Method for enhancing synthesis capability of pigment products in double metabolic pathways of yeast and application of method
By mutagenesis and screening of the yeast global transcription factor SPT15, an engineered strain of Saccharomyces cerevisiae was constructed, which solved the problem of low efficiency in the synergistic regulation of heterologous metabolic pathways in yeast cells in traditional methods, and achieved rapid and efficient increase in the yield of dual pigments.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN UNIV
- Filing Date
- 2026-02-12
- Publication Date
- 2026-05-22
AI Technical Summary
Existing technologies cannot achieve synergistic regulation of two heterologous metabolic pathways by simply modifying yeast cells, resulting in traditional methods being cumbersome and inefficient, and unable to simultaneously increase the yield of both pigments.
By constructing an engineered strain of Saccharomyces cerevisiae and mutagenizing the global transcription factor SPT15, a mutant library was constructed. Yeast strains that can simultaneously increase the production of violacein and lycopene were screened out. Error-prone PCR was used to adjust the reaction system to achieve rapid screening.
The synergistic optimization of two heterologous metabolic pathways was achieved, shortening the strain construction cycle, reducing detection costs, successfully screening high-yielding dichromatin yeast strains, and significantly improving yield.
Smart Images

Figure CN122071671A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of synthetic biology and metabolic engineering, specifically to a method for enhancing the synergistic synthesis capacity of yeast cells through dual heterologous metabolic pathways by modifying global transcription factors, particularly for increasing the production of violacein and lycopene. Background Technology
[0002] Currently, traditional methods for producing edible pigments rely on plant extraction, which faces problems such as insufficient production capacity and environmental pollution. Utilizing microbial cell factories for biosynthesis offers a green and sustainable alternative. Saccharomyces cerevisiae, as a safe eukaryotic model microorganism, is an ideal substrate for producing natural pigments. However, rationally modifying yeast to increase pigment yield through traditional metabolic engineering strategies (such as overexpressing key genes and knocking out competing pathways) typically involves cumbersome manipulation of multiple genes, has a long construction cycle, and may impose a metabolic burden on cells, thus limiting its yield-increasing effect.
[0003] Global transcriptional machinery engineering is a method that remodels the whole-cell transcriptome by mutagenesis of global transcription factors, thereby triggering the evolution of complex traits. Previous studies have reported that mutagenesis of the global transcription factor SPT15 (encoding a TATA-binding protein) in Saccharomyces cerevisiae can improve the yeast's tolerance to substrates and its ability to synthesize certain single products.
[0004] However, there are currently no reports of applying such methods to synergistically regulate two independent heterologous metabolic pathways (such as the aromatic amino acid pathway and the terpene pathway) to simultaneously increase the production of two different pigments. Summary of the Invention
[0005] In view of this, the present invention provides a method and application for enhancing the ability of yeast to synthesize pigment products via a dual metabolic pathway.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for enhancing the ability of yeast to synthesize pigment products via a dual metabolic pathway includes the following steps: (1) Construct a brewer's yeast strain capable of simultaneously synthesizing violacein and lycopene; (2) A mutant library of the global transcription factor SPT15 in Saccharomyces cerevisiae was constructed using error-prone PCR technology; (3) Transform the SPT15 mutant library obtained in step (2) into the engineered strain constructed in step (1) to obtain the transformant library; (4) Based on the color intensity of the colonies, yeast strains that simultaneously increase the production of violacein and lycopene are visually screened from the transformant library of step (3).
[0008] Furthermore, in step (1), the engineered strain of Saccharomyces cerevisiae is constructed by integrating the lycopene synthesis pathway gene into Saccharomyces cerevisiae and introducing a plasmid carrying the violacein synthesis pathway gene.
[0009] Furthermore, the lycopene synthesis pathway genes include crtE, crtYB, and crtI; The complete sequence of the crtE, crtYB, and crtI expression cassette assembly is shown in SEQ ID NO: 1; The genes for the violacein synthesis pathway include vioA, vioB, vioE, vioD, and vioC; The vioA expression cassette sequence is shown in SEQ ID NO: 8; The vioB expression cassette sequence is shown in SEQ ID NO: 9; The vioE expression cassette sequence is shown in SEQ ID NO: 10; The vioD expression cassette sequence is shown in SEQ ID NO: 11; The vioC expression cassette sequence is shown in SEQ ID NO: 12.
[0010] Furthermore, in step (2), the error-prone PCR is achieved by adjusting the Mn2+ concentration, dNTP ratio, and selecting a low-fidelity DNA polymerase in the reaction system.
