Phyllostachys edulis pe erf106 gene and application thereof in breeding for improving plant cellulose content and / or cell wall thickness
By cloning the PeERF106 gene of moso bamboo and overexpressing it in Arabidopsis thaliana and moso bamboo, the problem of regulating cellulose synthesis in bamboo breeding was solved, resulting in a significant increase in cellulose content and cell wall thickness, which improved the strength and stress resistance of bamboo and is applicable to the breeding of a variety of plants.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING FORESTRY UNIV
- Filing Date
- 2026-03-21
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are insufficient to effectively increase cellulose content and cell wall thickness in bamboo breeding, and cellulose synthesis regulatory genes are difficult to function stably in heterologous plants, resulting in low efficiency and unstable traits.
The PeERF106 gene of moso bamboo was cloned, an overexpression vector was constructed, and overexpression was performed in Arabidopsis thaliana and moso bamboo. Overexpression of the PeERF106 gene or its encoded protein significantly promoted cellulose accumulation and cell wall thickening, achieving precise regulation of cellulose content and cell wall thickness.
It significantly increases the cellulose content and cell wall thickness of plants, enhances the strength, durability and stress resistance of bamboo, and improves the ecological carbon sequestration capacity. It solves the problem of low efficiency in cellulose improvement in traditional breeding and is suitable for plants with different genetic backgrounds.
Smart Images

Figure CN122103295A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the PeERF106 gene sequence of moso bamboo and its application in regulating plant cellulose synthesis and plant root development. Background Technology
[0002] Cellulose, as a core structural component of plant cell walls, is a key factor determining the mechanical strength, stress resistance, and timber value of plants. This is especially true for renewable biomass materials like bamboo, which possess both ecological and economic value; cellulose content directly impacts their application potential and cultivation benefits. Through synergistic action with lignin, cellulose constructs robust secondary cell walls, not only providing the plant stems with the mechanical properties to support the above-ground parts but also forming a physical barrier against pathogen invasion and reducing water loss. Furthermore, it plays a crucial role in carbon storage and ecological restoration.
[0003] In the field of plant breeding, increasing the cellulose content of plants (especially bamboo) has clear practical value and strategic significance: First, increasing cellulose content can enhance the strength and durability of bamboo, optimize timber quality, and alleviate pressure on timber resources; second, the dense cell wall structure can improve bamboo's tolerance to abiotic stress and reduce management costs; third, its high carbon sequestration and soil and water conservation characteristics endow it with significant ecological benefits. Therefore, targeted increase of cellulose content has become an important goal in bamboo breeding, and it is of great significance for promoting the efficient utilization of renewable resources, ecological protection, and sustainable agricultural development.
[0004] With the development of molecular biology techniques, regulating the expression of cellulose synthesis-related genes through genetic engineering has become an important approach to improving plant quality. However, plant molecular breeding still faces significant technical bottlenecks: the genetic backgrounds of different plants vary greatly, the gene networks involved in cellulose synthesis pathways are complex and species-specific, and many identified cellulose regulatory genes often fail to function stably in heterologous plants, or may even lead to phenotypic deterioration due to genetic background compatibility issues. For bamboo, its genetic transformation system is not yet fully mature, and the cellulose synthesis regulation mechanism of bamboo itself differs significantly from that of model plants such as Arabidopsis and rice, making it difficult to directly apply cellulose regulatory genes screened from model plants to bamboo breeding. Furthermore, cellulose synthesis is closely related to traits such as lignin synthesis and secondary cell wall thickening, and heterologous expression of a single gene often fails to achieve precise regulation of target traits, further increasing the difficulty of targeted cellulose improvement in bamboo.
[0005] Therefore, discovering the key genes that regulate cellulose unique to bamboo, clarifying their functions and regulatory mechanisms, and developing molecular technologies suitable for bamboo breeding are of great significance for breaking through the species limitations of existing molecular breeding, achieving targeted improvement of bamboo cellulose content, and cultivating bamboo species with high timber value, strong stress resistance and excellent ecological functions. It can also provide new gene resources and technical references for improving the cellulose content of other plants. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a PeERF106 gene from moso bamboo (Phyllostachys edulis) and its application in regulating plant cellulose accumulation, cell wall thickening, and cultivating plant varieties with high cellulose content.
