Plant disease resistance-related protein, its coding gene and application

Abstract

The present application discloses a plant disease resistance related protein, its coding gene and application. The protein provided by the present application is the protein shown in SEQ ID NO: 3. The nucleic acid molecule coding the protein also belongs to the protection scope of the present application. The present application also protects the application of the protein or the nucleic acid molecule in regulating plant disease resistance. The regulation is positive regulation. The present application also provides a method for cultivating a plant with improved disease resistance, comprising the following steps: introducing the nucleic acid molecule into a recipient plant to obtain a transgenic plant with improved disease resistance. The present application has important application and popularization value for cultivating new germplasm of plant disease resistance.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding and relates to plant disease resistance-related proteins, their encoding genes, and applications. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the world's major food crops, providing humans with 18% of their daily calorie and 19% of their protein intake. It is also my country's second largest staple food crop.

[0003] Every year, a large number of wheat fields in my country suffer from various diseases such as powdery mildew, stripe rust, and Fusarium head blight, and the situation is worsening annually, seriously threatening my country's wheat production security and sustainable agricultural development. Developing disease-resistant wheat varieties is the core objective of wheat breeding and the most economical and efficient way to address the threat of wheat diseases. Cloning disease-resistant genes and elucidating disease resistance mechanisms can provide valuable genetic resources and scientific theoretical guidance for wheat disease-resistant breeding.

[0004] Wheat autoimmune (WAI) mutants are the phenomenon in which the plant's own immune system is activated and produces a hypersensitive reaction (HR) in the absence of pathogens. WAI mutants exhibit a series of disease resistance characteristics, such as increased salicylic acid content, reactive oxygen species bursts, and increased expression of disease resistance-related genes, which can provide long-lasting broad-spectrum disease resistance. Therefore, they can serve as a potential genetic resource for broad-spectrum plant resistance breeding.

[0005] Currently, the breeding of broad-spectrum disease-resistant wheat varieties faces two major challenges: insufficient basic theoretical research and a lack of available gene resources. Therefore, it is urgent to further explore broad-spectrum disease-resistant gene resources in wheat, such as wheat immune self-activation resources, clone broad-spectrum disease-resistant genes and analyze related molecular mechanisms, so as to breed broad-spectrum disease-resistant wheat varieties and ensure my country's food production security. Summary of the Invention

[0006] The purpose of this invention is to provide plant disease resistance-related proteins, their encoding genes, and their applications.

[0007] The protein provided by this invention is as follows (a1) or (a2) or (a3) ​​or (a4):

[0008] (a1) The protein shown in SEQ ID NO: 3;

[0009] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0010] (a3) Proteins related to plant disease resistance obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1);

[0011] (a4) is a protein derived from wheat that shares more than 98% identity with (a1) and is associated with plant disease resistance.

[0012] The specific labels are shown in Table 1.

[0013] Table 1: Label Sequence

[0014]

[0015]

[0016] The nucleic acid molecules encoding the protein are also within the scope of protection of this invention.

[0017] The nucleic acid molecule is either a DNA molecule or an RNA molecule.

[0018] Specifically, the nucleic acid molecule is one of the following: (b1) or (b2) or (b3) or (b4) or (b5):

[0019] (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2;

[0020] (b2) The DNA molecule shown at positions 3132-6746 of SEQ ID NO: 1;

[0021] (b3) The DNA molecule shown in SEQ ID NO: 1;

[0022] (b4) A DNA molecule derived from wheat that has more than 95% identity with (b1) or (b2) or (b3) and that encodes the protein thereon;

[0023] (b5) A DNA molecule that hybridizes under stringent conditions with a nucleotide sequence defined by (b1) or (b2) or (b3) and encodes the protein.

[0024] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.

[0025] Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cells containing the aforementioned nucleic acid molecules are all within the scope of protection of this invention.

[0026] Specifically, the recombinant vector is a recombinant plasmid obtained by inserting the nucleic acid molecule into a plant expression vector. Specifically, the plant expression vector is the plant expression vector pCAMBIA1300 (the insertion site can be between the BamHI and HindIII restriction sites). Specifically, the plant expression vector is the plant expression vector pICSL86977OD (the insertion site can be a BsaI restriction site).

[0027] Specifically, the recombinant microorganism is a recombinant Agrobacterium obtained by introducing the recombinant vector into Agrobacterium. Specifically, the Agrobacterium is Agrobacterium EHA105 or Agrobacterium GV3101.

[0028] This invention also protects the application of the protein or nucleic acid molecule in regulating plant disease resistance. The regulation is positive; increased protein content enhances plant disease resistance. The regulation is also positive; increased expression of the nucleic acid molecule enhances plant disease resistance.

