Two SNP (Single Nucleotide Polymorphism) molecular markers related to oil content of common camellia oleifera seed kernel and application of two SNP molecular markers

Abstract

The invention relates to the technical field of molecular markers, in particular to two SNP molecular markers related to the oil content of common camellia oleifera kernels and application of the two SNP molecular markers. The invention develops two SNP molecular markers highly associated with the oil content of common camellia oleifera kernels, and the phenotypic variances of the oil content of 2.75% and 2.20% can be respectively explained. The SNP molecular marker is clear in position, the detection method is convenient and rapid, identification and auxiliary screening can be carried out in the seedling stage, the production and breeding cost is greatly saved, the selection efficiency is improved, the SNP molecular marker is not influenced by the environment, the purposiveness is higher, the workload is small, and the identification accuracy is higher when two SNP molecular markers are jointly used. The method can accelerate the breeding process of common camellia oleifera with high kernel oil content, and has important significance on molecular marker-assisted breeding and genetic improvement of the oil yield of common camellia oleifera.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to two SNP molecular markers related to the oil content of common camellia seed kernels and their applications. Background Technology

[0002] Common tea oil ( Camellia oleifera Abel., belonging to the genus Camellia in the family Theaceae. Camellia Camellia seed oil (L.) is one of the world's four major woody oilseeds. Rich in nutrients, camellia seed oil is a high-quality edible oil with over 90% unsaturated fatty acids, primarily oleic and linoleic acids. It is also rich in vitamin E, squalene, sterols, and other nutrients, giving it high nutritional and health value.

[0003] In recent years, significant progress has been made in the genetic breeding of Camellia oleifera, with the completion of multiple Camellia oleifera genome sequencing and mapping projects, and substantial advancements in the analysis of seed oil synthesis and accumulation mechanisms. Building upon this foundation, identifying and screening molecular markers for early selection of high-oil-content germplasm, and constructing corresponding detection systems, are effective ways to accelerate the breeding process of superior high-oil-content Camellia oleifera varieties.

[0004] Compared to traditional breeding techniques, marker-assisted breeding can begin selection at the seedling stage, significantly shortening the breeding cycle. Its advantages are particularly pronounced in economic forest breeding where fruit production is the primary objective. Effective molecular markers are indispensable for marker-assisted breeding.

[0005] Therefore, developing molecular markers related to the oil content of common camellia seeds has become a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention develops molecular markers related to the oil content of common camellia seeds and their applications.

[0007] Since *Camellia oleifera* is a typical outcrossing species, linkage disequilibrium (LD) typically diminishes rapidly over a small area, making LD mapping of important traits feasible. All transcripts of *Camellia oleifera* kernels were used as regions for marker development in this invention. Given a natural population of *Camellia oleifera* that exhibits significant genetic variation, the development of SNP molecular markers significantly correlated with variations in the oil content of *Camellia oleifera* kernels can be effectively conducted.

[0008] The development process of the SNP molecular markers of this invention is basically as follows: (1) Collect camellia germplasm resources extensively in the entire distribution area of ​​common camellia and establish a natural population of common camellia with widely separated kernel oil content.

[0009] (2) Fully mature seeds of 221 common camellia oleifera germplasms from natural populations were collected, and the oil content of the kernels was determined by Soxhlet extraction.

[0010] (3) Kernels from 221 common camellia oleifera plants in a natural population during the high-speed oil synthesis period were collected. Total RNA was extracted using the RNAprepPure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (centrifuge column type, TIANGEN kit code no. DP441). A cDNA library was constructed for each sample and analyzed using Illumina HiSeq. TM Second-generation transcriptome sequencing was performed on the 4000 platform.