[0007] This invention clones the PeERF106 gene from moso bamboo, constructs an overexpression vector for this gene, establishes stable overexpression lines in Arabidopsis thaliana, and verifies transient overexpression in moso bamboo. Experiments including cellulose content determination, cell wall thickness observation, staining analysis, and gene expression detection confirm that the PeERF106 gene significantly promotes cellulose accumulation and cell wall thickening in plants. The PeERF106 gene encodes a protein with a specific amino acid sequence. This gene and its encoded protein can be directly applied to plant genetic engineering breeding, providing key gene resources and technical support for targeted enhancement of plant cellulose content, improvement of timber quality, and stress resistance. Considering codon degeneracy, modifications to the nucleotide sequence or optimization of the gene sequence to adapt to the codon preferences of different plants, without altering the amino acid sequence, are all within the scope of protection of this invention.
[0008] On the one hand, the present invention provides a protein that increases the cellulose content and cell wall thickness of plants, the amino acid sequence of which is shown in SEQ ID NO.2.
[0009] Furthermore, the present invention provides a gene for increasing plant cellulose content and cell wall thickness, the gene encoding a protein with the amino acid sequence shown in SEQ ID NO.2.
[0010] Preferably, the nucleotide sequence of the gene comprises the sequence shown in SEQ ID NO.1, or comprises a nucleotide sequence that is completely inversely complementary to the sequence shown in SEQ ID NO.1.
[0011] On the other hand, the present invention provides expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant tissues or transgenic plants containing the aforementioned genes.
[0012] On the other hand, the present invention provides the application of the aforementioned protein or gene or expression cassette, recombinant vector or recombinant microorganism in regulating plant cellulose content.
[0013] Furthermore, the regulation of plant cellulose content is achieved by overexpressing the aforementioned protein or gene to increase plant cellulose content, or by reducing the expression of the aforementioned protein or gene to decrease plant cellulose content.
[0014] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.
[0015] Furthermore, the plant is a species of the genus Arabidopsis or Phyllostachys.
[0016] Furthermore, the plant is Arabidopsis thaliana or bamboo.
[0017] On the other hand, the present invention provides the application of the aforementioned protein or gene or expression cassette, recombinant vector or recombinant microorganism in regulating plant cell wall thickness.
[0018] Furthermore, the regulation of plant cell wall thickness is achieved by overexpressing the aforementioned proteins or genes to increase plant cell wall thickness, or by reducing the expression of the aforementioned proteins or genes to decrease plant cell wall thickness.
[0019] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.
[0020] Furthermore, the plant is a species of the genus Arabidopsis or Phyllostachys.
[0021] Furthermore, the plant is Arabidopsis thaliana or bamboo.
[0022] On the other hand, the present invention provides the application of the aforementioned protein or the aforementioned gene or the aforementioned expression cassette, recombinant vector or recombinant microorganism in the cultivation of plant varieties with high cellulose content.
[0023] Furthermore, the cultivation of plant varieties with high cellulose content is achieved by overexpressing the aforementioned proteins or genes to obtain plant varieties with significantly higher cellulose content than wild-type varieties.
[0024] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.
[0025] Furthermore, the plant is a species of the genus Arabidopsis or Phyllostachys.
[0026] Furthermore, the plant is Arabidopsis thaliana or bamboo.
[0027] On the other hand, the present invention provides the application of the aforementioned protein or the aforementioned gene or the aforementioned expression cassette, recombinant vector or recombinant microorganism in the cultivation of plant varieties with thickened cell walls.
[0028] Furthermore, the plant varieties with thickened cell walls are obtained by overexpressing the aforementioned proteins or genes, resulting in plant varieties with significantly thicker cell walls than wild-type varieties.
[0029] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.
[0030] Furthermore, the plant is a species of the genus Arabidopsis or Phyllostachys.
[0031] Furthermore, the plant is Arabidopsis thaliana or bamboo.
[0032] On the other hand, the present invention provides a method for increasing the cellulose content and / or cell wall thickness of plant stems, comprising the following steps:
[0033] Increase the expression levels of the aforementioned proteins or genes in plants.
[0034] In a preferred embodiment, the method for increasing the cellulose content and / or cell wall thickness of plant stems is achieved by overexpressing the gene encoding the aforementioned protein in the plant.