[0029] This invention also provides a method for cultivating plants with enhanced disease resistance, comprising the following steps: introducing the nucleic acid molecule into a recipient plant to obtain a transgenic plant with enhanced disease resistance. Specifically, the method involves introducing an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule into the recipient plant.

[0030] The present invention also provides a method for cultivating plants with enhanced disease resistance, comprising the following steps: increasing the content of the protein in the plant to obtain plants with enhanced disease resistance.

[0031] This invention also protects the application of any of the methods described above in plant breeding. Specifically, the purpose of the plant breeding is to cultivate plants with improved disease resistance.

[0032] The disease resistance described above refers to resistance to powdery mildew. The disease resistance described above refers to resistance to stripe rust. The disease resistance described above refers to resistance to both powdery mildew and stripe rust. The powdery mildew described above is a disease caused by powdery mildew fungus. Specifically, the powdery mildew fungus described above is physiological race E20 of powdery mildew.

[0033] Any of the plants described above may be monocotyledonous or dicotyledonous. Any of the plants described above may be members of the Poaceae family. Any of the plants described above may be members of the Triticum genus. Specifically, any of the plants described above may be common wheat. Specifically, any of the plants described above may be wheat.

[0034] This invention has significant application and promotion value for cultivating new plant germplasm resistant to disease. Attached Figure Description

[0035] Figure 1 Examples of photographs related to the results of Example 1.

[0036] Figure 2 Examples of phenotypic identification for Example 3.

[0037] Figure 3 This is an exemplary photograph of the disease resistance identification in Example 4.

[0038] Figure 4 This is an exemplary photograph of Example 4. Detailed Implementation

[0039] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0040] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all performed in triplicate, and the results are averaged.

[0041] The common wheat cultivar ZK331 (referred to as ZK331) is described in the following literature: WPA1 encodes a vWA domain protein that regulates wheat plant architecture. The Crop Journal, (2024).

[0042] Liangxing 99 (referred to as LX99): Hebei Approval No. 2004007; recorded in the following literature: Genetic analysis and detection of the gene MlLX99 on chromosome 2BL conferring resistance to powdery mildew in the wheat cultivar Liangxing 99; Theoretical and Applied Genetics, Volume 126, pages 3081–3089.

[0043] Fielder of common wheat is described in the following literature: A rare single nucleotide variant in Pm5econfers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.

[0044] Xuezao, a common wheat variety, is described in the following literature: A rare single nucleotide variantin Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.

[0045] Example 1: Obtaining wheat mutant M3405, and its phenotypic analysis and disease resistance identification.

[0046] The wheat mutant M3405 was obtained by EMS mutagenesis of common wheat Zhongke 331.

[0047] Under natural conditions, compared with common wheat variety Zhongke 331, wheat mutant M3405 exhibits the following differential phenotypes: leaf necrosis appears in mature plants, starting at the leaf tip and spreading towards the middle and base of the leaf. Laboratory cultivation revealed that the leaf necrosis phenotype in wheat mutant M3405 begins to appear in the seedling stage. Wheat mutant M3405 was crossed with common wheat variety Zhongke 331 to obtain F1 hybrid plants. The phenotype of the F1 hybrid plants is intermediate between that of wheat mutant M3405 and common wheat variety Zhongke 331. Exemplary photographs of wheat mutant M3405, common wheat variety Zhongke 331, and F1 hybrid plants are available in [link to photograph]. Figure 1 A. Exemplary photographs of mature leaves of wheat mutant M3405, common wheat Zhongke 331, and hybrid F1 plants are shown in [reference needed]. Figure 1 Examples of leaf images of seedlings of wheat mutant M3405, common wheat Zhongke 331, and hybrid F1 plants are shown in Figure B. Figure 1 C.

[0048] The wheat mutant M3405 and the common wheat Zhongke 331 were subjected to the following operations: leaves at the two-leaf-one-heart stage were taken and stained with diaminobenzidine (DAB staining) and trypan blue, respectively. An example photograph after DAB staining is shown below. Figure 1 An exemplary photograph of D. after trypan blue staining can be found in [reference needed]. Figure 1 E. It can be observed that: the necrotic areas on the leaves of wheat mutant M3405 were stained dark brown by DAB, indicating a burst of reactive oxygen species; the necrotic areas on the leaves of wheat mutant M3405 were stained blue by trypan blue, indicating that cell membrane permeability was disrupted. These results indicate that the leaves of wheat mutant M3405 produced a cell death response, meaning that wheat mutant M3405 is an autoimmune activation mutant (most autoimmune activation mutants exhibit varying degrees of increased resistance to pathogens due to immune autoactivation).