[0011] Furthermore, in step (4), the visualization screening specifically involves selecting transformants whose colony color is darker than that of the original engineered strain, extracting pigments after fermentation, and verifying the yield by measuring the yield using spectrophotometry.
[0012] A strain of *Saccharomyces cerevisiae* obtained by screening through a method of enhancing the ability of yeast to synthesize pigment products via a dual metabolic pathway, wherein the SPT15 gene of the strain contains a mutation and its production of violacein and lycopene is higher than that of the original engineered strain.
[0013] The application of the brewer's yeast strain in the simultaneous production of violacetin and lycopene.
[0014] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: This invention only requires mutagenesis and screening of a single global transcription factor SPT15 to simultaneously regulate two heterologous pathways, avoiding the cumbersome operation of modifying multiple pathway genes one by one in traditional methods, and greatly shortening the strain construction cycle (candidate strains can be obtained in 3-4 days).
[0015] This invention utilizes the property of dual-pigment products to color colonies, allowing for initial screening by directly observing the color intensity of colonies with the naked eye. It eliminates the need for expensive testing equipment and is a straightforward, rapid, and low-cost method.
[0016] This invention successfully screened mutant strains (such as mutant strain F-11) that can simultaneously increase the production of lycopene and violacein, demonstrating that synergistic optimization of different metabolic pathways can be achieved by perturbing global transcription, providing a new approach for the overall engineering of complex metabolic networks. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0018] Figure 1 This is a schematic diagram illustrating the principle of the technical solution of the present invention; Figure 2 The images show colony morphology diagrams. The left image shows the colony morphology of the unmodified Saccharomyces cerevisiae BY4742, and the right image shows the colony morphology of the dual-pathway engineered strain constructed in Example 1. Figure 3 This is an agarose gel electrophoresis image of the SPT15 gene and its homologous recombination components amplified by PCR in Example 2; Figure 4 This is an agarose gel electrophoresis image of the SPT15 mutant library constructed by error-prone PCR in Example 2; Figure 5 This is a plate image of yeast colonies obtained after transforming the SPT15 mutant library in Example 3; Figure 6 This is a color comparison diagram of the bacterial solution used to verify the initial screening strain in Example 4. Detailed Implementation
[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0020] Source of experimental materials: Saccharomyces cerevisiae BY4742: American Type Culture Collection (ATCC) strain, accession number 201389; Wild-type Saccharomyces cerevisiae S288c: American Type Culture Collection (ATCC) strain, accession number 204508; Escherichia coli cloning plasmid pUC57: purchased from Beijing Qingke Biotechnology Co., Ltd. (conventional Escherichia coli cloning plasmid); Yeast plasmid pRS413: American Type Culture Collection (ATCC) deposited plasmid, accession number 87518; Commercial Gibson assembly kit: purchased from Thermofisher Scientific.
[0021] All other unspecified experimental materials used in the examples are commercially available conventional products.
[0022] Example 1 Construction of dual-pathway engineered strains 1. Using *Saccharomyces cerevisiae* BY4742 as the starting strain. First, expression cassettes of lycopene synthesis pathway genes (crtE, crtYB, crtI) were integrated into specific sites in the genome via CRISPR-Cas9-mediated homologous recombination. The specific process is as follows: (1) Construction of crtE, crtYB, and crtI expression cassette assemblies: The full sequences of crtE, crtYB, and crtI expression cassette assemblies (with NotI restriction sites GCGGCCGC added on both sides) were synthesized by Qingke Biotechnology Co., Ltd., and cloned into pUC57 for storage respectively. The full sequence (7750bp) of the crtE, crtYB, and crtI expression cassette assembly is shown in SEQ ID NO: 1; (2) Using the genome of wild-type Saccharomyces cerevisiae S288c as a template, PCR amplification was performed; Amplify the "HO site integration left arm" using primers HO-Left-F and HO-Left-R: HO-Left-F: 5'-TCGTGATCCGCTAATCAGCGAC-3', as shown in SEQ ID NO: 2; HO-Left-R: 5'-GATGAATTGAATTGAAAAGCTGTGGTTCCCTACGCTCAAGGGCA-3', as shown in SEQ IDNO: 3; Amplify the "right arm of HO site integration" using primers HO-Right-F and HO-Right-R: HO-Right-F: 5'-ACATAATTCCAGCACGCAGC-3', as shown in SEQ ID NO: 4; HO-Right-R: 5'-TCGATCAAGGAGTATTGTGTCATGTTC-3', as shown in SEQ ID NO: 5; Amplify the "URA3 screening tag" using primers URA3-F and URA3-R: URA3-F: 5'-TGCCCTGAGCGTAGGGAACCACAGCTTTTCAATTCAATTCATC-3', as shown in SEQ ID NO: 6; URA3-R: 5'-GGGTAATAACTGATATAATTAAATTGAAGCTCTAATTTGTG-3', as shown in SEQ ID NO: 7.