[0035] In this invention, increasing cell wall thickness includes increasing secondary cell wall thickness and / or total cell wall thickness.
[0036] In this invention, overexpression refers to the process by which the transcriptional and / or translational levels of a target gene in a target plant cell or tissue are significantly higher than the basal expression levels of the gene in wild-type or control plants under the same conditions, achieved through genetic engineering methods such as exogenous gene introduction, endogenous gene activation, and enhancer utilization.
[0037] Compared with the prior art, the present invention has the following advantages:
[0038] 1) This invention cloned the PeERF106 gene of moso bamboo for the first time, clarified the function of the PeERF106 gene and its encoded protein, and proved that it can simultaneously regulate the accumulation of plant cellulose, cell wall thickening and activation of key genes in the cellulose synthesis pathway, providing a new functional gene target for the targeted improvement of plant cellulose.
[0039] 2) This invention provides a new method for precisely regulating plant cellulose content and cell wall thickness, namely, by overexpressing the PeERF106 gene or its encoded protein, a significant increase in cellulose content and effective thickening of the cell wall are achieved, solving the problems of low efficiency in cellulose improvement and unstable traits in traditional breeding.
[0040] 3) The PeERF106 gene is derived from moso bamboo and can function stably in both homologous plants (moso bamboo) and heterologous model plants (Arabidopsis thaliana), breaking through the bottleneck of gene function heterogeneity caused by differences in the genetic background of different plants, and has a wider range of applications.
[0041] 4) Plant varieties with high cellulose and thick cell walls cultivated using the genes and methods of this invention can significantly improve timber quality (mechanical strength and durability) and stress resistance (resistance to diseases and pests, lodging resistance, and drought resistance), while enhancing ecological carbon sequestration capacity, which meets the development needs of efficient utilization of renewable resources and ecological protection. Attached Figure Description
[0042] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0043] Figure 1 The figure shows the transcriptional level of the PeERF106 gene in two independent overexpression lines (OE-1, OE-2) and wild type (WT) detected by RT-qPCR.
[0044] Figure 2 The figures show the cellulose content in the stems of wild-type and PeERF106 overexpression lines; *P<0.05; **P<0.01; ***P<0.001 (two-tailed Student's t-test); error bars represent standard deviation (SD).
[0045] Figure 3 The results of Congo red staining on stem sections of wild-type and PeERF106 overexpressing lines are shown, indicating that the cellulose signal of the PeERF106 overexpressing lines is stronger (scale bar = 10 μm).
[0046] Figure 4 The image shows the quantitative analysis of cell wall thickness in the stems of wild-type and PeERF106 overexpressing lines based on scanning electron microscopy images (n=30); *P<0.05; **P<0.01; ***P<0.001 (two-tailed Student's t test); error bars represent standard deviation (SD).
[0047] Figure 5 The images show the cell wall characteristics of wild-type and PeERF106 overexpressing lines. Figure A shows the toluidine blue staining results of stem cross sections, indicating that the PeERF106 overexpressing lines stain more deeply (scale bar = 50 μm). Figure B shows the scanning electron microscope image of stem cross sections, indicating that the secondary cell walls of the PeERF106 overexpressing lines are thicker (scale bar = 10 μm).
[0048] Figure 6The figure shows the transcriptional level of the PeERF106 gene in wild-type (WT), empty vector control (EV), and five transient overexpression samples detected by RT-qPCR.
[0049] Figure 7 The figures show the cellulose content in the stem tissues of wild-type, empty vector control, and overexpression (OE) samples; *P<0.05; **P<0.01; ***P<0.001 (two-tailed Student's t-test); error bars represent standard deviation (SD).
[0050] Figure 8 The results of Congo red staining of stem sections from wild-type (WT) and two transient overexpression samples are shown, indicating that the cellulose signal of the PeERF106 overexpression line is stronger (scale bar = 10 μm).
[0051] Figure 9 The cell wall thickness was quantitatively analyzed based on scanning electron microscopy images in wild-type (WT) and two transiently overexpressed samples (n=30); *P<0.05; **P<0.01; ***P<0.001 (two-tailed Student's t-test); error bars represent standard deviation (SD).
