karyotype risk grouping, and IPSS-R risk stratification.

[0054] Categorical variables are expressed as case counts, and comparisons between groups were performed using the chi-square test or Fisher's exact test. Continuous variables are expressed as medians (ranges), and comparisons between groups were performed using the Mann-Whitney U test. All statistical analyses were two-tailed tests, and a p-value < 0.05 was considered statistically significant. The results are shown in Table 1.

[0055] Table 1. Baseline clinical characteristics of patients in different groups with different PRSS33 expression levels

[0056] There were no statistically significant differences between the low expression group and the high expression group in terms of gender, age, white blood cell count, platelet count, neutrophil count, and proportion of bone marrow blast cells (P>0.05), indicating that the two groups had similar basic characteristics and were comparable.

[0057] Compared with the low expression group, patients in the high expression group had significantly higher hemoglobin levels (P=0.046) and significantly higher eosinophil counts (P=0.003).

[0058] There were no significant differences in the distribution of WHO classification and cytogenetic karyotype risk groups between the two groups (P > 0.05). However, there were significant differences in the distribution of IPSS-R risk stratification between the two groups (P = 0.002): the proportion of very low / low risk patients was higher in the high expression group, while the proportion of very high risk patients was higher in the low expression group.

[0059] The above results confirm that the expression level of PRSS33 is significantly correlated with the IPSS-R risk stratification of MDS patients, and can be used as an objective quantitative indicator for MDS prognostic assessment and risk stratification, and has potential application value for MDS prognostic agents / kits.

[0060] Low PRSS33 expression was significantly associated with lower hemoglobin levels, lower eosinophil counts, and higher IPSS-R risk scores. This suggests that PRSS33 expression levels can serve as a useful indicator of MDS risk and are suitable for assisting in patient prognostic assessment and risk stratification.

[0061] Example 5: Regression analysis of MDS prognostic factors based on PRSS33 expression levels This embodiment uses regression analysis to screen clinical indicators that are independently associated with MDS study outcomes defined based on PRSS33 expression levels, in order to establish a more stable risk stratification and prognostic assessment model.

[0062] Complete clinical data of 129 MDS patients in Implementation 4 were collected, including demographic information, laboratory indicators and molecular genetic information. The expression level of PRSS33 was used as the dependent variable for grouping. The results are shown in Table 2.

[0063] Table 2. Regression analysis of clinical indicators grouped by PRSS33 expression level

[0064] First, a univariate logistic regression analysis was performed to screen for latent variables that were statistically associated with the grouping outcomes (P<0.05). Then, the significant variables from the univariate analysis were incorporated into a multivariate logistic regression model for correction analysis. The odds ratio (OR) and its 95% confidence interval for each variable were calculated, with P<0.05 used as the threshold for statistically independent association.

[0065] Univariate logistic regression analysis showed that platelet count, eosinophil count, bone marrow blast cell ratio, and chromosome karyotype were significantly correlated with PRSS33 expression level group outcomes (P<0.05). No significant associations were found between sex, age, white blood cell count, hemoglobin level, neutrophil count, and WHO classification (P>0.05).

[0066] After further multivariate logistic regression correction, platelet count (P<0.001), eosinophil count (P<0.001), and bone marrow blast cell ratio (P=0.027) remained statistically significant, indicating that they are clinical indicators independently associated with PRSS33 expression level groups. Chromosomal karyotype no longer showed a significant association after multivariate correction (P=0.701).

[0067] This embodiment confirms through regression analysis that platelet count, eosinophil count, and bone marrow blast cell ratio are clinical indicators independently associated with MDS patient grouping outcomes based on PRSS33 expression levels. When using PRSS33 testing for MDS risk stratification, prognostic assessment, or auxiliary diagnosis, these indicators can be used in conjunction to improve the stability, comprehensiveness, and clinical applicability of the interpretation.