[0023] (3) The expression cassettes of crtE, crtYB, and crtI were integrated into the genome through yeast transformation. The specific method was as follows: yeast cells were collected and treated with 0.1 M LiAc for 5 min. Then, 74 μL of mixed DNA (containing NotI-digested linearized fragments of the expression cassettes of crtE, crtYB, and crtI, the left arm of the HO site integration, the URA3 selection tag, and the right arm of the HO site integration) was co-incubated with 10 μL of salmon sperm vector DNA and 240 μL of PEG3350 and 36 μL of 1 M LiAc transformation mixture. The mixture was vortexed for 1 min to mix, and then incubated at 30°C for 30 min. The mixture was then plated on the corresponding defect-selection plate Sc-Lys-His and cultured at 30°C for 2-3 days. The full sequence of the fragment expected to be assembled and integrated into the HO site of the genome was SEQ "HO left arm-URA3 tag-crtE expression cassette-crtYB expression cassette-crtI expression cassette-HO right arm".
[0024] 2. Transform the yeast plasmid pRS413 (or its derivative plasmid) carrying the expression cassettes of violacein synthesis pathway genes (vioA, vioB, vioE, vioD, vioC) into the above-mentioned strain. The specific procedure is as follows: (1) Expression cassettes for vioA, vioB, vioE, vioD, and vioC were constructed respectively: The following sequences were synthesized by Qingke Biotechnology Co., Ltd. and cloned into the E. coli cloning plasmid pUC57 for storage: The vioA expression cassette sequence (2937bp) is shown in SEQ ID NO: 8; The vioB expression cassette sequence (4275bp) is shown in SEQ ID NO: 9; The vioE expression cassette sequence (1157bp) is shown in SEQ ID NO: 10; The vioD expression cassette sequence (1826bp) is shown in SEQ ID NO: 11; The vioC expression cassette sequence (2005 bp) is shown in SEQ ID NO: 12.
[0025] (2) In E. coli, linearized fragments of the plasmids containing vioA, vioB, vioE, vioD, and vioC were obtained by PCR amplification. Each fragment was then assembled into plasmid pRS413 (an E. coli-Saccharomyces cerevisiae shuttle vector plasmid, linearized by NotI digestion for assembly) using a commercial Gibson assembly kit. The assembly sequence in the resulting plasmid was “vioA expression cassette-vioB expression cassette-vioE expression cassette-vioD expression cassette-vioC expression cassette”.
[0026] Primer pair used to amplify the vioA expression cassette: vioA-F: 5'-GGGCCCCCCCTCGAGGTCGACGGTA-3', as shown in SEQ ID NO: 13; vioA-R: 5'- GAGTTGAAGTCAGGAATCTAAAATATATTCGAACTGCCCATTCAGCTTTTC-3', as shown in SEQ ID NO: 14; Primer pair used to amplify the vioB expression cassette: vioB-F: 5'-GAAAAGCTGAATGGGCAGTTCGAATATATTTTAGATTCCTGACTTCAACTC-3', as shown in SEQ ID NO: 15; vioB-R: 5'-ATAATCCAATACACCCACACCCACCGGAATCTGTGTATATTACTGCATCT-3', as shown in SEQ ID NO: 16; Primer pair used to amplify the vioE expression cassette: vioE-F: 5'-AGATGCAGTAATATACACAGATTCCGGTGGGTGTGGGTGTATTGGATTAT-3', as shown in SEQ ID NO: 17; vioE-R: 5'- CCAACCTGATGGGTTCCTAGATATAAAAGATGAGCTAGGCTTTTGTAAA-3', as shown in SEQ ID NO: 18; Primer pair used to amplify the vioD expression cassette: vioD-F: 5'-TTTACAAAAGCCTAGCTCATCTTTTATATCTAGGAACCCATCAGGTTGG-3', as shown in SEQ ID NO: 19; vioD-R: 5'-CCCGAAATTGTTCCTACGAGAAGTAACGAACGCAGAATTTTCGAGTTAT-3', as shown in SEQ ID NO: 20; Primer pair used to amplify the vioC expression cassette: vioC-F: 5'-ATAACTCGAAAATTCTGCGTTCGTTACTTCTCGTAGGAACAATTTCGGG-3', as shown in SEQID NO: 21; vioC-R: 5'-AAACAGCTATGACCATGATTACGCCAAG-3', as shown in SEQ ID NO: 22.