[0052] Figure 10 The image shows the cell wall characteristics in wild-type (WT) and two transient overexpression samples. Figure A shows the toluidine blue staining results of stem cross sections (scale bar = 50 μm); Figure B shows the scanning electron microscope image of stem cross sections, showing that the total cell wall thickness of the overexpression samples is thicker than that of the wild-type, mainly due to secondary cell wall thickening (scale bar = 10 μm). Detailed Implementation
[0053] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0054] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0055] The nucleotide sequence of the PeERF106 gene from moso bamboo in this embodiment is shown in SEQ ID NO.1:
[0056] ATGGCGCCAAAGAGCTCGTCGCGAGCCGAGCACGAGGCTGGCAAGGGAGGCGGCGGTGGCTGCTGGGGGGCGGAGCCGAGGCTCCGCGGCGTGCGGAAGCGGCCGTGGGGCCGGTACGCGGCGGAGATCCGCGACCCGGCCAGGAAGACGCGCGTCTGGCTGGGGACCTTCGACACGGCCGAACAGGCCGCGCGGGCCTACGACGCCGCCGCGCGCCGGCTCCGCGGGCCTTCCGCCAGGACCAATTTCCCCGCTGCCGCCGTGCAGGCGGTGGCGCAGCCCGAGACGGCTACGGCGGTGAGCCTGAGTGGCAGCACCGTGGACGAGTCGTCGTTGTCGTTCCGGGACTCGCCGGTGGGGACGGCTGCGGCGGAATTCATGGCGCCTGTGTCGTTGGACCTGAGGCTGGGGAAGCCGACGGTGGTGGCCGCGCAGCCGTACCTGTTCCTGGACCCGAGGCTGGCGGTCACGATGGCTGTGACGGCACCAGCACCGTTCGCGCCGCCGAGCAGCCGGCATGCGGCGGCCGTGACGGGCAAGAAGGCGTGGGATGACGTGCAGAGTGACACGGGTTCGTCAGAGTCGTCAGTGGTGGACGCGGCGCCGGCGGTGGGCGTGGGGATCGACCTCAACCTGCCGCCGCCGGCCGAGATGGTGATGTAG
[0057] The amino acid sequence of the Phyllostachys edulis PeERF106 protein is shown in SEQ ID NO.2:
[0058] MAPKSSSRAEHEAGKGGGGGCWGAEPRLRGVRKRPWGRYAAEIRDPARKTRVWLGTFDTAEQAARAYDAAARRLRGPSARTNFPAAAVQAVAQPETATAVSLSGSTVDESSLSFRDSPVGTAAAEFMAPVSLDLRLGKPTVVAAQPYLFLDPRLAVTMAVTAPAPFAPPSSRHAAAVTGKKAWDDVQSDTGSSESSVVDAAPAVGVGIDLNLPPPAEMVM
[0059] Example
[0060] Example 1: Construction of a vector for overexpressing the PeERF106 gene from moso bamboo.
[0061] Based on the unigene sequence obtained from previous sequencing in our laboratory, a pair of specific primers, PeERF106-F (ATGGCGCCAAAGAGCTCGTC) and PeERF106-R (CTACATCACCATCTCGGCC), were designed. RNA was extracted from moso bamboo and reverse transcribed into cDNA. The moso bamboo was grown in a greenhouse at Nanjing Forestry University. The PCR amplification system consisted of 20 μL: 10 μL Prime STAR MaxPremix enzyme (TaKaRa, Dalian, China), 7 μL ddH2O, 1 μL template cDNA, and 1 μL each of forward and reverse primers. The PCR reaction program was as follows: 98 ℃ pre-denaturation for 3 min; 35 cycles: 98 ℃ denaturation for 10 s, 54 ℃ annealing for 30 s, 72 ℃ extension for 60 s; and 72 ℃ extension for 5 min. PCR products were recovered using a DNA recovery kit, ligated into the pMD19-T vector, transformed into *E. coli* DH5α competent cells, and single colonies were picked for PCR detection. Finally, plasmids were extracted and sequenced (GenScript, Nanjing, China). Specific recombination primers PeERF106-F2 (GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGGCGCCAAAGAGCTCGTC) and PeERF106-R2 (GGGGACCACTTTGTACAAGAAAGCTGGGTCGCATCACCATCTCGGCC) were designed based on the vector sequence and the PeERF106 gene sequence to amplify the PeERF106 gene. Subsequently, using the Gateway cloning system (Invitrogen), the overexpression vector pB2GW7-PeERF106 was generated through BP and LR recombination reactions.