[0011] (4) Using the genome of common Camellia oleifera 'Changlin 40' (Zhu, H., Wang, F., Xu, Z., Wang, G., Hu, L., Cheng, J., Ge, X., Liu, J., Chen, W., Li, Q., Xue, F., Liu, F., Li, W., Wu, L., Cheng, X., Tang, X., Yang, C., Lindsey, K., Zhang, X., Ding, F., Hu, H., Hu, X. and Jin, S. (2024) The complex hexaploid oil-Camellia genometraces back its phylogenomic history and multi-omics analysis of Camellia oilbiosynthesis. Plant Biotechnol. J., https: / / doi.org / 10.1111 / pbi.14412.) as the reference sequence, the SNP sites of the transcriptome sequences of 221 samples obtained in (3) were analyzed by multiple sequence alignment.

[0012] (5) SNP data were strictly filtered according to the following principles: each locus had only 2 alleles; genotype deletion rate ≤20%; minimum allele frequency ≥5%; SNP quality value ≥100; number of homozygous genotype samples exceeded 10; heterozygous genotype rate ≤70%. The software bcftools v1.9 (http: / / www.htslib.org / doc / bcftools.html) used in the process is publicly available and free.

[0013] (6) Input the genotype data of the population into GCTA v1.25.2 (Jian Y, S Hong L, Goddard ME, Visscher PM, 2011. GCTA: a tool for genome-wide complex trait analysis. American Journal of Human Genetics 88, 76-82.) software to perform principal component analysis (PCA).

[0014] (7) Input the genotype data of the population, the data of the first 10 principal components (PC), the phenotypic data of the oil content of the kernel, and the Kinship matrix data into the IIIVmrMLM software, and use the unified mixed linear model (MLM) method to analyze the linkage disequilibrium of SNP molecular markers and the oil content trait of common camellia kernel.

[0015] Using the above method, this invention ultimately obtained a result that was highly significantly correlated with the oil content of ordinary camellia seed kernels ( P <10 -5 The two SNP molecular markers of ) are shown in Table 1, namely SNP1 molecular marker or SNP2 molecular marker; The SNP1 molecular marker is located at position 99,591,676 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A; the SNP2 molecular marker is located at position 126,149,650 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A. Their contributions to phenotypic variation are 2.75% and 2.20%, respectively.

[0016] Table 1 SNP molecular marker information

[0017] Based on this, the present invention proposes the following technical solution.

[0018] First, the present invention provides SNP molecular markers related to the oil content of common camellia seed kernels, wherein the SNP molecular markers are selected from either SNP1 or SNP2 molecular markers; The SNP1 molecular marker is located at position 99591676 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A; the SNP2 molecular marker is located at position 126149650 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A; the version number of the Camellia oleifera genome is Changlin 40 V1.0.

[0019] In the specific implementation process, among the SNP1 or SNP2 molecular markers, the genotype G / G corresponds to high oil content; the genotype G / A corresponds to candidate high oil content; and the genotype A / A corresponds to low oil content.

[0020] Preferably, the SNP1 molecular marker is located at position 118 of the nucleotide sequence shown in SEQ ID NO.5, and the base polymorphism is G / A.

[0021] Preferably, the SNP2 molecular marker is located at position 130 of the nucleotide sequence shown in SEQ ID NO.6, and the base polymorphism is G / A.

[0022] SEQ ID NO.5: TTTTGGAATGTGGCAGGTATATTATGGAGCTGATCTGGAAACTGGAGCATTTGCTAGTGGGTTCCCCAAGGCATTGTCTTTCTCTATCCAAAAATGAATCAAATCAGTATATGGTTTCGGGTTGGAAT TTGAATAACTTTCCACGCTTGCCTGGTTCTGTACTATGTTTTGAAGAATGCGATATCTCAGGAGTTCTAGTGCCATGGCTCTATGTGGGGATGTGCTTTTCATCATTTTGCTGGGTAAGTACTACTA SEQ ID NO.6: TACATACAACATTTTCCAAAAAAATATTTTCTACCAAACAAACGGAGGGCAAAAATGCAATCCTTGATTTCATACACAAATGGTGTTTGAACTACATTATTTTTTCTAGAAAAGGGCATTGAAAAAGCTATTTAGATGAGCATATAGTGT ATTTAGCTTTTTAACTTTGTTTTGTGGTTCTGTGATGTGGGTTGTTTTTAACTTTTGGGGGTTAACAACTGGAGAGGAGTTTGTCGTGTTCAGCAGATTGAGCAGAAATGGAGACAAGGGAAAATTGAAGCAGAAAGTGAAGAAGAGGA Furthermore, the present invention provides a combination of SNP molecular markers related to the oil content of common camellia seed kernels, wherein the combination of SNP molecular markers includes SNP1 molecular markers and SNP2 molecular markers.