[0027] (3) Transform the above plasmids into yeast strains containing integrated crtE, crtYB, and crtI. The transformation method is as follows: collect yeast cells, treat with 0.1 M LiAc for 5 min, then co-incubate yeast cells with 74 μL of plasmid, 10 μL of salmon sperm vector DNA, 240 μL of PEG3350 and 36 μL of 1 M LiAc transformation mixture, vortex for 1 min to mix, incubate at 30℃ for 30 min, then spread the mixture on the corresponding defect screening plate Sc-Ura-His, and culture at 30℃ for 2-3 days.
[0028] 3. Select transformants; their colonies should exhibit the expected brownish-black color. Figure 2 Preliminary results indicate that a dual-pigment synthesis pathway of lycopene and violacein was successfully constructed in the same yeast strain, and the strain was named the "initial production strain" of the synthetic pigments.
[0029] Example 2 Construction of SPT15 mutant library Using Saccharomyces cerevisiae BY4742 genomic DNA as a template, PCR amplification was performed; The natural promoter of the SPT15 gene (500 bp) was amplified using primers SPT15-Pro-F and SPT15-Pro-R, as shown in SEQ ID NO: 23: SPT15-Pro-F: 5'-GAATTTGTACTTCTTTCGAAATCGTTCAAT-3', as shown in SEQ ID NO: 24; SPT15-Pro-R: 5'- GGCAGAGAGGGCATCCATAATTAAAAAAGTTTCTCTTGATACACC-3', as shown in SEQ ID NO: 25; The open reading frame (ORF, 723 bp) of the SPT15 gene was amplified using primers SPT15-ORF-F and SPT15-ORF-R, as shown in SEQ ID NO: 26: SPT15-ORF-F: 5'-GGTGTATCAAGAGAAACTTTTTTAATTATGGATGCCCTCTCTGCC-3', as shown in SEQ ID NO: 27; SPT15-ORF-R: 5'-GAAGTTCTCCTCGACCGTCGACTACCCCTTTCTAAACTCGTTCAAC-3', as shown in SEQ ID NO: 28; The terminator (500 bp) sequence of the SPT15 gene was amplified using primers SPT15-Ter-F and SPT15-Ter-R, as shown in SEQ ID NO: 29: SPT15-Ter-F: 5'-GGCCTTACGACGTAGTCGATGGGGAAGGAGTAGACGAAAAG-3', as shown in SEQ IDNO: 30; SPT15-Ter-R: 5'-ATGACAAGTGAGTTTAAAAAAGTGCTTACG-3', as shown in SEQ ID NO: 31.
[0030] Simultaneously, the LEU2 selection marker expression cassette (2235 bp) was amplified from the wild-type Saccharomyces cerevisiae S288C genome using primers LEU2-F and LEU2-R, as shown in SEQ ID NO: 32: LEU2-F: 5'-GTTGAACGAGTTTAGAAAGGGGTAGTCGACGGTCGAGGAGAACTTC-3', as shown in SEQ IDNO: 33; LEU2-R: 5'-CTTTTCGTCTACTCCTTCCCCATCGACTACGTCGTAAGGCC-3', as shown in SEQ ID NO: 34.
[0031] Electrophoresis results ( Figure 3 The size of each segment is displayed correctly.
[0032] The ORF region of SPT15 was amplified using an error-prone PCR system to construct a mutant library. The system contained: 0.5 mM MnCl2, 0.2 mM dATP / dTTP, 0.1 mM dCTP / dGTP, and low-fidelity Taq DNA polymerase. PCR products were detected by electrophoresis. Figure 4 The results showed a clear band at approximately 723 bp, indicating that the SPT15 mutant library was successfully obtained.