[0062] Example 2: Obtaining and phenotypic analysis of PedERF106 transgenic Arabidopsis thaliana
[0063] (I) Obtaining transgenic Arabidopsis
[0064] The recombinant plasmid was sent to Nanjing GenScript Biotech Co., Ltd. (Nanjing, China) for sequencing. The recombinant plasmid pB2GW7-PeERF106, verified by sequencing, was introduced into *Agrobacterium tumefaciens* strain GV3101 using electroporation, and *Arabidopsis thaliana* was genetically transformed using the flower-dip method (Zhang et al., 2006). Transgenic positive seedlings were screened using 1 / 2 MS medium containing hygromycin (35 mg / L), followed by PCR amplification using specific primers (PeERF106-qF: GCCTTCCGCCAGGACCAATTTC; PeERF106-qR: CGACTCTGACGAACCCGTGTCACT). The expression level of PeERF106 in the positive transgenic lines was detected by RT-qPCR. RT-qPCR experiments were performed using the SYBR PreMix Ex Taq kit (TaKaRa, Dalian, China) on the Bio-Rad IQ5 real-time PCR platform. Amplification system: SYBRPreMix Ex Taq 10 μL, dd H2O 7.2 μL, cDNA 2 μL, forward and reverse primers 0.4 μL each. RT-qPCR reaction conditions: 95 ℃ for 30 s; 95 ℃ for 10 s, 60 ℃ for 20 s, 40 cycles; melting curve analysis range: 65 ℃-95 ℃, increasing by 0.5 ℃ every 5 s to verify amplification specificity. PeGADPH was used as an internal reference gene (Wu et al., 2016). Nine biological replicates were performed for each sample, based on 2... -ΔΔCT The relative gene expression levels were calculated (Pfaffl, 2001). Two different transgenic lines (OE-1 to OE-2) were selected for subsequent experiments. Figure 1 ).
[0065] (II) Quantitative analysis of cellulose content
[0066] Arabidopsis thaliana samples (wild-type and overexpression lines, approximately 1 cm above the rosette) were ground into a fine powder, incubated with 95% (v / v) ethanol at 65°C for 30 minutes, cooled to room temperature, and centrifuged. The precipitate was washed twice with 95% ethanol, followed by overnight extraction with methanol:chloroform (2:3, v / v). The precipitate was collected by centrifugation, washed five times with 95% ethanol, and dried at 65°C for 12 hours. 1 mg of the dried precipitate was added to 1 mL of 2M trifluoroacetic acid and hydrolyzed at 120°C for 90 minutes. After cooling, the precipitate was resuspended in 1 mL of Updegraff reagent (acetic acid:nitric acid:water, 8:1:2, v / v / v), heated at 100°C for 30 minutes, and cooled to room temperature. The resulting precipitate was air-dried, and 175 μL of 72% (v / v) sulfuric acid was added, incubated at room temperature for 30 minutes. Then, 825 μL of distilled water was added for dilution, and insoluble substances were removed by centrifugation. Cellulose content was determined using the anthrone colorimetric method: A series of diluted glucose standards and sample supernatants were mixed separately with freshly prepared anthrone reagent (2 mg / mL anthrone in concentrated sulfuric acid solution, w / v), incubated at 80°C for 30 minutes, and then cooled to room temperature. The absorbance was measured at 625 nm, and the cellulose content in the sample was calculated based on the standard curve plotted using glucose standards.
[0067] The results of cellulose content determination showed that, compared with wild-type plants, the cellulose accumulation in the stems of PeERF106 overexpression lines was significantly increased. Figure 2 Congo red staining further revealed increased cellulose content in the cell walls of the overexpressing lines. Figure 3 )
[0068] (III) Measurement of cell wall thickness
[0069] Arabidopsis thaliana stem segments were collected approximately 1 cm above the soil surface. Samples were fixed overnight at 4°C with 2.5% (v / v) glutaraldehyde (0.1 M phosphate-buffered saline PBS, pH 7.0), washed three times with 0.1 M PBS (15 min each time), followed by gradient ethanol dehydration (30%, 50%, 70%, 80%, 90%, 95%, 100%, 15 min for each gradient), and finally treated twice with 100% ethanol (20 min each time). After drying, the samples were sputter-coated with gold using a Cressington 108 automated coating system and observed using a GeminiSEM 360 scanning electron microscope. Cell wall thickness was quantified using ImageJ software in the scanning electron microscope images.