[0023] In specific implementation, the SNP molecular marker combination may also include other SNP molecular markers related to the oil content of common camellia seed kernels.

[0024] Furthermore, the present invention provides primers for amplifying the SNP molecular markers or combinations of the SNP molecular markers.

[0025] Preferably, the primers include those shown in SEQ ID NO.1-2 and / or SEQ ID NO.3-4.

[0026] SEQ ID NO.1: TGGAATGTGGCAGGTATATTATG SEQ ID NO.2: AGTAGTACTTACCCAGCAAAATG SEQ ID NO.3: TACATACAACATTTTCCAAA SEQ ID NO.4: TCCTCTTCTTCACTTTCTGCTT The two SNP molecular markers related to the oil content of common Camellia oleifera kernels of the present invention can be obtained by PCR amplification using the genomic DNA of common Camellia oleifera as a template, respectively, using primer pairs with nucleotide sequences as shown in SEQ ID NO.1-2 and SEQ ID NO.3-4.

[0027] Furthermore, the present invention provides a kit for identifying the oil content of common camellia seed kernels, which contains the aforementioned primers.

[0028] Furthermore, the present invention provides the application of the SNP molecular marker, or the combination of SNP molecular markers, or the primers, or the kit in at least one of the following aspects: (1) Identification of the oil content phenotype of common camellia seeds; (2) Identification, improvement or molecular marker-assisted breeding of common camellia oleifera germplasm resources; (3) Early prediction of oil content in common camellia seeds; (4) Screening common camellia with high oil content.

[0029] In some implementation schemes, the target trait for the identification, improvement, or molecular marker-assisted breeding of the common camellia oleifera germplasm resource is the oil content of the common camellia oleifera kernel.

[0030] Furthermore, this invention provides a method for identifying the oil content of common camellia seed kernels, comprising: Using the genomic DNA of the common camellia oleifera seed as a template, PCR amplification was performed using primers that amplified the SNP molecular markers or combinations of the SNP molecular markers. The genotype of the common camellia oleifera seed kernel oil content phenotype was identified based on the genotype of the SNP molecular marker loci.

[0031] Each SNP molecular marker can be used alone or in combination to identify the oil content phenotype of common Camellia oleifera kernels. The accuracy of identification is higher when two SNP molecular markers are used in combination.

[0032] Preferably, the identification method includes: (1) Extract genomic DNA from the common camellia oleifera to be identified; (2) Using the genomic DNA as a template, perform PCR amplification using the primers; (3) Analyze the genotype of the SNP molecular markers in the PCR amplification products, and determine the phenotype of the oil content of the kernel of the common camellia to be identified based on the genotype.

[0033] Preferably, the reaction program for the PCR amplification reaction is as follows: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

[0034] More preferably, the PCR amplification reaction program is as follows: 95°C, 3 min, 1 cycle of pre-denaturation; 95°C, 15 s of denaturation, 68°C, 45 s of extension, 40 cycles; 68°C, 5 min, 1 cycle of complete extension.

[0035] Preferably, when using SNP1 or SNP2 molecular markers alone for identification: if the genotype of any SNP locus is G / G, then the Camellia oleifera individual is a high-oil-content Camellia oleifera; if the genotype of any SNP locus is G / A, then the Camellia oleifera individual is a candidate for high-oil-content Camellia oleifera; if the genotype of any SNP locus is A / A, then the Camellia oleifera individual is a low-oil-content Camellia oleifera. When using SNP1 and SNP2 molecular markers for identification: if one of the two SNP molecular markers is G / G and the other is G / A heterozygous, or if both SNP molecular markers are G / A heterozygous, then the Camellia oleifera individual is a candidate for high oil content Camellia oleifera; if both SNP molecular markers are A / A, then the Camellia oleifera individual is a low oil content Camellia oleifera.