[0049] The powdery mildew resistance of wheat mutant M3405 and common wheat Zhongke 331 were identified (method described in step four of Example 3), and the results are shown below. Figure 1 F. The stripe rust resistance of wheat mutant M3405 and common wheat Zhongke 331 were identified, and the results are shown in […]. Figure 1 The results showed that the wheat mutant M3405 exhibited high resistance to both powdery mildew and stripe rust.

[0050] Example 2: Map-based cloning and discovery of trait-related proteins

[0051] A mapping population was constructed by crossing wheat mutant M3405 with common wheat Liangxing 99 as parents, and phenotypic analysis was conducted at the adult stage. The results are shown in Table 2 (χ²). 2 0.05,2 =5.99). Of the 309 families, 74 showed normal leaf characteristics, 159 showed leaf phenotypic segregation, and 76 showed leaf necrosis. Chi-square test results indicated that these proportions conformed to a 1:2:1 segregation ratio controlled by a single gene. The results suggest that the immune autoactivation phenotype in the wheat mutant M3405 is controlled by a semi-dominant single gene, which was named WAI-D3.

[0052] Table 2

[0053] combination generations total normal Separation Necrosis Expected value <![CDATA[χ 2 ]]> M3405 / LX99 <![CDATA[F 2:3 ]]> 309 74 159 76 1:2:1 0.288

[0054] To locate this gene, pooled sequencing (BSR-Seq) was performed using leaves from 30 homozygous normal plants and 30 homozygous leaf-necrotic plants in the F2 population. Based on the BSR-Seq results, molecular markers were developed using the Chinese spring reference genome sequence, ultimately pinpointing the WAI-D3 gene to the end of the long arm of wheat chromosome 2D, corresponding to a physical region of approximately 600 kb in the Chinese spring reference genome. The candidate region included 11 annotated genes. Sequence amplification analysis revealed that, compared to the wild type, only one gene in this region contained a T>C mutation in an intron and a C>T mutation in an exon, causing the 619th amino acid residue of the protein encoded by this gene to change from leucine (Leu) to phenylalanine (Phe). The sequences of the other 10 genes in the mapped region showed no difference.

[0055] Based on the above steps, the protein associated with the above phenotype in wheat mutant M3405 is shown in SEQ ID NO: 3. The coding frame of this protein in the cDNA of wheat mutant M3405 is shown in SEQ ID NO: 2. The gene encoding this protein in the genomic DNA of wheat mutant M3405 is shown in SEQ ID NO: 1 (wherein the start codon is shown at positions 3132-3134 of SEQ ID NO: 1, and the stop codon is shown at positions 6744-6746 of SEQ ID NO: 1).

[0056] Example 3: Functional Verification

[0057] I. Construction of recombinant plasmids

[0058] 1. Prepare the double-stranded DNA molecule shown in SEQ ID NO: 1.

[0059] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification using primer pair composed of F1 and R1, and recover the PCR amplification product.

[0060] F1: AATTTCGAGCTCGGTACCCGGG TGTCCCACACATGCATTGAGA ;

[0061] R1: TGTAAAACGACGGCCAGTGCCAA GGTACCGCGTATCCCTTCT .

[0062] 3. Take the plant expression vector pCAMBIA1300, and double digest it with restriction endonucleases BamHI and HindIII to recover the linear vector (about 9kb).

[0063] The plant expression vector pCAMBIA1300 is described in the following literature: A rare single nucleotide variant in Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.

[0064] 3. Using a homologous recombination kit, the PCR amplification product obtained in step 2 and the linear vector obtained in step 3 were used to prepare a circular plasmid, namely the recombinant plasmid pCAMBIA1300-WAI-D3. The recombinant plasmid pCAMBIA1300-WAI-D3 contains the DNA molecule shown in SEQ ID NO: 1.

[0065] Homologous recombination kit ( -Uni Seamless Cloning and Assembly Kit): TransGen Biotech Co., Ltd., catalog number CU101-01.

[0066] II. Preparation of transgenic plants

[0067] 1. The recombinant plasmid pCAMBIA1300-WAI-D3 was introduced into Agrobacterium EHA105 (Beijing Huayueyang Biotechnology Co., Ltd.) to obtain recombinant Agrobacterium.