[0068] In summary, this invention established a standard method for detecting the methylation level of the PRSS33 gene promoter and its mRNA expression level through Examples 1 and 2; Example 3 verified in multi-level clinical samples that PRSS33 exhibits a characteristic silencing state of low expression and high methylation in MDS, and that its expression can be reversed by demethylation therapy; Example 4 further demonstrated that low PRSS33 expression is significantly associated with adverse clinical indicators and higher IPSS-R risk stratification; Example 5, through regression analysis, clarified that platelet count, eosinophil count, and bone marrow blast cell ratio are clinical parameters independently associated with PRSS33 expression levels. These examples comprehensively construct a system from molecular detection to clinical interpretation, confirming that PRSS33 can serve as a novel molecular marker for the auxiliary diagnosis, risk stratification, and efficacy monitoring of MDS.

[0069] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0070] Although preferred embodiments of the present invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the embodiments of the present invention.

[0071] Finally, it should be noted that in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or terminal device that includes said element.

[0072] The present invention provides a detailed description of a method and kit for detecting PRSS33 gene methylation and expression levels. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of this application. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.

Claims

1. A method for detecting PRSS33 gene methylation and expression levels, characterized in that, Includes the following steps: S1: Provide a sample to be tested, and extract genomic DNA and / or total RNA from the sample; S2: Detect the methylation level of the PRSS33 gene promoter region and / or the transcriptional expression level of the PRSS33 gene.

2. The method for detecting PRSS33 gene methylation and expression levels according to claim 1, characterized in that, The test sample is derived from mononuclear cells in bone marrow or peripheral blood.

3. The method for detecting PRSS33 gene methylation and expression levels according to claim 1, characterized in that, The method for detecting the methylation level of the PRSS33 gene promoter region is selected from one of the following: bisulfite sequencing, methylation-specific PCR, high-resolution melting curve analysis, or pyrosequencing.

4. The method for detecting PRSS33 gene methylation and expression levels according to claim 3, characterized in that, The method for detecting the methylation level of the PRSS33 gene promoter region is a bisulfite conversion-binding sequencing method, including: The genomic DNA obtained from S1 was subjected to bisulfite conversion treatment; PCR amplification of transformed DNA was performed using primer pairs targeting the methylation region of the PRSS33 gene promoter. The amplified products were sequenced using sequencing primers to analyze the methylation status of CpG sites.

5. The method for detecting PRSS33 gene methylation and expression levels according to claim 4, characterized in that, The primer pair targeting the methylation region of the PRSS33 gene promoter includes the upstream primer PRSS33-F, the sequence of which is shown in SEQ ID NO:1; and the downstream primer PRSS33-R, the sequence of which is shown in SEQ ID NO:

2.

6. The method for detecting PRSS33 gene methylation and expression levels according to claim 3, characterized in that, The PRSS33-S is the primer used for sequencing, and its sequence is shown in SEQ ID NO:

3.

7. The method for detecting PRSS33 gene methylation and expression levels according to claim 1, characterized in that, The method for detecting the mRNA expression level of the PRSS33 gene is selected from one of real-time quantitative PCR, digital PCR, Northern blot, or RNA in situ hybridization, wherein the real-time quantitative PCR method includes: Genomic DNA was removed from the total RNA extracted from the sample in S1 to obtain processed RNA; The processed RNA was used as a template for reverse transcription to synthesize cDNA. The synthesized cDNA was used as a template for real-time quantitative PCR amplification to detect the mRNA expression level of the PRSS33 gene.

8. The method for detecting PRSS33 gene methylation and expression levels according to claim 7, characterized in that, The primer pair sequences used to detect PRSS33 mRNA expression levels are shown in SEQ ID NO:4 and SEQ ID NO:

5.

9. A reagent kit, characterized in that, The kit contains primer pairs for targeting the methylation region of the PRSS33 gene promoter and / or primer pairs for detecting PRSS33 mRNA expression levels.

10. The application of the kit described in claim 9 in detecting methylation and expression levels of the PRSS33 gene.

Images