[0036] In some implementations, the Camellia oleifera to be identified can be any Camellia oleifera breeding material, including individuals from natural populations or sexual populations.

[0037] The oil content described in this invention is the oil content of the kernel.

[0038] Preferably, the genomic DNA of common Camellia oleifera is extracted using the TaKaRa MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, Dalian, China).

[0039] In some implementations, after the PCR amplification, the obtained PCR product is detected and recovered by agarose gel electrophoresis.

[0040] In some embodiments, the concentration of agarose gel in the agarose gel electrophoresis is 1.2%. Gel recovery is performed using the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50).

[0041] In some implementations, the genotype of the SNP molecular marker can be analyzed using conventional techniques in the art, such as sequencing, for example, using SEQ ID NO.1-2 and SEQ ID NO.3-4 as sequencing primers.

[0042] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention developed two SNP molecular markers highly correlated with the oil content of common Camellia oleifera kernels, which can explain 2.75% and 2.20% of the phenotypic variance of oil content, respectively. In conventional selection breeding of common Camellia oleifera, the identification of the kernel oil content trait requires 5-6 years of seedling planting, which is time-consuming and labor-intensive. In contrast, the SNP molecular markers of this invention have clearly defined locations, and the detection method is convenient and rapid. Identification and assisted screening can be carried out at the seedling stage, greatly saving production and breeding costs, improving selection efficiency, and being unaffected by environmental factors. This method is more targeted, requires less work, and can accelerate the breeding process of common Camellia oleifera with high kernel oil content. It is of great significance for molecular marker-assisted breeding and genetic improvement of oil yield in common Camellia oleifera. Detailed Implementation

[0043] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0044] Unless otherwise specified, all techniques or conditions used in this invention are conventional methods or performed according to techniques or conditions described in the literature in this field, or according to product instructions. Reagents and instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0045] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art complete the corresponding experiments under the guidance of the operating manuals accompanying various commercial reagent kits or entrust them to specialized companies, such as primer synthesis and gene sequencing.

[0046] The 221 natural population materials used in this invention, all of which were collected and evaluated by the Woody Oilseed Breeding and Cultivation Research Group of the Subtropical Forestry Research Institute of the Chinese Academy of Forestry, and are preserved in the germplasm resource nursery of Dongfanghong Forest Farm in Wucheng District, Jinhua, Zhejiang Province.

[0047] Example 1: Construction and trait determination of an isolated population of oil content from common Camellia oleifera seed kernels In this embodiment, 221 natural populations of common Camellia oleifera germplasm resources were collected from a nursery. Their origins covered most of my country's main Camellia oleifera producing areas, including Zhejiang, Hunan, Jiangxi, Guangxi Zhuang Autonomous Region, Fujian, and Guangdong provinces. After the fruits of all 221 individuals were fully mature (5% of the fruits split open), seeds were collected, and the oil content of the kernels was determined using Soxhlet extraction. The operational steps are as follows: (1) Prepare medium-speed filter paper packs and place them in an aluminum box. Dry them at 105°C until constant weight is achieved. Record the weight of the aluminum box and the filter paper packs. W 1 ).

[0048] (2) Remove the hard seed coat from an appropriate amount of common camellia seeds, dry them at 105℃ to constant weight, crush them with a pulverizer, pack them into a filter paper bag and wrap them up, and record the total weight of the aluminum box, filter paper bag and sample. W 2 ).

[0049] (3) Using a Swiss Buchi Soxhlet extractor B-811LSV, the weighed sample filter paper package was placed in an extraction flask, and about 100 ml of petroleum ether was added. Extraction was carried out for 6 hours, and the petroleum ether was recovered. The filter paper package (containing residue) was placed in an aluminum box and dried at 105°C until constant weight was achieved. The weights of the aluminum box, filter paper package, and residue were recorded. W 3 ).