[0070] Cytological analysis of stem sections showed enhanced cell wall deposition in the overexpression lines: toluidine blue staining showed that the stems of the overexpression lines were stained more deeply and the cell walls were thicker; scanning electron microscopy confirmed that the secondary cell wall layer of the overexpression lines was significantly thickened (Figures 4-5).
[0071] Example 3: Transient expression and phenotypic analysis of PedERF106 in bamboo stems
[0072] (a) Transient expression of PedERF106 in bamboo stems
[0073] Following the method of Wang et al. (2024), Agrobacterium tumefaciens strain GV3101 carrying the recombinant vector pB2GW7–PeERF106 was cultured and resuspended in infection buffer. Agrobacterium was injected into newly germinated bamboo seedlings using a needle-puncture method: the hypocotyl region was punctured with a syringe equipped with a fine needle, and the bacterial solution was directly injected into the tissue. After infection, the seedlings were cultured in a greenhouse with a photoperiod of 16 hours light / 8 hours dark, and the temperature was maintained at approximately 26°C. When the aerial stem developed three internodes, the second internodes of transiently transformed plants and wild-type control plants were collected for phenotypic identification and molecular analysis. Figure 6 ).
[0074] (II) Quantitative analysis of cellulose content
[0075] The second internode of moso bamboo seedlings (wild type and overexpression lines) was sampled for analysis. The specific method was the same as in Example 2. The cellulose content analysis results showed that transient expression of PeERF106 significantly increased the amount of cellulose accumulated in the stem tissue of moso bamboo (Figure 7). Congo red staining results showed that the amount of cellulose deposition in the stems of the transformed lines increased (Figure 8).
[0076] (III) Measurement of cell wall thickness
[0077] A 3mm long stem segment from the midpoint of the second internode of bamboo seedlings (wild type and overexpression lines OE-1 and OE-4) was used for measurement. The specific method was the same as in Example 2. The results showed that toluidine blue staining revealed that, compared with the wild type, the stems of the PeERF106 expression lines were more deeply stained, and the cell walls were significantly thickened; scanning electron microscopy further confirmed the significant thickening of the cell walls, mainly the thickening of the secondary cell walls (…). Figure 9-10 ).
[0078] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.
Claims
1. A protein that increases the cellulose content and cell wall thickness of plants, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
2.
2. A gene for increasing plant cellulose content and cell wall thickness, characterized in that, The gene encodes the amino acid sequence shown in SEQ ID NO.
2.
3. An expression cassette, recombinant vector, recombinant microorganism, transgenic plant tissue, or transgenic plant containing the gene described in claim 2.
4. The use of the protein of claim 1, the gene of claim 2, or the expression cassette, recombinant vector, or recombinant microorganism of claim 3 in regulating plant cellulose content and / or cell wall thickness.
5. The application according to claim 4, characterized in that, The regulation of plant cellulose content is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant cellulose content, or by reducing the expression of the protein of claim 1 or the gene of claim 2 to decrease plant cellulose content. The regulation of plant cell wall thickness is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant cell wall thickness, or by reducing the expression of the protein of claim 1 or the gene of claim 2 to decrease plant cell wall thickness.
6. The use of the protein of claim 1, the gene of claim 2, or the expression cassette, recombinant vector, or recombinant microorganism of claim 3 in the cultivation of plant varieties with high cellulose content.
7. The application according to claim 6, characterized in that, The cultivation of plant varieties with high cellulose content is achieved by overexpressing the protein of claim 1 or the gene of claim 2.
8. The use of the protein of claim 1, the gene of claim 2, or the expression cassette, recombinant vector, or recombinant microorganism of claim 3 in the cultivation of plant varieties with thickened cell walls.
9. The application according to claim 8, characterized in that, The cultivation of plant varieties with increased cell wall thickness is achieved by overexpressing the protein of claim 1 or the gene of claim 2.
10. A method for increasing the cellulose content and / or cell wall thickness of plant stems, characterized in that, Includes the following steps: Overexpression of the protein of claim 1 or the gene of claim 2 in plants.