[0068] 2. Using the Agrobacterium tumefaciens infection method, recombinant Agrobacterium tumefaciens was used to genetically transform the embryogenic callus of common wheat Fielder. The callus was then subjected to co-culture, screening culture, differentiation and regeneration culture and rooting culture in sequence to obtain regenerated plants, namely T0 generation plants.

[0069] 3. Take leaves from T0 generation regenerated plants, extract total DNA, and perform PCR identification. Plants with positive identification results are T0 generation transgenic plants.

[0070] PCR identification method: Using total DNA as a template, PCR amplification is performed using primer pair consisting of primers F2 and R2. If an amplification product of about 500 bp is displayed, the identification result is positive.

[0071] Primer F2 (corresponding to the vector backbone): agctcactcattaggcaccc;

[0072] Primer R2 (corresponding to the target gene): GATTCAACATAGAGCTCTCC.

[0073] 4. The T0 generation transgenic plants selected in step 3 are self-pollinated and the seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.

[0074] 5. Take leaves from T1 generation plants and perform PCR identification (method as in step 3). Plants with positive identification results are T1 generation transgenic plants.

[0075] 6. The T1 generation transgenic plants selected in step 5 are self-pollinated and the seeds are harvested. The seeds are then cultivated into plants, which are the T2 generation plants.

[0076] 7. Take leaves from T2 generation plants and perform PCR identification (method as in step 3). Plants with positive identification results are T2 generation transgenic plants.

[0077] Based on the results of steps 5 and 7, the following principle shall be followed for judgment: For a certain T1 generation transgenic plant, if all T2 generation plants obtained by self-pollination are PCR-positive transgenic plants, the T1 generation plant and its self-pollinated offspring constitute a homozygous transgenic line.

[0078] Three homozygous transgenic lines were obtained and named WAI-D3-T1-1, WAI-D3-T1-2 and WAI-D3-T1-3, respectively.

[0079] III. Preparation of plants with empty vector

[0080] Replace the recombinant plasmid pCAMBIA1300-WAI-D3 with the plant expression vector pCAMBIA1300, and follow the steps in step two to obtain the empty vector-transformed line.

[0081] IV. Phenotypic Identification

[0082] The tested plants were: T2 generation plants of the WAI-D3-T1-1 line, T2 generation plants of the WAI-D3-T1-2 line, T2 generation plants of the WAI-D3-T1-3 line, and Fielder common wheat plants.

[0083] The test plants were cultured under parallel conditions. All transgenic plants developed immune necrosis spots on their leaves at maturity, while the leaves of the common wheat Fielder plants showed normal results. Exemplary photographs of the plants are shown below. Figure 2 The above image shows an exemplary photograph of the blade. Figure 2 The image below.

[0084] V. Disease Resistance Identification

[0085] Powdery mildew is an airborne disease, primarily spread by conidia of the powdery mildew fungus (the causative agent) carried by air currents. The powdery mildew used in this example is physiological race E20 (referred to in the literature as "Bgt isolate E20"), described in the following reference: A rare single nucleotide variant in Pm5e confers powdery mildew resistance in common wheat. New Phytologist, Volume 228, Issue 3, November 2020, Pages 1011-1026.

[0086] The tested plants were: 12 T2 generation plants of the WAI-D3-T1-1 line, 12 T2 generation plants of the WAI-D3-T1-2 line, 12 T2 generation plants of the WAI-D3-T1-3 line, 12 common wheat Fielder plants, and 12 plants of empty vector-transformed lines.

[0087] 1. Sow seeds in plastic flower pots (10cm in diameter, 30 seeds per pot) and cultivate common wheat seedlings to the three-leaf stage. Place powdery mildew conidia above the leaves and shake them onto the leaves. Then, cultivate normally for 2 weeks. The flower pot at this time is called a mycelium propagation pot.

[0088] 2. Cultivate the test plants in plastic flower pots (30cm in diameter, 4 plants per pot) until the heading stage, referred to as test pots.

[0089] 3. Transfer the propagation pots and test pots to the same greenhouse room, and place four test pots radially around each propagation pot (the distance between the edges of the propagation pots and the test pots is 20cm). Incubate normally for 2 weeks. During the incubation process, manually brush away the powdery mildew spores on the plants in the propagation pots to promote their spread.

[0090] 4. After completing step 3, take photos and count the disease severity of the tested plants.

[0091] Disease severity assessment criteria: Record the percentage of powdery mildew spore mass area on the flag leaf relative to the total leaf area, using a 0-4 grading system. 0 indicates no spores; 1 indicates a spore mass area greater than 0 and less than or equal to 25% of the leaf area; 2 indicates a spore mass area greater than 25% and less than or equal to 50% of the leaf area; 3 indicates a spore mass area greater than 50% and less than or equal to 75% of the leaf area; and 4 indicates a spore mass area greater than 75% and less than or equal to 100% of the leaf area.