[0050] Kernel oil content = [( W 2 - W 3 ) / ( W 2 - W 1)]×100% The results of the oil content determination of common camellia seeds showed that the oil content of natural population seeds exhibited a normal distribution, indicating that this trait has quantitative characteristics.

[0051] Example 2: Transcriptome sequencing and polymorphic site identification of seed kernels during the rapid lipid synthesis period 1. Total RNA extraction from the kernels of 221 common Camellia oleifera clones during the high-speed oil synthesis period: Total RNA was extracted from immature kernels of various common Camellia oleifera clones using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (centrifugal column type, TIANGEN Kit Code No. DP441).

[0052] 2. Transcriptome sequencing: Total RNA from each sample was tested for purity and concentration, and ribosomal RNA was removed to maximize the retention of all coding RNA and ncRNA. The resulting RNA was randomly fragmented into short segments, and cDNA first-strand was synthesized using the fragmented RNA as a template with six-base random hexamers. Then, buffer, dNTPs (dUTP instead of dTTP), RNase H, and DNA polymerase I were added to synthesize cDNA second-strand. The cDNA was purified using a QiaQuick PCR kit and eluted with EB buffer. End repair, addition of base A, and the addition of sequencing adapters were performed, followed by degradation of the second strand by UNG (Uracil-N-Glycosylase). Fragment size selection was performed using agarose gel electrophoresis, followed by PCR amplification. Finally, the constructed sequencing library was analyzed using Illumina HiSeq. TM Second-generation transcriptome sequencing was performed on the 4000 platform.

[0053] 3. Polymorphic site identification: To ensure data quality, the clean reads obtained after initial filtering are further filtered more rigorously to obtain high-quality clean reads for subsequent information analysis. The filtering steps are as follows: (1) Remove reads containing connectors; (2) Remove reads that are all A bases; (3) Remove reads containing more than 10% N; (4) Remove low-quality reads (the number of bases with a quality value of Q≤20 accounts for more than 50% of the total reads).

[0054] Tophat v2.1.1 (Trapnell C, Roberts A, Goff L, et al., 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols 7, 562-78.) software was used to align high-quality reads from each sample to a hexaploid reference genome sequence (Zhu, H., Wang, F., Xu, Z., Wang, G., Hu, L., Cheng, J., Ge, X., Liu, J., Chen, W., Li, Q., Xue, F., Liu, F., Li, W., Wu, L., Cheng, X., Tang, X., Yang, C., Lindsey, K., Zhang, X., Ding, F., Hu, H., Hu, X. and Jin, S. (2024) The complex hexaploid oil-Camellia genometraces back its phylogenomic history and multi-omics analysis of Camellia oilbiosynthesis. Plant Biotechnol. J., https: / / doi.org / 10.1111 / pbi.14412.). Unaligned sequences were removed, and the remaining sequences were used to identify SNP sites using bcftools v1.9 software (http: / / www.htslib.org / doc / bcftools.html). The identified SNP sites underwent rigorous filtering to obtain high-quality SNP data. The filtering criteria are as follows: (1) There are only 2 alleles at each locus; (2) Genotype deletion rate ≤ 20%; (3) Minimum allele frequency (MAF) ≥ 5%; (4) SNP quality value ≥ 100; (5) The number of homozygous genotype samples is greater than 10; (6) The heterozygous genotype sample rate is ≤70%.

[0055] Example 3: Screening of SNP molecular markers related to oil content in common camellia seed kernels 1. Group structure analysis: Principal component analysis (PCA) was performed on the natural population of Camellia oleifera using GCTA v1.25.2 (Jian Y, S Hong L, Goddard ME, Visscher PM, 2011.GCTA: a tool for genome-wide complex trait analysis. American Journal of Human Genetics 88, 76-82.). The first 10 principal components (PCs) were used as fixed effects for subsequent association analysis (Table 2).