[0033] Example 3 Yeast transformation and initial colony screening The lithium acetate chemical transformation method was used: yeast cells were collected and treated with 0.1 M LiAc for 5 min. Then, 74 μL of all PCR fragments obtained in Example 2 (SPT15 ORF mutant library, SPT15 promoter, SPT15 terminator, LEU2 marker) were co-incubated with 10 μL of salmon sperm vector DNA and a transformation mixture of 240 μL PEG3350 and 36 μL 1 M LiAc. The mixture was vortexed for 1 min to mix, and incubated at 30°C for 30 min. The mixture was then plated onto the corresponding defect-selection plate (Sc-Leu) and cultured at 30°C for 2-3 days. The expected assembly and integration of the fragment into the genome was "SPT15 promoter-SPT15 ORF mutant library-LEU2 marker-SPT15 terminator". A large number of transformants grew on the plate, forming a colony library (…). Figure 5 By visual observation, dozens of clones with a color significantly darker than the surrounding and original colonies were selected and numbered (e.g., B5, F11, H5, etc.) for subsequent verification.
[0034] Example 4 Fermentation validation of high-yield strains The 22 clones with deepened color obtained from the initial screening in Example 3 and the initial production bacteria obtained in Example 1 were inoculated into liquid culture medium for small-scale fermentation (50 mL centrifuge tubes). After a certain fermentation time, the bacterial solutions showed different degrees of color difference ( Figure 6 ).
[0035] After fermentation, the bacterial cells were collected by centrifugation. For lycopene, DMSO was added and extracted in a 55°C water bath. The supernatant was collected by centrifugation, and the absorbance was measured at a wavelength of 472 nm. For violacein, methanol was added and extracted in a 75°C water bath. The supernatant was collected by centrifugation, and the absorbance was measured at a wavelength of 575 nm. The product concentration was calculated based on their respective standard curves.
[0036] The results are shown in Table 1. Some mutant strains showed significantly increased production of both pigments. Specifically, mutant strain F-11 produced 53.12 mg / L of lycopene and 0.147 mg / L of violacein. Compared to the original engineered strain, F-11 showed approximately 1.27-fold and 3.42-fold increases in lycopene and violacein production, respectively. These results demonstrate that the method of this invention successfully screened yeast mutant strains capable of synergistically enhancing pigment synthesis through dual pathways.
[0037] Table 1. Absorbance test results of pigment production via dual pathways in the screened strains.
[0038] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for enhancing the ability of yeast to synthesize pigment products via a dual metabolic pathway, characterized in that, Includes the following steps: (1) Construct a brewer's yeast strain capable of simultaneously synthesizing violacein and lycopene; (2) A library of Saccharomyces cerevisiae global transcription factor SPT15 mutants was constructed using error-prone PCR technology; (3) Transform the SPT15 mutant library obtained in step (2) into the engineered strain constructed in step (1) to obtain the transformant library; (4) Based on the color intensity of the colonies, the yeast strains that simultaneously increase the production of violacein and lycopene are visually screened from the transformant library of step (3).
2. The method according to claim 1, characterized in that, In step (1), the engineered strain of Saccharomyces cerevisiae is constructed by integrating the lycopene synthesis pathway gene into Saccharomyces cerevisiae and introducing a plasmid carrying the violacein synthesis pathway gene.
3. The method according to claim 2, characterized in that, The lycopene synthesis pathway genes include crtE, crtYB, and crtI; The complete sequence of the crtE, crtYB, and crtI expression cassette assembly is shown in SEQ ID NO: 1; The genes for the violacein synthesis pathway include vioA, vioB, vioE, vioD, and vioC; The vioA expression cassette sequence is shown in SEQ ID NO: 8; The vioB expression cassette sequence is shown in SEQ ID NO: 9; The vioE expression cassette sequence is shown in SEQ ID NO: 10; The vioD expression cassette sequence is shown in SEQ ID NO: 11; The vioC expression cassette sequence is shown in SEQ ID NO:
12.
4. The method according to claim 1, characterized in that, In step (2), the error-prone PCR is performed by adjusting the Mn content in the reaction system. 2+ This is achieved by adjusting the concentration, dNTP ratio, and using a low-fidelity DNA polymerase.
5. The method according to claim 1, characterized in that, In step (4), the visualization screening specifically involves selecting transformants whose colony color is darker than that of the original engineered strain, extracting pigments after fermentation, and verifying the yield by spectrophotometry.
6. A strain of *Saccharomyces cerevisiae* obtained by screening using the method described in any one of claims 1 to 5, characterized in that, The strain's SPT15 gene contains a mutation, and its production of violacein and lycopene is higher than that of the original engineered strain.
7. The use of the Saccharomyces cerevisiae strain of claim 6 in the simultaneous production of violacein and lycopene.