[0092] See example photos Figure 3 .

[0093] The disease severity grade of the T2 generation plants of the WAI-D3-T1-1 line was 1, the disease severity grade of the T2 generation plants of the WAI-D3-T1-2 line was 1, the disease severity grade of the T2 generation plants of the WAI-D3-T1-3 line was 1, the disease severity grade of the transgenic recipient common wheat Fielder plant was 3, and the disease severity grade of the empty vector line plant was 3. These results indicate that the transgenic plants exhibit good resistance to powdery mildew.

[0094] Example 4: Verification of Inducing Programmed Cell Death

[0095] I. Preparation of recombinant Agrobacterium

[0096] Suspension buffer: contains 10 mM MgCl2 and 0.2 mM AS, with the remainder being pH 5.6, 10 mM MES buffer.

[0097] Vector pICSL86977OD (plant cell vector pICSL86977OD): Bio-Sci Biotechnology, http: / / www.bio-sci.com.cn / index.php?id=59879.

[0098] The mutant WAI-D3 gene (i.e., the double-stranded DNA molecule shown in SEQ ID NO: 2) was inserted into the BsaI restriction site of the vector pICSL86977OD to obtain a mutant gene recombinant plasmid. The mutant gene recombinant plasmid was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was then suspended in suspension buffer to obtain a bacterial suspension, named WAI-D3 bacterial suspension (OD). 600 =0.4).

[0099] The wild-type WAI-D3 gene (different from the double-stranded DNA molecule shown in SEQ ID NO: 2 except that nucleotide 1855 is C) was inserted into the BsaI restriction site of the vector pICSL86977OD to obtain a wild-type recombinant plasmid. This wild-type recombinant plasmid was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was then suspended in suspension buffer to obtain a bacterial suspension named WAI-D3. WT Bacterial suspension (OD) 600 =0.4).

[0100] II. Inhibitory effect on plant immune response

[0101] 1. Take leaves of this type of tobacco, inject WAI-D3 bacterial suspension (50 μL) into one side of the petiole, and inject WAI-D3 into the other side of the petiole. WT Bacterial suspension (50 μL) was incubated for 24 hours.

[0102] 2. After completing step 2, observe the necrosis of the tobacco leaves.

[0103] See results Figure 4 Necrosis occurred around the injection site of the WAI-D3 bacterial suspension. WT No necrosis occurred around the injection hole of the bacterial suspension.

[0104] The results showed that the mutant protein encoded by the mutant WAI-D3 gene induced programmed cell death, while the wild-type protein encoded by the wild-type WAI-D3 gene did not induce programmed cell death.

[0105] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Proteins, in the following forms: (a1) or (a2) or (a3) ​​or (a4): (a1) The protein shown in SEQ ID NO: 3; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) Proteins related to plant disease resistance obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1); (a4) is a protein derived from wheat that shares more than 98% identity with (a1) and is associated with plant disease resistance.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule as described in claim 2, characterized in that: The nucleic acid molecule is one of the following: (b1) or (b2) or (b3) or (b4) or (b5): (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule shown at positions 3132-6746 of SEQ ID NO: 1; (b3) The DNA molecule shown in SEQ ID NO: 1; (b4) A DNA molecule derived from wheat that has more than 95% identity with (b1) or (b2) or (b3) and that encodes the protein thereon; (b5) A DNA molecule that hybridizes under stringent conditions with a nucleotide sequence defined by (b1) or (b2) or (b3) and encodes the protein.

4. An expression cassette, recombinant vector, recombinant microorganism, or transgenic plant cell containing the nucleic acid molecule described in claim 2 or 3.

5. The application of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 in regulating plant disease resistance.

6. The application as described in claim 5, characterized in that: The regulation is positive regulation; the disease resistance is resistance to powdery mildew and / or stripe rust.

7. A method for cultivating plants with enhanced disease resistance, comprising the following steps: introducing the nucleic acid molecule of claim 2 or 3 into a recipient plant to obtain a transgenic plant with enhanced disease resistance.

8. A method for cultivating plants with enhanced disease resistance, comprising the following steps: increasing the content of the protein of claim 1 in the plant to obtain plants with enhanced disease resistance.

9. The method as described in claim 7 or 8, characterized in that: The disease resistance refers to resistance to powdery mildew and / or stripe rust.

10. The application of the method according to any one of claims 6 to 9 in plant breeding.

Images