[0056] Table 2. Top 10 PC values ​​of selected individuals in a natural population.

[0057] 2. Association Analysis: All SNP locus data, the top 10 PC values, phenotypic data (see Example 1), and Kinship matrix data were imported into IIIVmrMLM software. MLM analysis was used to analyze the linkage disequilibrium between SNPs and kernel oil content. SNP molecular markers significantly associated with kernel oil content were screened. After multiple validation corrections, two loci with extremely significant association with kernel oil content were detected. P <10 -5 (Table 1) These two loci are located in the intergenic region and intronic region of chromosome 25, and their contributions to the difference in oil content are 2.75% and 2.20%, respectively (Table 1).

[0058] Example 4: Application of the SNP molecular markers of the present invention in high-oil breeding of common camellia oleifera (1) Select a common Camellia oleifera hybrid F1 generation family as material (the maternal parent is 'Changlin 53' and the paternal parent is 'Changlin 40', both of which are nationally approved improved varieties with improved variety numbers 'Guo S-SC-CO-012-2008' and 'Guo S-SC-CO-011-2008' respectively), and collect young leaves to extract total genomic DNA according to the method in Example 2.

[0059] (2) Genomic DNA was amplified by PCR using the primers shown in SEQ ID NO.1-2 and SEQ ID NO.3-4. The reaction system is shown in Table 3.

[0060] Table 3 Reaction System

[0061] The PCR amplification program was as follows: 95℃, 3 min, 1 cycle for pre-denaturation; 95℃, 15 s for denaturation, 68℃, 45 s for extension, 40 cycles; 68℃, 5 min, 1 cycle for complete extension.

[0062] (3) PCR amplification products were subjected to gel detection, purification, recovery, sequencing, and genotyping. Gel detection and purification were performed according to the instructions of the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50). DNA was recovered from the gel, and the corresponding amplification primers were used as sequencing primers. The nucleotide sequence of the amplification products was determined by Sanger sequencing, and the genotype of each SNP site on the sequencing peak map was interpreted using Chromas software.

[0063] (4) Identify the genotypes of the two loci for each individual. Compare the relationship between the genotypes of each locus and the oil content.

[0064] When using SNP1 or SNP2 molecular markers alone for identification: if the genotype of any SNP locus is G / G, then the Camellia oleifera individual is a high-oil-content Camellia oleifera; if the genotype of any SNP locus is G / A, then the Camellia oleifera individual is a candidate for high-oil-content Camellia oleifera; if the genotype of any SNP locus is A / A, then the Camellia oleifera individual is a low-oil-content Camellia oleifera. When using SNP1 and SNP2 molecular markers for identification: if one of the two SNP molecular markers is G / G and the other is G / A heterozygous, or if both SNP molecular markers are G / A heterozygous, then the Camellia oleifera individual is a candidate for high oil content Camellia oleifera; if both SNP molecular markers are A / A, then the Camellia oleifera individual is a low oil content Camellia oleifera.

[0065] (5) Collect fully mature seeds from all F1 generation individuals and determine their kernel oil content (method as in Example 1). The results are shown in Table 4: A. Among individual plants with the high oil content genotype at Chr25_99591676, 80.39% of the individuals had a kernel oil content higher than the average kernel oil content of the population; among individual plants with the candidate high oil content genotype at Chr25_99591676, 68.50% of the individuals had a kernel oil content higher than the average kernel oil content of the population; among individual plants with the low oil content genotype at Chr25_99591676, only 42.86% of the individuals had a kernel oil content higher than the average kernel oil content of the population.

[0066] B. No oil content was detected in individual plants with the high oil content genotype at Chr25_126149650. Among individual plants with the candidate high oil content genotype at Chr25_126149650, 66.50% of the individual kernels had an oil content higher than the average oil content of the population kernels. Among individual plants with the low oil content genotype at Chr25_126149650, only 37.23% of the individual kernels had an oil content higher than the average oil content of the population kernels.

[0067] C. Among the individual plants with high oil content genotypes at the Chr25_99591676 locus and candidate high oil content genotypes at the Chr25_126149650 locus, 90.63% of the individuals had kernel oil content higher than the average kernel oil content of the population.

[0068] This indicates that the two SNP molecular markers of the present invention are effective in assisting selection. They can be used alone or in combination for early identification or auxiliary identification of oil content in common Camellia oleifera, which can greatly save production and breeding costs, improve selection efficiency, and accelerate the breeding process of high-oil Camellia oleifera.

[0069] Table 4. Kernel oil content and genotype data of F1 individual plants

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker associated with the oil content of common camellia seed kernels, characterized in that, The SNP molecular marker is selected from either the SNP1 molecular marker or the SNP2 molecular marker; The SNP1 molecular marker is located at position 99591676 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A; the SNP2 molecular marker is located at position 126149650 on chromosome 25 of the Camellia oleifera genome, with a base polymorphism of G / A; the version number of the Camellia oleifera genome is Changlin 40 V1.

0.

2. The SNP molecular marker according to claim 1, characterized in that, In SNP1 or SNP2 molecular markers, a genotype of G / G corresponds to high oil content; a genotype of G / A corresponds to a candidate for high oil content; and a genotype of A / A corresponds to low oil content.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, The SNP1 molecular marker is located at position 118 of the nucleotide sequence shown in SEQ ID NO. 5, and the base polymorphism is G / A; Alternatively, the SNP2 molecular marker is located at position 130 of the nucleotide sequence shown in SEQ ID NO.6, with a base polymorphism of G / A.

4. A combination of SNP molecular markers associated with the oil content of common camellia seed kernels, characterized in that, The SNP molecular marker combination includes SNP1 molecular markers and SNP2 molecular markers; The SNP1 and SNP2 molecular markers are as described in claim 1 or 3.

5. Primers for amplifying the SNP molecular markers of any one of claims 1 to 3 or the combination of SNP molecular markers of claim 4.

6. The primer according to claim 5, characterized in that, The primers include those shown in SEQ ID NO.1-2 and / or SEQ ID NO.3-4.

7. A reagent kit for identifying the oil content of common camellia seed kernels, characterized in that, It contains the primers described in claim 5 or 6.

8. The use of the SNP molecular marker of any one of claims 1 to 3, or the SNP molecular marker combination of claim 4, or the primer of claim 5 or 6, or the kit of claim 7, in at least one of the following aspects: (1) Identification of the oil content phenotype of common camellia seeds; (2) Identification, improvement or molecular marker-assisted breeding of common camellia oleifera germplasm resources; (3) Early prediction of oil content in common camellia seeds; (4) Screening common camellia with high oil content.

9. A method for identifying the oil content of common camellia seed kernels, characterized in that, include: Using the genomic DNA of the common camellia oleifera to be tested as a template, PCR amplification reaction was performed using primers for amplifying the SNP molecular markers described in any one of claims 1 to 3 or the SNP molecular marker combination described in claim 4, and the genotype of the oil content phenotype of the common camellia oleifera seed kernel was identified based on the genotype of the SNP molecular marker locus. Preferably, the reaction program for the PCR amplification reaction is as follows: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

10. The identification method according to claim 9, characterized in that, When using SNP1 or SNP2 molecular markers alone for identification: if the genotype of any SNP locus is G / G, then the Camellia oleifera individual is a high-oil-content Camellia oleifera; if the genotype of any SNP locus is G / A, then the Camellia oleifera individual is a candidate for high-oil-content Camellia oleifera; if the genotype of any SNP locus is A / A, then the Camellia oleifera individual is a low-oil-content Camellia oleifera. When using SNP1 and SNP2 molecular markers for identification: if one of the two SNP molecular markers is G / G and the other is G / A heterozygous, or if both SNP molecular markers are G / A heterozygous, then the Camellia oleifera individual is a candidate for high oil content Camellia oleifera; if both SNP molecular markers are A / A, then the Camellia oleifera individual is a low oil content Camellia oleifera.

Images